Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M605948200 on November 2, 2006

J. Biol. Chem., Vol. 281, Issue 52, 40440-40449, December 29, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
281/52/40440    most recent
M605948200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Uchiumi, T.
Right arrow Articles by Kohno, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Uchiumi, T.
Right arrow Articles by Kohno, K.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

YB-1 Is Important for an Early Stage Embryonic Development

NEURAL TUBE FORMATION AND CELL PROLIFERATION*Formula

Takeshi Uchiumi{ddagger}1, Abbas Fotovati§, Takakazu Sasaguri, Kohtaro Shibahara||, Tatsuo Shimada**, Takao Fukuda||, Takanori Nakamura||, Hiroto Izumi{ddagger}, Teruhisa Tsuzuki{ddagger}{ddagger}, Michihiko Kuwano§, and Kimitoshi Kohno{ddagger}

From the {ddagger}Department of Molecular Biology, University of Occupational and Environmental Health, School of Medicine, Yahatanishi-ku, Kitakyushu 807-8555, §Research Center for Innovative Cancer Therapy, Kurume University, Kurume, Fukuoka 830-0011, the Department of Pathology II, University of Occupational and Environmental Health, School of Medicine, Yahatanishi-ku, Kitakyushu 807-8555, the ||Department of Medical Biochemistry, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, **Health Sciences, School of Nursing, Faculty of Medicine, Oita University, Yufushi 879-5595, and {ddagger}{ddagger}Medical Biophysics and Radiation Biology, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan

Received for publication, June 21, 2006 , and in revised form, October 13, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The eukaryotic Y-box-binding protein-1 (YB-1) is involved in the transcriptional and translational control of many biological processes, including cell proliferation. In clinical studies, the cellular level of YB-1 closely correlates with tumor growth and prognosis. To understand the role of YB-1 in vivo, especially in the developmental process, we generated YB-1 knock-out mice, which are embryonic lethal and exhibit exencephaly associated with abnormal patterns of cell proliferation within the neuroepithelium. beta-Actin expression and F-actin formation were reduced in the YB-1 null embryo and YB-1-/- mouse embryonic fibroblasts, suggesting that the neural tube defect is caused by abnormal cell morphology and actin assembly within the neuroepithelium. Fibroblasts derived from YB-1-/- embryos demonstrated reduced growth and cell density. A colony formation assay showed that YB-1-/- mouse embryonic fibroblasts failed to undergo morphological transformation and remained contact-inhibited in culture. These results demonstrate that YB-1 is involved in early mouse development, including neural tube closure and cell proliferation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The Y-box protein family is characterized by a highly conserved cold-shock domain that binds nucleic acids and shares homology with the prokaryotic cold-shock proteins (1, 2). The human Y-boxbinding gene, YB-1, is located on chromosome 1p34 (1). YB-1 has multiple functions but was initially identified as a transcription factor that associates with the Y-box sequence of the major histocompatibility complex class II genes (3).

YB-1 promotes cell proliferation through its transcriptional regulation of target genes such as proliferating cell nuclear antigen (PCNA),2 epidermal growth factor receptor, DNA topoisomerase II{alpha}, thymidine kinase, and DNA polymerase {alpha} (4, 5). We previously reported its role in the transcriptional activation of human multidrug resistance 1 (MDR1) and DNA topoisomerase II{alpha} in response to various environmental stimuli (6, 7). In addition, it has been shown to chaperone RNA, modify chromatin, participate in the translational masking of mRNA, and be involved in stress responses such as the redox signaling pathway (8). Eukaryotic Y-box proteins also regulate gene expression at the translational level through their recognition of RNA (9-11), and therefore play critical roles in both mRNA turnover and translational control.

YB-1 protects mammalian cells from the cytotoxic effects induced by DNA damage. We previously reported that human cancer cell lines overexpressing YB-1 resist cisplatin, whereas the reduction of YB-1 itself leads to increased sensitivity to cisplatin, other DNA-interacting drugs, and UV irradiation (2). YB-1 is mainly localized in the cytoplasm, but translocates to the nucleus following UV irradiation of cells or treatment with anticancer drugs (12). YB-1 binds directly to repair-associated proteins such as PCNA and p53 (13), whereas proteolytic cleavage of the C-terminal fragment is linked to stress induced by DNA damage (14).

In clinical studies, the cellular level of YB-1 has been shown to correlate with tumor growth and prognosis in cancers of the ovary, lung, and breast (15). Moreover, overexpression or the nuclear presence or absence of YB-1 plays a critical role in P-glycoprotein expression, malignant progression, poor prognosis, and global drug resistance (2, 15, 16).

To understand how YB-1 proteins exert their multiple functions, we previously established mouse embryonic stem cell lines with a heterozygously targeted disruption of the YB-1 gene (YB-1+/-), and we demonstrated their hypersensitivity to cytotoxic agents such as cisplatin and mitomycin C (17).

Here we carried out targeted disruptions of the mouse YB-1 gene to elucidate the role of YB-1 molecules in vivo. We show that YB-1 plays a critical role in early development in mice. The targeted disruptions were fatal in the late embryonic stage, and animals showed defects in the anterior neural tube. Furthermore, we investigated the role of YB-1 in cell proliferation and the transformation activity of MEFs.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Animals—Animals were mated overnight, and the females were examined for a vaginal plug the following morning. Noon on the day of vaginal plug detection was recorded as day E0.5. All animal experiments were carried out according to the guidelines for animal experimentation at Kyushu University, Japan, and the University of Occupational Environmental Health, Japan. All experimental protocols were approved by the ethics committee of Kyushu University and the University of Occupational Environmental Health, Japan.

In Situ Hybridization—In situ hybridization of digoxygeninlabeled probes was performed as described previously (18). The digoxigenin-labeled hybridization probe was prepared from an in vitro transcription system (Promega, Madison, WI) using the mouse YB-1 full-length cDNA (11).

Generation of YB-1 (MSY-1)-deficient Mice—Embryonic stem cells were transfected with the linearized targeting construct that deleted exons 5 and 6 of mouse YB-1 (MSY-1) (17), and recombinant clones were selected and microinjected into C57BL/6 mouse blastocytes. Chimeric males that transmitted the mutant allele to the germ line were mated with C57BL/6 females, and germ line transmission of the mutant allele was confirmed by Southern blot analysis (17). Heterozygous offspring were intercrossed to produce homozygous mutant animals. For embryo genotyping, DNA was extracted from the corresponding embryonic tissue removed from microscope sections and amplified by 30 cycles of PCR at 94 °C for 30 s, 58 °C for 30 s, and 68 °C for 1 min using the following primers: YB5-1, 5'-GGAAACCATGTGGAGATGTC, and YB3-1, 5'-GGAGGTTCAAAAGCACACTC (wild-type allele); neo5, 5'-GATTGCACGCAGGTTCTCCG, and neo3, 5'-CAAGAAGGCGATAGAAGGCG (mutant allele).

Immunohistochemistry—Cells seeded the previous day on glass coverslips were washed with phosphate-buffered saline (PBS), fixed with 3.7% formaldehyde for 30 min, rinsed twice with PBS, and then incubated with PBS containing 0.1% Triton X-100 (Sigma) for 30 min. Next, the coverslips were washed with PBS, incubated with 10% goat serum for 1 h at room temperature in a humidified container, and then incubated for 1 h with FITC-conjugated phalloidin (Sigma). After washing three times with PBS, glass slides were mounted using Slowfade mounting medium (Molecular Probes). FITC-conjugated phalloidin (Sigma) was diluted 1:200 and used to detect F-actin organization in mouse tissue and MEF cells.

Immunoblot Analysis—Embryos (E11.5) and MEF cells were lysed with radioimmunoprecipitation (RIPA) buffer (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, and 1% Nonidet P-40) and subjected to immunoblot analysis as described previously (17) using polyclonal antibodies against YB-1 (19) and monoclonal antibodies against beta-actin (AC-15; Sigma), EF-1 (Upstate, Charlottesville, VA), p70 S6K (BD Biosciences), eIF4E (BD Biosciences), Akt (9272; Cell Signaling, Danvers, MA), and PCNA (sc-56, Santa Cruz Biotechnology, Santa Cruz, CA). Band intensities were measured by Image Gauge (Fujifilm, Tokyo, Japan).

Immunohistochemical Analysis of Mouse Embryo Sections—Mouse embryo tissue was fixed with 10% buffered formalin and embedded in paraffin. Sagittal sections (5 µm thick) were cut and mounted on silane-coated glass slides. After routine deparaffination and rehydration through gradient ethanol immersions, the slides were steam-heated for 20 min to expose the antigen. Endogenous peroxidase activity was quenched using 3% (v/v) H2O2 followed by three 5-min washes in PBS containing 0.2% (v/v) Triton X-100, and the sections were blocked with 10% (v/v) normal goat serum in PBS. Specimens were incubated for 1 h with the YB-1 and beta-actin antibody diluted in PBS containing 0.3% (v/v) Triton X-100 and 0.1% (w/v) bovine serum albumin, followed by three 5-min washes in PBS, and then incubation with the FITC-conjugated goat anti-rabbit antibody (Kirkegaard & Perry Laboratories, Gaithersburg, MD) for 30 min. Specimens were counterstained with hematoxylin for 30 s and washed with tap water. The sections were immediately dehydrated by sequential immersion in gradient ethanol and xylene, then mounted with Permount (ProSciTech, Australia), and coverslips. Images were obtained using a Leica DMRX upright microscope coupled with a digital camera (Leica, Germany).

Culture of Mouse Embryonic Fibroblasts (MEF)—Heterozygous male and female mutant mice were bred to obtain wild-type (YB-1+/+), heterozygous (YB-1+/-), and homozygous mutant (YB-1-/-) embryos. Mouse embryonic fibroblasts were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum. Outgrowths were inspected daily, and their development was monitored by photography.

Proliferation Assay—Cells (1 x 104) were seeded in triplicate in 35-mm dishes and grown under high serum (10% fetal bovine serum) conditions. Dishes were trypsinized and counted daily using a Coulter-type cell size analyzer (CDA-500, Sysmex, Kobe, Japan).


Figure 1
View larger version (36K):
[in this window]
[in a new window]

  		FIGURE 1.
Exencephaly in YB-1-/- embryos. A, PCR genotyping of yolk sac DNA from nine E11. 5 embryos. M, size marker. Bands of 650 bp of wild-type (WT) and 865 bp of mutant (disrupted) are shown. Total embryo protein (E11.5) was isolated, and the amount of YB-1 protein was determined by Western blotting using a polyclonal YB-1 antibody (lower panel). B, YB-1+/+ and YB-1-/- embryos at E11.5 to E14.5 stages of development. Exencephaly was observed in various embryonic stages of YB-1 null mice. Arrow indicates brain tissue outside of the calvarium in exencephalic embryos. C, YB-1+/+ and YB-1-/- embryos at E10.5 stage of development. YB-1-/- embryos show severe hemorrhage (bottom left panel) and anemia (bottom right panel) in comparison with wild-type embryos (top panels).

 
Transformation Assay—Cells (3 x 103) were seeded in triplicate in 10-cm dishes and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotic-antimycotic (Invitrogen). Growth medium was changed every 3 days. After 14-16 days, transformation efficiency was evaluated by counting individual foci. All transformation assays were repeated at least three times. Representative plates were stained with Giemsa and photographed.

Anchorage-independent Growth—Growth in soft agar was assayed in 35-mm dishes prepared with a lower layer of 0.7% agar (Invitrogen) overlaid with top agar (0.4%) containing 5 x 103 suspended cells. Cells were fed every 3 days with media. Fifteen days after plating, colonies were stained with 2% crystal violet, and colonies with >50 cells were counted on an inverted microscope (Olympus, Tokyo, Japan).

Knockdown Analysis Using siRNA—siRNA transfections were performed according to the manufacturer's instructions (Invitrogen). Briefly, cells cultured in 35-mm dishes were transfected with stealth RNA interference-negative control duplexes and YB-1 siRNA oligonucleotides (CAACGUCGGUAUCGCCGAAACUUCA) at a final concentration of 100 µM using Lipofectamine 2000 (Invitrogen). After transfection, cell number and cell volume were quantified using an electronic sizing technique with a CDA-500 Coulter-type cell size analyzer (Sysmex). Cells were also harvested for Western blotting (17).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Disruption of YB-1 Causes Embryonic Lethality—To elucidate the function of YB-1 during mouse development, we used gene targeting to generate YB-1-deficient mice. Although the heterozygous offspring appeared normal and fertile (Table 1), Southern blot analysis of tail DNA from 3-week-old mice revealed that no live animals (of 144 births from heterozygote crosses) were homozygous for the YB-1 mutation. Thus, loss of YB-1 results in embryonic lethality.


View this table:
[in this window]
[in a new window]

  		TABLE 1
YB-1 deficiency causes embryonic lethality

Embryos at the indicated stages were isolated from intercrosses of heterozygous animals, and the total numbers (n) of intact as well as disintegrated or resorbed embryos were counted. For calculation of % expected (–/–): n(–/–) x 100 x 3/n(+/+) + n(+/–).

 
To determine the time at which the YB-1 mutant becomes lethal, we examined embryos from YB-1+/- intercrosses at various developmental stages. PCR genotyping data of nine mouse embryos at E11.5 revealed two wild-types, five heterozygotes, and two homozygous mutants, in accordance with the expected Mendelian ratio (Fig. 1A and confirmed by PCR with four additional primer sets; data not shown). In contrast to wild-type embryos, the growth of YB-1-/- embryos appeared retarded as early as E10.5 (Fig. 1B). Most YB-1-/- embryos had been resorbed by E17.5 and YB-1-/- embryos died between E14.5 and E18.5 (Table 1). The phenotype of YB-1-/- embryos includes retarded growth, hemorrhage, and severe anemia but is otherwise normal in appearance (Fig. 1C).

Mouse YB-1 Is Expressed in Most Tissues during Embryogenesis—We reported previously that human YB-1 is expressed ubiquitously in the adult (19). The YB-1 transcript and protein have also been detected in mouse embryonic stem cells (17). To determine whether the expression of mouse YB-1 is developmentally regulated, we performed in situ hybridization on mouse embryos tissue sections at E13.5. We found that mouse YB-1 mRNA is expressed at whole body, specifically at high levels in the brain region (Fig. 2, A and B). Expression in the brain is widespread, with some enrichment in the cortical plate, diencephalons (thalamus), roof of the neopallial cortex, and choroid plexus extending into lateral ventricle, midbrain, and cerebellar primordium (Fig. 2B). YB-1 mRNA is also strongly expressed in the posterior mesoderm, the craniofacial region, root ganglion, kidney, liver, head mesoderm, and in the developing heart (Fig. 2B). These data support a critical role for YB-1 expression during embryonic development.


Figure 2
View larger version (85K):
[in this window]
[in a new window]

  		FIGURE 2.
YB-1 expression in embryonic tissues. A, nonradioactive in situ hybridization of wild-type E13.5 mouse embryos with antisense or sense YB-1-specific probes shows that YB-1 is expressed in the whole embryo region. Sense, negative control; H&E, hematoxylin and eosin staining. Scale bar = 2 mm. B, in situ hybridization of wild-type E13.5 embryos showing expression of YB-1 in mouse organs. Left panel, scale bar = 100 µm. Right panel, scale bar = 20 µm. C, immunohistochemistry showing YB-1 expression in wild-type and YB-1 null E13.5 embryos. No staining was observed in the ganglion of the YB-1-/- mouse. Scale bar = 100 µm.

 
YB-1 protein expression in E13.5 embryos is almost ubiquitous, with high expression detected in the central nervous system, lung, kidney, and heart (Fig. 2C). YB-1 was predominantly localized to the cytoplasm region in wild-type embryos. No expression was detected in either connective tissues or bone of wild-type embryos and was absent from YB-1-/- embryos (Fig. 2C).

Neural Tube Closure Is Impaired in YB-1-deficient Mice—As shown in Fig. 1B, YB-1-/- embryos were smaller than their wild-type littermates, although no gross abnormalities were observed in organ or limb development. When examined at E10.5 to E13.5, ~30% of the YB-1-/- embryos exhibited exencephaly in the forebrain, midbrain, and hindbrain regions (12/80 YB-1-/- embryos) (Fig. 1B). Almost all of the mutant embryos were pale and anemic, as a consequence of severe blood loss through hemorrhage (seen as petechial and paintbrush patterns in Fig. 1C).


Figure 3
View larger version (48K):
[in this window]
[in a new window]

  		FIGURE 3.
Neural tube defects in YB-1 mutant mice. A, histological profile of sagittal sections at E10.5 showing exencephaly and defective development of cephalic area in mutant embryos. hb, hindbrain; mb, midbrain; ne, neuroepithelium. Scale bar = 1 mm. B, histological profile of whole E11.5-13.5 embryo frontal sections stained with hematoxylin and eosin staining showing severe disturbance of cephalic area in exencephalic embryos. YB-1-/- mutants exhibit open neural tubes. Scale bar = 200 µm. C, cross-sections of wild-type and YB-1-/- E12.5 to E13.5 mouse embryos showing defective neural tube closure. YB-1-/- mouse embryos were surrounded by the everted neuroectoderm of the midbrain and hindbrain. 3rdV, third ventricle; LV, lateral ventricle; mv, mesencephalic vesicle; po, pons. Scale bar = 1 mm. D, sagittal sections of wild-type and YB-1-/- E14.5 to E15.5 mouse embryos showing defective neural tube closure and exencephalic phenotype of the mutant embryo (upper right panel). Some YB-1-/- embryos (bottom center panels) exhibit anterior brain structure, skull closure, and size comparable with wild-type littermates. ms, mesencephalon; me, medulla; te, telencephalon; di, diencephalon; sp, spinal cord. Scale bar = 1 mm. E, sagittal sections of wild-type and YB-1-/- E14.5 to E15.5 mouse embryos showing smaller liver size of the mutant embryo (right panel). Erythrocytes (arrow) are present in YB-1+/+ liver region, but not in YB-1-/- liver (lower panel).

 
Histological analysis of other parts of the mutant embryos revealed that the YB-1 mutation does not affect organogenesis, because all major organs were intact (data not shown). Exencephaly typically reflects a defect in closure of the anterior neural tube, which normally occurs between E8.5 and E9.5 (20). Fig. 3 showed a severe brain malformation characterized by exencephaly, expanded midbrain, and a disrupted cortical zone. Examination of older embryos (E13.5 to E15.5) revealed that the mutant brains failed to develop further.

Frontal and cross-sections of the hindbrain region of the E11.5 to E13.5 neural tube defect (NTD) embryos clearly demonstrate incomplete neural tube closure (Fig. 3, B and C), and the anterior neural tubes of most E10.5 to E11.5 YB-1-/- embryos failed to close with varying degrees of severity. No other cranial or neural tube abnormalities such as holoprosencephaly or impaired caudal neural closure were observed. Those YB-1-/- mice that achieved skull closure also possessed major brain structures but demonstrated retarded development of the maxilla and mandible (Fig. 3D). Most E15.5 YB-1-/- embryos had a subcutaneous edema of the whole body (Fig. 3D), which was not observed in wild-type and heterozygous mice. Moreover, fetal livers of YB-1-/- embryos were smaller than those of their YB-1+/- and YB-1+/+ littermates, which is suggestive of hepatic hematopoiesis (Fig. 3E). YB-1-/- embryos were also anemic as a result of macroscopically detectable defects in erythropoiesis of the fetal livers (Fig. 3E). These data suggest that exencephaly, smaller size of organ, and severe hemorrhage account for the embryonic lethality of the YB-1 mutation.

Enhanced EF-1 Expression in YB-1-/- Embryos—Using whole-cell extracts of eight E11.5 mouse embryos (YB-1+/+ (n = 1), YB-1+/- (n = 5), and YB-1-/- (n = 2)), the expression of other proteins involved in the regulation of translation was examined by immunoblotting. Western blotting using antibodies against the YB-1 N- and C-terminal ends revealed that E11.5 YB-1-/- embryos did not express either the full-length or the truncated YB-1 protein (Fig. 4A; data not shown). YB-1+/- embryos expressed ~70-80% as much YB-1 as wild-type embryos. The expression of the serine/threonine protein kinase p70 S6K (S6K) was slightly reduced in YB-1 null embryos compared with wild-type and heterozygous embryos, whereas human eukaryotic translation initiation factor 4E (eIF4E), Akt, and PCNA expression was unchanged. However, translational elongation factor-1 (EF-1) was overexpressed in YB-1-/- embryos, which might reflect a compensatory mechanism.

Decreased Proliferation in YB-1-/- MEFs—To examine the molecular basis of YB-1 in cellular proliferation, we established MEFs from wild-type (n = 4), YB-1+/- (n = 4), and YB-1-/- (n = 4) embryos from three independent litters at E13.5. Heterozygous MEFs (numbers 2, 56, 72, and 73) expressed approximately half as much YB-1 as wild-type MEFs, whereas YB-1 null MEFs (numbers 3, 60, 74, and 75) expressed no YB-1. PCNA expression was comparable between all MEFs (Fig. 4B).

During the first three passages, cell proliferation and population doubling was comparable between YB-1+/+, YB-1+/-, and YB-1-/- MEFs. From passages 4 to 5 onward, all YB-1-/- MEFs analyzed showed greatly reduced proliferation and a reduction in cell numbers under base-line culture conditions (Fig. 4C). YB-1+/- and YB-1+/+ MEFs proliferated at a similar rate. YB-1-/- MEFs exhibited premature senescence and an extended crisis as determined by an enlarged and flattened cell morphology (Fig. 5B). After 100 days of culture, YB-1-/- MEF cells showed reduced cell proliferation and density, which could be completely recovered to wild-type levels by expression of the YB-1 vector (Fig. 4D). YB-1 expression from this vector was confirmed by Western blotting (Fig. 4B). These data demonstrate the importance of YB-1 in cell proliferation and maintaining cell morphology.

NTD and Actin Assembly—NTDs involving mutations in genes that regulate actin arrangement at the cell membrane or play alternative roles in actin synthesis have been reported previously (21). In all cases, the defects included exencephaly caused by a failure of cranial neural fold elevation, as observed in the YB-1-/- embryos. In addition, YB-1 has been shown to associate with beta-actin mRNA and the actin protein (11, 22). We used immunofluorescence to investigate whether beta-actin synthesis and rearrangement are affected in E13.5 YB-1-/- embryos, and we showed that beta-actin protein levels were greatly reduced in the cephalic region of the YB-1 null embryo, in comparison with the wild type (Fig. 5A).

Phalloidin staining of E13.5 brain sections revealed a substantially decreased accumulation of F-actin along the basal edge of neuroepithelial cells in the null mutant embryo compared with the wild type (Fig. 5B). These data suggest that the reduced beta-actin levels and F-actin filament formation might be responsible for the NTDs of YB-1-/- embryos. In some mutant animals, a reduced apical constriction of the neuroepithelial cells within this region was also observed.

We next examined the role of YB-1 in cell morphology and organization of the actin cytoskeleton. Wild-type MEFs had an elongated morphology and an F-actin-rich polarized cytoskeleton. In contrast, YB-1-/- MEFs were round in shape, with lower cell density (Fig. 5B). Most strikingly, mutant cells lacked appreciable F-actin structures such as fibers or bundles. Instead, a small amount of F-actin was seen as a fuzzy phalloidin signal that was consistently found in the subcellular region rather than in the cell perimeter (Fig. 5B). These results show that YB-1 is essential for organizing F-actin and maintaining the cell shape of MEFs.

As YB-1 possesses RNA binding activity and has been shown to regulate protein synthesis and mRNA stability (11, 23), we next investigated the interaction of YB-1 with beta-actin mRNA. An in vitro RNA gel shift assay was performed using purified recombinant YB-1 and a probe corresponding to full-length beta-actin mRNA. Recombinant YB-1 clearly bound to beta-actin mRNA, whereas the control glutathione S-transferase protein failed to do so (supplemental Fig. 1A). To determine whether the interaction occurs in vivo, we performed reverse transcription-PCR using beta-actin-specific primers on mRNA isolated by co-immunoprecipitation with YB-1. beta-Actin transcript was amplified from wild-type but not from YB-1-/- MEFs (supplemental Fig. 1B), suggesting that YB-1 indeed interacts with beta-actin mRNA in MEFs. This interaction might regulate the activity or availability of beta-actin in protein synthesis.


Figure 4
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 4.
Elevated EF-1 expression in YB-1-/- embryos and decreased growth of YB-1-/- MEFs. A, Western blot analysis of protein expression in E11.5 embryonic mouse tissues. Total protein derived from eight PCR-genotyped mouse embryo tissues (50 µg of protein per lane) was immunoblotted using a specific antibody against YB-1, EF-1, p70 S6K, eIF4E, Akt, and PCNA. Elevated levels of EF-1 were observed in YB-1-/- MEFs (lanes 3 and 5). Relative band intensity (%) is presented. B, establishment of MEFs. Western blot analysis of YB-1 and PCNA expression levels after establishment of immortalized, PCR-genotyped MEF clones (left panel) and immortalized YB-1 null MEF clones transfected with a pIRES (control) vector or pIRES-YB-1 plasmid (right panel). C, growth curves of YB-1+/+, YB-1+/-, and YB-1-/- MEFs. One representative experiment is shown. Population doubling curves were determined using trypan blue exclusion. D, proliferation rate of MEFs as assessed by cell counts. YB-1+/+ (diamonds), YB-1+/- (squares), and YB-1-/- (triangles) were inoculated at 5 x 104 cells/ml. The cell numbers were determined at the time points indicated. Ectopic expression of wild-type YB-1 reversed the proliferation defect (right panel).

 


Figure 5
View larger version (76K):
[in this window]
[in a new window]

  		FIGURE 5.
Actin expression in the brain of wild-type and mutant embryos. A, at low magnification, beta-actin was shown to be ubiquitously expressed in wild-type embryos; however, YB-1-/- embryos demonstrated local reduction and derangement of beta-actin expression. This is especially obvious in connective tissue-filled central nervous system supportive tissues. B, immunohistochemistry with FITC-phalloidin was performed in E10.5 mouse embryos (top panels) and MEFs (bottom panels). Mutant embryos showed reduced F-actin structures. Normal cytoskeletal structures can be seen in wild-type MEFs. Stress fiber formation was reduced in YB-1-/- MEFs, and cells were flatter and larger than wild-type MEFs.

 


Figure 6
View larger version (41K):
[in this window]
[in a new window]

  		FIGURE 6.
Colony transformation activity was reduced in YB-1-/- MEFs but could be rescued by re-expression of YB-1. A, three YB-1-/- MEF cell lines (middle panel) demonstrated reduced transformation activity compared with wild-type MEFs (top panel), following 2% Giemsa staining. Introduction of recombinant YB-1 restored the transformation activity (bottom panel). B, three YB-1-/- MEF cell lines demonstrated reduced colony forming activity compared with wild-type MEFs, following 2% crystal violet staining. Cells were assayed in triplicate.

 
Reduced Anchorage-independent Growth by YB-1-/- Cells—We established three wild-type and three YB-1-/- immortalized MEF lines after continuous culturing for more than 6 months to investigate their spontaneous transformation ability in vitro. Although the wild-type cells did not show any signs of a decrease in proliferative rate, YB-1-/- MEFs failed to undergo morphological transformation and remained contact-inhibited after 2 weeks of cultivation (Fig. 6A, upper and middle panel). Following re-expression of transgenic YB-1, however, the MEFs underwent morphological transformation, whereas vector-only transduced MEFs failed to do so (Fig. 6A, lower panel). Furthermore, a one-fifth reduction in anchorage-independent growth was observed in the YB-1-/- MEF clones (Fig. 6B).

To confirm these results, we investigated whether knockdown of endogenous YB-1 via siRNA affected cell growth and size. The siRNA oligonucleotide was directed against the YB-1 C-terminal region, with the exception of the cold-shock domain. Western blot analysis of siRNA-transfected MEFs revealed that YB-1 protein levels were reduced to 20% of wild-type levels 72 h after transfection (Fig. 7A). YB-1 siRNA-transfected MEFs also showed a reduced growth rate and were ~10% larger (22 µm in diameter) than the negative control transfected MEFs (20 µm in diameter) (Fig. 7, B and C). This phenomenon was consistent with our earlier observations of YB-1-/- MEFs (Fig. 5B) and shows that YB-1 is involved in both regulating cell growth rates and cell size. In an anchorageindependent transformation assay in soft agar, YB-1 expressing MEFs (number 70) showed morphological transformation, but siRNA-transfected MEFs demonstrated reduced transformation activity (Fig. 7D). These results confirm our earlier finding that YB-1 is necessary for anchorage-independent transformation activity (see also Fig. 6A).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
This study demonstrates that YB-1 plays a critical role in DNA repair, transcription, mRNA turnover, and translational control. Previously, Lu et al. (24) reported that targeted disruption of YB-1 exon 3 (encoding part of the cold-shock domain) causes embryonic lethality and showed that YB-1 is important for cellular stress responses and prevention of premature senescence after E13.5. In this study, we demonstrated that YB-1-/- embryos exhibit severe growth retardation and progressive mortality after E10.5, revealing a nonredundant role for YB-1 in early embryonic development. Our study design disrupted YB-1 exons 5 and 6, encoding a nonspecific RNA binding region of the protein. Western blot analysis using an antibody against the YB-1 C terminus revealed that the YB-1 protein was completely absent from the E13.5 YB-1-/- embryo (Fig. 4A).

In this experiment, we first demonstrated that beta-actin expression and F-actin formation were reduced in the YB-1 null embryo and YB-1-/- MEF, suggesting that the neural tube defect is caused by abnormal cