Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M608301200 on October 18, 2006

J. Biol. Chem., Vol. 281, Issue 50, 38871-38878, December 15, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/50/38871    most recent
M608301200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, L.
Right arrow Articles by Casida, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, L.
Right arrow Articles by Casida, J. E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Spontaneous Mobility of GABAA Receptor M2 Extracellular Half Relative to Noncompetitive Antagonist Action*

Ligong Chen{ddagger}, Kathleen A. Durkin§, and John E. Casida{ddagger}1

From the {ddagger}Environmental Chemistry and Toxicology Laboratory, Department of Environmental Science, Policy, and Management and the §Molecular Graphics Facility, College of Chemistry, University of California, Berkeley, California 94720

Received for publication, August 30, 2006 , and in revised form, October 6, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The {gamma}-aminobutyric acid type A receptor beta3 homopentamer is spontaneously open and highly sensitive to many noncompetitive antagonists(NCAs) and Zn2+.OurearlierstudyoftheM2cytoplasmic half (-1' to 10') established a model in which NCAs bind at porelining residues Ala2', Thr6', and Leu9'. To further define transmembrane 2 (M2) structure relative to NCA action, we extended the Cys scanning to the extra cellular half of the beta3 homopentamer (11' to 20'). Spontaneous disulfides formed with T13'C, L18'C, and E20'C from M2/M2 cross-linking and with I14'C (weak), H17'C, and R19'Con bridging M2/M3 intersubunits, based on single (M2 Cys only) and dual (M2 Cys plus M3 C289S) mutations. Induced disulfides also formed with T16'C, but there were few or none with M11'C, T12'C, and N15'C. These findings show conformational flexibility/mobility in the M2 extracellular half 17' to 20' region interpreted as a deformed beta-like conformation in the open channel. The NCA radioligands used were [3H]1-(4-ethynylphenyl)-4-n-propyl-2,6,7-trioxabicyclo[2.2.2]octane ([3H]EBOB) and [3H]3,3-bis-trifluoromethylbicyclo[2.2.1]heptane-2,2-dicarbonitrile with essentially the same results. NCA binding was disrupted by individual Cys substitutions at 13',14',16',17', and 19'. The inactivity of T13'C/T13'S may have been due to disturbance of the channel gate; I14'S and T16'S showed much better binding activity than their Cys counterparts, and the low activities of H17'C and R19'C were reversed by dithiothreitol. Zn2+ potency for inhibition of [3H]EBOB binding was lowered 346-fold by the mutation H17'A. We propose that NCAs enter their binding site both directly, through the channel pore, and indirectly, through the water cavity of adjacent subunits.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The GABAA receptor (GABAAR)2 of the ligand-gated ion channel (LGIC) superfamily (1, 2) is blocked by noncompetitive antagonists (NCAs) of widely diverse structures (3) including some of the most important insecticides (4) and, at another site, by Zn2+ (5). Complete mutational scanning of the 15 amino acids in the cytoplasmic half and adjacent regions of the M2 segments of the beta3 homopentamer (Ala-4 ' to Thr10')3 establishes that eight are directly or indirectly involved in NCA binding with Ala2', Thr6', and Leu9' of greatest importance (3). The extracellular half of the M2 segments (Met11' to Glu20') has a proposed NCA interaction site at S17'Cinan {alpha}1 subunit (6) and aZn2+ site at His17' and Glu20' in the beta3 subunit (5).

Disulfide trapping experiments with heteromeric receptors ({alpha}1beta1 or {alpha}1beta1{gamma}2) have helped to define the structure and mobility of the extracellular half of M2. The following cases of spontaneous or induced disulfide bond formation have been observed (in M2 unless stated otherwise): {alpha}112'C with several Cys mutants in the intrasubunit M3 (7); {gamma}214'C with both {alpha}115'C and {alpha}116'C and also {gamma}213'C and {alpha}113'C (8); {alpha}-beta or beta-beta spontaneous disulfide cross-linking at 17' and 20' (9); nonadjacent beta-beta disulfide bridging by beta120'C (10). These relationships indicate that the M2 segments can undergo significant rotational and translational movement.

The beta3 homopentamer is ideal for defining the open state channel structure relative to NCA action because it is self-assembling, spontaneously open, and symmetrical with high sensitivities to NCAs and Zn2+ (3, 11, 12). To further understand M2 structure and NCA action, here we have examined the role of the extracellular half of the M2 segments in NCA and Zn2+ binding involving site-directed mutagenesis with Cys, Ser, and Ala replacements in M2 and M3 using two NCA radioligands. The structural aspects were studied with SCAM (substituted Cys accessibility method) and disulfide trapping (3, 13). This investigation establishes the conformational flexibility of the extracellular half of M2 segments in the beta3 homopentamer and suggests that NCAs access their binding sites both directly, through the channel pore, and indirectly, through the interface of adjacent subunits. The relationships considered lead to a model of the beta3 homopentameric GABAA receptor M2 segments relative to NCA action (shown in Fig. 1).


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Mutagenesis, Transfection, and Expression—Alignment of M2, M3, and flanking sequences of various LGICs are shown in Fig. 2 (1, 3, 7, 14, 15). Single Cys mutations were introduced for the entire 10 residues Met11' to Glu20' of the beta3 M2 extracellular half. Four Ser mutations, i.e. T13'S, T14'S, N15'S, and T16'S, were generated for comparison with the corresponding Cys mutations. In addition, two Ala mutations, H17'A and E20'A, allowed further study of the sites of Zn2+ interaction. It was possible that the engineered M2 Cys might interact with the single endogenous Cys (Cys289) in M3. To avoid this possible complication, some dual mutations (13'C, 14'C, and 16'Cto 20'C) were generated with Cys replaced by Ser at position 289 to give Cys-less M3.


Figure 1
View larger version (35K):
[in this window]
[in a new window]

  		FIGURE 1.
Structural model of beta3 homopentameric GABAA receptor M2 segments relative to NCA action and interaction sites. For illustrative purposes one of the M2s of a functional pentameric channel has been removed. The pore-facing residues are considered to be -1',2',6',9',13',16',18', and 20'. The {alpha}-helical structure of -1' to 16' (red) becomes a more beta-like conformation for 17' to 20' (blue). Dotted lines represent cross-linking of M2 14',17', and 19' with M3 Cys289. EBOB binds primarily at 2' and 6', with enhancement by 9', largely below the narrower 9' to 14' gating region. Zn2+ binds at His17', and anesthetics and alcohol interact with Asn15'.

 


Figure 2
View larger version (23K):
[in this window]
[in a new window]

  		FIGURE 2.
Alignment of M2, M3, and the flanking sequences of various LGICs. The species considered are human for GABAAR and rat for glycine receptor (GlyR) {alpha}1, serotonin type 3A receptor (5-HT3AR), and nAChR {alpha}1. The subunit-specific number is given at the left for the first residue of each aligned sequence (7). Index numbers (see Footnote 3) for positioning in M2 are shown at the top. Pore-facing residues of GABAAR {alpha}1 and nAChR {alpha}1 subunits are shown in bold type (14, 15). In GABAAR beta3 the lightly shaded residues are proposed to face the channel lumen and the dark-shaded residues to form M2/M3 disulfide bonds (Ref. 3 and this study). In the nAChR, the boxed area (9' to 14') is the narrowest region of the channel pore identified by cryo-electron microscopy (1). In the GABAAR M3 region, the conserved endogenous Cys, indicated by an asterisk, is boxed for the beta3 Cys289 position, which was mutated to Ser in the dual mutants.

 
The human GABAA receptor beta3 homopentamer and a series of mutants thereof were expressed in insect Sf9 cells. The methods for site-directed mutagenesis of M2 -4' to 10', transfection, cell culture, and protein expression were discussed earlier (3, 12). Similar protocols were followed here for single mutations to Cys, Ser, or Ala of M2 11' to 20'. Preparation of dual mutations involved a two-step PCR-based mutagenesis method, i.e. first M2 Cys was introduced as a template, and then M3 Cys was mutated to Ser. For example, the first mutational primer introduced M2 H17'C (CAACCATCAACACCTGCCTTCGGGAGACCTTG), and the second primer generated the dual mutations M2 H17'C/M3 C289S (GACATGTACCTTATGGGCTCCTTCGTCTTTGTGTTCCTGG) (mutated genetic code underlined). All mutations were confirmed by double-stranded DNA sequencing.

Membrane Preparation, Western Blotting, and Radioligand Binding—The procedures for membrane preparation (500 x g supernatant; 100,000 x g pellet) and Western blotting (mouse anti-GABAA receptor beta2,3 chain monoclonal antibody; Chemicon International, Temecula, CA) were described previously (3, 12). NCA binding was determined with [3H]1-(4-ethynylphenyl)-4-n-propyl-2,6,7-trioxabicyclo[2.2.2]octane ([3H]EBOB) (3, 12, 16) or [3H]3,3-bis-trifluoromethylbicyclo[2.2.1]heptane-2,2-dicarbonitrile ([3H]BIDN) (3, 17) at 1 and 3 nM, respectively, in pH 7.4 buffer (see below) containing 100 mM NaCl with incubation for 90 min at 25 °C. Specific binding was 75-85% of total binding using 1 µM {alpha}-endosulfan or 3 µM unlabeled BIDN to determine nonspecific binding of [3H]EBOB and [3H]BIDN, respectively. The buffer was 3 mM NaH2PO4/1 mM K2HPO4 except with studies involving Zn + when 20 mM Tris-HCl was used to avoid precipitation.

Flow Cytometry Analysis—Flow cytometric analysis was used to determine receptor surface expression measured as membrane immunofluorescence (18). Sf9 cells were transfected with recombinant baculovirus for 48 h. Cells were harvested and washed with phosphate-buffered saline (PBS), and then 106 cells in 100 µl of PBS were incubated for 30 min on ice with anti-GABAAR antibody as described above or, as a negative control, with PBS only. After washing twice with PBS, Alexa Fluor 488 goat anti-mouse IgG (1:200) (Invitrogen Molecular Probe) was added to each sample on ice for 30 min. Following three washes with PBS, the fluorescence density was measured using a Coulter Elite instrument (Beckman-Coulter) and analyzed with WinMDI 2.8 software provided by Duke University (Durham, NC). The expression of beta3 homomer was evaluated as the mean fluorescence value.


Figure 3
View larger version (53K):
[in this window]
[in a new window]

  		FIGURE 3.
Baculovirus transfection efficiencies and protein expression levels of WT and single mutantbeta3 subunits. A, PCR analysis of recombinant efficiency showing virus incorporating beta3 cDNA at 2.3 kb. B, SDS-PAGE Western blotting analysis of protein expression level. Samples were treated with 10 mM DTT in sample buffer. C, flow cytometry showing surface expression of WT and T13'S mutant. Negative control (shaded) refers to proteins labeled with Alexa Fluor 488 goat anti-mouse IgG.

 


Figure 4
View larger version (32K):
[in this window]
[in a new window]

  		FIGURE 4.
Disulfide cross-linking profiles for single M2 mutations and dual M2 and M3 mutations for M11'CtoE20'C. Samples are untreated (spontaneous) without Cu:phen or DTT (-/-), treated with 100:200 µM

Cu:phen (oxidized) but not treated with DTT (+/-), or treated with Cu:phen and then reduced with 10 mM DTT (reduced) (+/+). Reactions were terminated with 10 mM N-ethylmaleimide and 1 mM EDTA before 10% SDS-PAGE/Western blotting analysis. The relationships shown in the representative Western blots were reproduced in three or more experiments with separate expression. WT shows no disulfide formation (3), similar to M11'C illustrated here.

 
Disulfide Cross-linking—Disulfide cross-linking profiles were determined for the single and dual mutants comparing spontaneous, oxidative, and reductive conditions (3, 7, 9). CuSO4 was prepared as a 100 mM stock solution in water and o-phenanthroline (Sigma) as a 200 mM stock solution in ethanol. CuSO4 and o-phenanthroline were freshly mixed to obtain the Cu:phen solution, which was added to samples to give a final concentration of 100:200 µM. For oxidation, membrane protein (100 µg) was incubated with Cu:phen for 5 min. Then the reaction was terminated by adding 10 mM N-ethylmaleimide and 1 mM EDTA. Following this treatment sequence, sample buffer (3) was added with or without 10 mM dithiothreitol (DTT). Finally, the cross-linked subunits were detected by immunoblotting. The results were compared with control samples without any treatment.

DTT Reduction, Cu:phen Oxidation, and NCA Binding—Membranes as described above were subjected to reduction and oxidation to determine the effect of the disulfide on receptor NCA binding activity. A similar procedure was used by others for cells with electrophysiology assay (7, 9). Samples were incubated with 10 mM DTT for 15 min or 100:200 µM Cu:phen for 5 min at room temperature. Samples with Cu:phen were also treated with 1 mM EDTA following oxidation to chelate the Cu2+ in solution. Controls were samples without any treatment. Finally, each sample was subjected to the [3H]EBOB binding assay. Activity values were expressed as percent of wild type (WT) binding level.

Sulfhydryl Modification and NCA Binding—2-Aminoethylmethanethiosulfonate hydrochloride (MTSEA+) (Toronto Research Chemical, North York, Canada) was used under previously described conditions (19) with analysis for its effect on [3H]EBOB binding. Briefly, selected Cys mutants (more than 30% WT binding level) and WT were labeled for 10 min at room temperature with 2.5 mM MTSEA+. Following incubation, each sample was centrifuged at 20,000 x g for 15 min and the supernatant removed completely. The pellet was resuspended in PBS and subjected to a binding assay.

Molecular Modeling—Disulfide cross-linking interactions were examined with the beta3 homopentamer model based on the homologous nAChR with {alpha}-helical structure throughout the transmembrane segments (3, 20). All modeling was done with Maestro 6.5 (Schrödinger LLC). The M2 residues from 11' to 20' were mutated to Cys and the distances measured between sulfur centers.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Mutagenesis, Transfection, and Expression—PCR analysis indicated a recombination efficiency of nearly 100% for all mutants (Fig. 3A) with their identities confirmed by sequencing. Western blotting established similar expression levels for each mutant (Fig. 3B). A faint dimer from T13'C was resistant to reduction. Similar transfection efficiencies and protein expression levels were also observed for dual M2 and M3 mutations, i.e. T13'C, I14'C, T16'C, H17'C, L18'C, R19'C, and E20'C with C289S (data not shown). Flow cytometry was used to further characterize protein localization and quantity with special respect to mutant T13'S (with little activity for NCA binding, as considered later) using non-fixed, transfected Sf9 cells (Fig. 3C). Mean fluorescence values were similar for the WT and mutant T13'S, i.e. values of 16.1 and 16.4, respectively. This result shows strong beta3 homopentamer surface expression, i.e. the mutation did not disturb the subcellular location of the homomer.

Disulfide Cross-linking Profiles—The 10 single Cys mutants (11' to 20') were exposed to ambient oxygen in the presence and absence of Cu:phen catalyst (Fig. 4). Mutants forming disulfide bonds were evident by conversion of some or most of the band at ~55 to ~130 kDa based on Western blot analysis. The WT (3) and the M11'C mutant did not form any disulfide bonds. There were no dimers formed at positions 12' and 15' without Cu:phen, but extremely weak dimers were induced by Cu:phen. T16'C formed a strong dimer with the oxidant. Five positions (T13'C, H17'C, R18'C, L19'C, and E20'C) formed disulfides spontaneously in the absence of Cu:phen, and there was some evidence of low spontaneous disulfide formation with I14'C. Cu:phen strongly increased the amount of dimer at these six positions, especially from 17' to 20', where only a small amount of monomer remained. The dramatic increase in dimer formation at 17' to 20' indicated that intersubunit disulfide bonds dominated compared with possible intrasubunit M2/M3 disulfides, which would make the free Cys less available. The effect of DTT reduction on dimer yield varied with the mutants. All of the dimers at about 130 kDa were almost completely reduced by DTT except for T13'C and E20'C with faint resistant bands. A similar observation has been noticed in the 6' position (3, 9).


Figure 5
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 5.
Effect of site-specific mutations (Cys, Ser, or Ala) on specific binding of [3H]EBOB and [3H]BIDN (asterisks designate positions of tritium labeling). Data are percent of WT ± S.D. (n ≥ 3). Brackets at bottom indicate two substitutions for the same position. Dual mutants refer to M2 as shown plus M3 C289S.

 


Figure 6
View larger version (25K):
[in this window]
[in a new window]

  		FIGURE 6.
Effect of DTT reduction and Cu:phen oxidation on [3H]EBOB binding. Samples involve no treatment (-/-/-), reduced with DTT (10 mM) (+/-/-), oxidized with Cu:phen (100:200 µM) (-/+/-), or oxidized with Cu:phen and then treated with EDTA (1 mM) (-/+/+). Data are percent of WT ± S.D. (n ≥ 3).

 
To determine M2/M2 versus possible M2/M3 intersubunit disulfide cross-bridging, dual mutants were generated by combining M3 C289S with M2 Cys mutants 13',14', and 16' to 20' (Fig. 4). The selection of mutants was based on the spontaneous or induced disulfide formation and spatiality to M3 Cys289 based on the GABAAR model (3). Dual M2 mutants 13',16', 18', and 20' showed strong spontaneous or oxidant-induced disulfide bond formation similar to that of the corresponding single Cys mutants establishing M2/M2 cross-linking. Spontaneous disulfide bond formation was greatly reduced in the dual Cys mutations 17' and 19', and the slight spontaneous dimer at single Cys mutant I14'C was also diminished indicating that spontaneous disulfide bond cross-linking by these M2 single Cys mutants largely involves M3 Cys289. However, for unknown reasons, oxidation also led to extensive protein loss at these three positions.

Effect of Site-specific Mutations on NCA Binding—The sitespecific mutations had very different effects on NCA binding. [3H]EBOB and [3H]BIDN gave essentially the same results (Fig. 5), indicating that they bind at the same site within the extracellular portion of the GABAAR as noted before for the cytoplasmic half (3). Five single Cys mutants (T13'C, I14'C, T16'C, H17'C, and R19'C) showed only 10-35% of WT activity. The remaining Cys positions (11',12',15',18', and 20') conferred binding activity more than 50% relative to the WT. Ser at 13' and 15' maintained similar activity to the Cys mutations, whereas Ser at 14' and 16' greatly enhanced activity relative to Cys. The seven M2/M3 dual mutations showed different patterns compared with their single M2 Cys counterparts. The binding activity of T13'C/C289S was the same as the single mutants T13'C and T13'S. Dual mutations I14'C/C289S and T16'C/C289S did not give the high activity of the corresponding Ser mutations I14'S and T16'S. On the other hand, H17'C/C289S and R19'C/C289S showed much better binding activity (60-70%) than the corresponding single Cys mutants (20-35%).

Effect of DTT Reduction and Cu:phen Oxidation on NCA Binding—Some single Cys mutants undergo partial spontaneous disulfide formation, which could affect [3H]EBOB binding and might be reversed with DTT or increased with Cu:phen. Any of these structural changes might either have no effect or alter [3H]EBOB binding. These relationships were further examined with the five single Cys mutants that undergo high spontaneous disulfide bond formation, i.e. 13',17',18',19', and 20' (Fig. 6); all other Cys mutants showed no significant increase in binding activity with treatment (data not shown). DTT at 10 mM had essentially no effect or slightly decreased the binding level of [3H]EBOB with WT, L18'C, and E20'C. T13'C with DTT showed an increased but still low level of binding. In contrast, mutants H17'C and R19'C showed greatly enhanced binding activity on the addition of DTT, with recovery to near the WT level. To check the effect of the oxidant, single Cys mutants 13' and 17' to 20' were treated with Cu:phen and EDTA. Before the addition of EDTA, Cu:phen inhibited the binding activity of WT, H17'C, L18'C, and E20'C about 15-40% but only slightly affected the binding of T13'C and R19'C. After the addition of EDTA to chelate the Cu2+ and withdraw the oxidative effect of Cu:phen, all of them returned almost to the binding levels without treatment. The stronger oxidative environment with Cu:phen did not reduce the binding level of these Cys mutants. DTT did not recover any significant activity for the seven dual mutants (data not shown).

Effect of Sulfhydryl Modification on NCA Binding of Single Cys Mutants—Membrane-impermeable MTSEA+ was used to explore the accessibility of M2 single Cys mutants to sulfhydryl modification. Mutants T13'C, I14'C, T16'C, and R19'C with less than 30% of WT [3H]EBOB binding activity could not be assessed accurately, but all others were examined (Fig. 7). MTSEA+ inhibited [3H]EBOB binding activity for the WT by 20%, but for mutants T12'C, N15'C, and L18'C the inhibition was more than 70%. The low inhibition (10-30%) for H17'C and E20'C may come from the strong, spontaneous, disulfide bond formation, but L18'C still could be modified by MTSEA+, indicating the greater availability of its free thiol moiety.


Figure 7
View larger version (23K):
[in this window]
[in a new window]

  		FIGURE 7.
Effect of MTSEA+ treatment on [3H]EBOB binding. Percent inhibition for each mutant is calculated as [1 - (specific binding after MTSEA+ treatment/specific binding without treatment)] x 100 ± S.D. (n ≥ 3). Mutants 13',14',16', and 19' are not included because of low specific binding (<30% of WT).

 


Figure 8
View larger version (31K):
[in this window]
[in a new window]

  		FIGURE 8.
Effect of three mutations on Zn2+ inhibition of [3H]EBOB binding. Control refers to absence of Zn2+. Nonspecific binding determined with 100 µM Zn2+ (WT, E20'A, and E182A) or 30 mM Zn2+ (H17'A). The binding assay was conducted in Tris buffer. Arrows and numbers designate IC50 values ± S.D. (µM) (n ≥ 3).

 
Effect of Zn2+ on NCA Binding—[3H]EBOB binding in the WT is very sensitive to Zn2+ (IC50 1.3 µM) (Fig. 8). In the beta3 subunit of the {alpha}1beta3 GABAA receptor, the Zn2+ binding site is reported as M2 His17' and Glu20' plus extracellular domain residue Glu182, which in turn is coordinated with the {alpha}1 subunit (5). These sites were therefore mutated by introducing Ala to give H17'A, E20'A, and E182A. H17'A and E182A retained 95-100% of the WT binding level, whereas E20'A reduced the binding activity to 60% of the WT. These mutations had very different effects on Zn2+ sensitivity of [3H]EBOB binding with IC50 values of 2.8 µM for Glu182, 5.7 µM for E20'A, and 450 µM for H17'A. The 346-fold IC50 increase for H17'A established that the blocking effect of Zn2+ mainly comes from occupying H17' instead of E20' or Glu182.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Proposed M2 Structure of Spontaneously Open beta3 Homopentameric Channel with High NCA Sensitivity—Findings are summarized in Table 1 and illustrated in Fig. 1 as a model for the proposed M2 structure and interaction sites. A detailed electrophysiological characterization of the functional beta3 homopentameric GABAAR has shown that this subunit forms a spontaneously open channel, which can be inhibited by picrotoxin (PTX) and Zn2+ and is insensitive to GABA (11, 21). The cytoplasmic end of the channel may act as a fixed fulcrum to open the narrow domain of the pore between 9' and 14' (1, 8, 22) with little change in conformation during gating (23). Low mobility and limited accessibility from 2' to 6' are evident for the beta1/3 subunit (3, 13). Disulfide cross-linking at the 9' position supports its role as an important component of the channel gate (3). The current investigation defines how NCAs access their binding site at the cytoplasmic end by studying the conformational flexibility of the M2 extracellular half.


View this table:
[in this window]
[in a new window]

  		TABLE 1
Effect of Cys mutations in M2 11' to 20' on disulfide cross-linking and NCA binding

 
Important Role of 11' to 16' Region Relative to the Channel Gate—The ease of disulfide bridging depends on the average distances of Cys residues, the orientation of thiol moieties, and the mobility/flexibility of the protein region (9, 24). Positions M11'C, T12'C, and N15'C, with little or no oxidant-induced disulfide formation, are probably not exposed in the channel lumen, although T12'C and N15'C can be accessed by sulfhydryl modification reagents (13). T13'C is the only position in the -1' to 16' region that spontaneously forms a strong disulfide bond, implying its flexibility in rapid opening and closing of the gate and/or the proximity of its thiol substituents in the narrowest region of the pore. The sulfurs in a disulfide bond are separated, center-to-center, by 2 Å (24), and those for T13'Con adjacent subunits are only 6.8 Å apart (Fig. 9) consistent with their spontaneous formation of a strong disulfide cross-link. Disulfide bonds also form spontaneously between {gamma}213'C and {alpha}113'C (8) but not at beta subunits (9). I14'C of the beta3 homopentamer gives very weak spontaneous disulfides associated with little M2 I14'C/M3 C289 cross-linking because of the considerably greater distance and unaligned orientation from M3 Cys289. Unaligned disulfides are also observed between {gamma}214'C and both {alpha}115'C and {alpha}116'C (8). Asn15' is not in the pore lumen and is important in alcohol or general anesthetic action (25). The induced but not spontaneous disulfide bond formation observed here with the beta3 homopentamer places Thr16' in the pore lumen consistent with a previous SCAM study (14), suggesting its relatively low mobility and longer sulfur-sulfur distance on adjacent M2, measured as 10.0 Å (Fig. 9).


Figure 9
View larger version (40K):
[in this window]
[in a new window]

  		FIGURE 9.
Sulfur-sulfur distances of Cys-mutated beta3 homopentameric GABAAR based on an {alpha}-helical frame. M2/M2 average distances are shown for 13' to 20' with the native side chains mutated to Cys using Maestro 6.5.

 


Figure 10
View larger version (46K):
[in this window]
[in a new window]

  		FIGURE 10.
NCA and anesthetics access pathways of Cys-mutated beta3 homopentameric GABAAR M2 segments. Cross-sectional view of the pore seen from the extracellular side, with transmembranes designated by colors: M1, red; M2 and M2/M3 loop, yellow; M3, green; M4, blue. M1-M4 are displayed as the C{alpha} trace. Some amino acids are not shown, for ease of visualization. Proposed pathways are: a, through the pore; b, through the water cavity of adjacent subunits; c, into the putative anesthetics binding pocket.

 
The M2 and M3 cross-links apparently yield only dimers but not trimers, quatermers, or pentamers. This finding is consistent with the observation that endogenous Cys289, both in WT (3) and M2 mutant M11'C (Fig. 4), does not form a spontaneous or Cu:phen-induced dimer or multimer, indicating that M3 Cys289 will not cross-link with itself. The major product from the mutated Cys in M2 and endogenous M3 Cys289 cross-linking is a dimer that probably "locks" the channel in an unfavorable conformation preventing further cross-linking to form multimers.

Conformational Mobility of 17' to 20' Region—The nAChRbased GABAAR model with an {alpha}-helical M2 structure places 17' and 20' in pore-facing positions (14, 20) and gives average M2/M2 sulfur-sulfur distances for 17',18',19', and 20' of 6.7, 13.6, 16.3, and 9.3 Å, respectively (Fig. 9). The pore-facing residues are spatially preferred to form disulfide bonds with relatively small movement asymmetrically (9), but this movement would rotate the non-pore-facing residues like 18' and 19' away from each other. However, all single Cys mutants in this region of the beta3 homopentamer form disulfide bonds spontaneously, to a similar extent. The strong and newly observed spontaneous disulfide formations at L18'C and R19'C are therefore not consistent with the helical conformation. The beta1 E20'C even forms a nonadjacent disulfide bond in the {alpha}1beta1{gamma}2 receptor, suggesting a possible structural difference from the nAChR in this region (10). The M2 H17'C/M3 Cys289 and M2 R19'C/M3 Cys289 intersubunit sulfur-sulfur distances are quite long, ranging from 18 to 27 Å (Fig. 10). The observed M2/M3 intersubunit bridging by H17'C and R19'C further indicates that they probably trap in different directions from L18'C and E20'C and face out of the channel lumen (Fig. 1). Their cross-linking would be greatly facilitated by a beta-like conformation, allowing closer proximity to the endogeneous M3 Cys.

We propose that in the beta3 homopentamer open channel, the 17' to 20' region assumes a beta-like conformation (Fig. 1) based on the disulfide formation profile. The extended deconformation structure, directly connected with the channel activation domain M2/M3 loop (22, 26) (Fig. 10), may help to open or widen the channel gate. GABA activation alters the access of a sulfhydryl modification reagent in the 17' to 20' region (13) implying a conformational change that relies on channel functional states. The nAChR {delta} subunit extracellular part of M2 undergoes a pronounced change between closed and open conormations (27). Significant backbone deformation occurs at positions 13',16', and 19' in nAChR {alpha} subunit M2 during channel gating (28). If LGICs in the closed state assume a well ordered {alpha}-helix structure (1), then the beta3 homopentamer may have undergone transition to a beta-like conformation in this region on channel opening. The proposed GABAAR beta-like conformation refers to the beta subunit only, because it is distinctive in flexibility and channel function relative to the {alpha} or {gamma} subunit (10, 29, 30).

NCA Interactions with the Extracellular Half—The nonpore-facing M11'C, T12'C, and N15'C had little effect on NCA binding and were not considered further here. Mutants T13'C and T13'S in the beta3 homopentamer showed dramatically reduced NCA binding. beta1T13'Ainan {alpha}1beta1 receptor does not respond to GABA and loses muscimol binding, suggesting its essential role in receptor function (29), possibly by disturbing the channel gate. L9' mutations change both the channel gating and NCA sensitivity (31), further indicating that NCA action is closely related with the gate domain. Cys mutations at Ile14' and Thr16' cause more damage than Ser on NCA binding, and DTT does not reverse the low binding activity; possibly the increased size of the Cys sulfur versus the Ser oxygen impedes NCA access to its binding site. With an {alpha}1beta1{gamma}2 receptor, a thiol-reactive probe related to the NCA fipronil irreversibly inhibits GABAinduced chloride current at a Cys-mutated 17' position of the {alpha}1 subunit (6). However, beta3 H17'A in the present study did not change the binding activity. Zn2+ binding affinity was sharply reduced by H17'A, consistent with earlier studies (5, 21, 32). The inhibition of [3H]EBOB binding by Zn2+ confirms M2 as the NCA target, but it is not clear whether the block is a direct or an allosteric effect (33).

The 17' to 20' region is particularly interesting relative to NCA binding. With the beta3 homopentamer, DTT reverses the low activity of single Cys mutants H17'C and R19'C but does not affect L18'C and E20'C, which have original high binding levels (Fig. 6), although these four single Cys mutants have similar levels of disulfide bond formation (Fig. 4). In contrast, disulfide formation at H17'Cinthe beta1 subunit of the {alpha}1beta1 receptor is much less damaging on Cl- conductance than that at E20'C (9). The blocking effect from M2/M3 intersubunit disulfide cross-linking by 17'C/Cys289 and 19'C/Cys289 indicates that the NCAs may prefer the exposed water cavity of 17' and 19' as an access pathway.

NCA Access to the Binding Site—The NCA PTX has been proposed to access its binding site either through open channels or with different efficacies through closed channels (34, 35). The present study suggests two pathways for NCA access to its beta3 homopentamer binding site at the cytoplasmic end of M2 (Fig. 10). One is directly through the pore and another one possibly through the water cavities between adjacent subunits, similar to the suggested general anesthetics binding pocket in the water crevice behind M2 (25). The M2 segments are well shielded from the lipid bilayer by an outer ring of the helices M1, M3, and M4 to form channel pore and water cavities around M2 (1) (Fig. 10). There is precedent for these proposals because access to the ligand binding site of G-protein-coupled receptors is via a water-filled crevice (36-39). The more cytoplasmic residues in M3 become available for modification by sulfhydryl reagents on GABA activation (40, 41). The challenge is to define how the NCA can reach its binding site at the cytoplasmic end of M2 through this novel pathway. As an alternative interpretation, M2/M3 disulfide formation from 17'C/Cys289 and 19'C/Cys289 may lock the channel pore in an unfavorable conformation for NCA binding. Similarly, disulfide bond formation at M2/M2 intersubunits or M2/M3 intrasubunit disrupts the channel conformation to alter the Cl- current (7-10). Although we cannot rule out this possibility, our new pathway suggestion has important implications for NCA access.

GABAA receptor noncompetitive antagonism is a complex phenomenon (34, 35, 42, 43). PTX can reach its site through both hydrophilic and hydrophobic pathways (34). It is suggested to bind at an allosteric site to stabilize a closed or desensitized state of the channel (35) or to bind to both use-dependent and use-independent sites in GABAA receptors (43). The overall inference is that channel opening is not an absolute requirement for PTX to reach its site. The complexity of NCA antagonism probably is related in part to the conformational mobility of the M2 extracellular half and multiple access pathways to the binding site.


   FOOTNOTES
 
* This work was supported by the William Mureice Hoskins Chair in Chemical and Molecular Entomology (to J. E. C.), NIEHS, National Institutes of Health, Grant ES08419 (to J. E. C.), and National Science Foundation Grant CHE-0233882 (to K. A. D.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Environmental Chemistry and Toxicology Laboratory, 114 Wellman Hall, University of California, Berkeley, CA 94720-3112. Tel.: 510-642-5424; Fax: 510-642-6497; E-mail: ectl{at}nature.berkeley.edu.

2 The abbreviations used are: GABA, {gamma}-aminobutyric acid; GABAAR, {gamma}-aminobutyric acid type A receptor; BIDN, 3,3-bis-trifluoromethylbicyclo[2.2.1]heptane-2,2-dicarbonitrile; Cu:phen, copper:phenanthroline; DTT, dithiothreitol; EBOB, 1-(4-ethynylphenyl)-4-n-propyl-2,6,7-trioxabicyclo[2.2.2]octane; LGIC, ligandgated ion channel; M1-M4, transmembranes 1-4; MTSEA+, 2-aminoethylmethanethiosulfonate hydrochloride; nAChR, nicotinic acetylcholine receptor; NCA, noncompetitive antagonist; PBS, phosphate-buffered saline; PTX, picrotoxin; WT, wild type. Back

3 Positions in the M2 segment are identified by a system of index numbers in which the absolutely conserved basic residue at the N-terminal end of M2 is numbered 0', i.e. GABAAR beta3 Arg250. Residues toward the C terminus are numbered 1',2', etc., and toward the N terminus are numbered -1', -2', etc. Back


   ACKNOWLEDGMENTS
 
We thank George Kamita of the University of California at Davis and Ann Fischer, Shannon Liang, and Rosa Hsieh of the University of California at Berkeley for valuable assistance.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Miyazawa, A., Fujiyoshi, Y., and Unwin, N. (2003) Nature 423, 949-955[CrossRef][Medline] [Order article via Infotrieve]
  2. Olsen, R. W., Chang, C., Li, G., Hanchar, H. J., and Wallner, M. (2004) Biochem. Pharmacol. 68, 1675-1684[CrossRef][Medline] [Order article via Infotrieve]
  3. Chen, L., Durkin, K. A., and Casida, J. E. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 5185-5190[Abstract/Free Full Text]
  4. Casida, J. E. (1993) Arch. Insect Biochem. Physiol. 22, 13-23[CrossRef][Medline] [Order article via Infotrieve]
  5. Hosie, A. M., Dunne, E. L., Harvey, R. J., and Smart, T. G. (2003) Nat. Neurosci. 6, 362-369[CrossRef][Medline] [Order article via Infotrieve]
  6. Perret, P., Sarda, X., Wolff, M., Wu, T.-T., Bushey, D., and Goeldner, M. (1999) J. Biol. Chem. 274, 25350-25354[Abstract/Free Full Text]
  7. Jansen, M., and Akabas, M. H. (2006) J. Neurosci. 26, 4492-4499[Abstract/Free Full Text]
  8. Bera, A. K., and Akabas, M. H. (2005) J. Biol. Chem. 280, 35506-35512[Abstract/Free Full Text]
  9. Horenstein, J., Wagner, D. A., Czajkowski, C., and Akabas, M. H. (2001) Nat. Neurosci. 4, 477-485[Medline] [Order article via Infotrieve]
  10. Horenstein, J., Riegelhaupt, P., and Akabas, M. H. (2005) J. Biol. Chem. 280, 1573-1581[Abstract/Free Full Text]
  11. Wooltorton, J. R. A., Moss, S. J., and Smart, T. G. (1997) Eur. J. Neurosci. 9, 2225-2235[CrossRef][Medline] [Order article via Infotrieve]
  12. Ratra, G. S., Kamita, S. G., and Casida, J. E. (2001) Toxicol. Appl. Pharmacol. 172, 233-240[CrossRef][Medline] [Order article via Infotrieve]
  13. Goren, E. N., Reeves, D. C., and Akabas, M. H. (2004) J. Biol. Chem. 279, 11198-11205[Abstract/Free Full Text]
  14. Xu, M., and Akabas, M. H. (1996) J. Gen. Physiol. 107, 195-205[Abstract/Free Full Text]
  15. Akabas, M. H., Kaufmann, C., Archdeacon, P., and Karlin, A. (1994) Neuron 13, 919-927[CrossRef][Medline] [Order article via Infotrieve]
  16. Cole, L. M., and Casida, J. E. (1992) Pestic. Biochem. Physiol. 44, 1-8
  17. Rauh, J. J., Benner, E., Schnee, M. E., Cordova, D., Holyoke, C. W., Howard, M. H., Bai, D., Buckingham, S. D., Hutton, M. L., Hamon, A., Roush, R. T., and Sattelle, D. B. (1997) Br. J. Pharmacol. 121, 1496-1505[CrossRef][Medline] [Order article via Infotrieve]
  18. Riby, J. E., Xue, L., Chatterji, U., Bjeldanes, E. L., Firestone, G. L., and Bjeldanes, L. F. (2006) Mol. Pharmacol. 69, 430-439[Abstract/Free Full Text]
  19. Slotboom, D. J., Konings, W. N., and Lolkema, J. S. (2001) J. Biol. Chem. 276, 10775-10781[Abstract/Free Full Text]
  20. O'Mara, M., Cromer, B., Parker, M., and Chung, S.-H. (2005) Biophys. J. 88, 3286-3299
  21. Wooltorton, J. R. A., McDonald, B. J., Moss, S. J., and Smart, T. G. (1997) J. Physiol. 505, 633-640[Abstract/Free Full Text]
  22. Unwin, N. (2005) J. Mol. Biol. 346, 967-989[CrossRef][Medline] [Order article via Infotrieve]
  23. Panicker, S., Cruz, H., Arrabit, C., Suen, K. F., and Slesinger, P. A. (2004) J. Biol. Chem. 279, 28149-28158[Abstract/Free Full Text]
  24. Careaga, C. L., and Falke, J. J. (1992) J. Mol. Biol. 226, 1219-1235[CrossRef][Medline] [Order article via Infotrieve]
  25. Hemmings, H. C., Jr., Akabas, M. H., Goldstein, P. A., Trudell, J. R., Orser, B. A., and Harrison, N. L. (2005) Trends Pharmacol. Sci. 26, 503-510[CrossRef][Medline] [Order article via Infotrieve]
  26. Absalom, N. L., Lewis, T. M., and Schofield, P. R. (2004) Exp. Physiol. 89, 145-153[Abstract/Free Full Text]
  27. Cymes, G. D., Grosman, C., and Auerbach, A. (2002) Biochemistry 41, 5548-5555[CrossRef][Medline] [Order article via Infotrieve]
  28. England, P. M., Zhang, Y., Dougherty, D. A., and Lester, H. A. (1999) Cell 96, 89-98[CrossRef][Medline] [Order article via Infotrieve]
  29. Dalziel, J. E., Birnir, B., Everitt, A. B., Tierney, M. L., Cox, G. B., and Gage, P. W. (1999) Eur. J. Pharmacol. 370, 345-348[CrossRef][Medline] [Order article via Infotrieve]
  30. Jensen, M. L., Timmermann, D. B., Johansen, T. H., Schousboe, A., Varming, T., and Ahring, P. K. (2002) J. Biol. Chem. 277, 41438-41447[Abstract/Free Full Text]
  31. Chang, Y., and Weiss, D. S. (1998) Mol. Pharmacol. 53, 511-523[Abstract/Free Full Text]
  32. Horenstein, J., and Akabas, M. H. (1998) Mol. Pharmacol. 53, 870-877[Abstract/Free Full Text]
  33. Gingrich, K. J., and Burkat, P. M. (1998) J. Physiol. 506, 609-625[Abstract/Free Full Text]
  34. Inoue, M., and Akaike, N. (1988) Neurosci. Res. 5, 380-394[CrossRef][Medline] [Order article via Infotrieve]
  35. Newland, C. F., and Cull-Candy, S. G. (1992) J. Physiol. 447, 191-213[Abstract/Free Full Text]
  36. Javitch, J. A., Li, X., Kaback, J., and Karlin, A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10355-10359[Abstract/Free Full Text]
  37. Javitch, J. A., Fu, D., Chen, J., and Karlin, A. (1995) Neuron 14, 825-831[CrossRef][Medline] [Order article via Infotrieve]
  38. Javitch, J. A., Fu, D., and Chen, J. (1995) Biochemistry 34, 16433-16439[CrossRef][Medline] [Order article via Infotrieve]
  39. Fu, D. Y., Ballesteros, J. A., Weinstein, H., Chen, J., and Javitch, J. A. (1996) Biochemistry 35, 11278-11285[CrossRef][Medline] [Order article via Infotrieve]
  40. Jung, S., Akabas, M. H., and Harris, R. A. (2005) J. Biol. Chem. 280, 308-316[Abstract/Free Full Text]
  41. Williams, D. B., and Akabas, M. H. (1999) Biophys. J. 77, 2563-2574
  42. Hawkinson, J. E., and Casida, J. E. (1992) Mol. Pharmacol. 42, 1069-1076[Abstract]
  43. Yoon, K. W., Covey, D. F., and Rothman, S. M. (1993) J. Physiol. 464, 423-439[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/50/38871    most recent
M608301200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, L.
Right arrow Articles by Casida, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, L.
Right arrow Articles by Casida, J. E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement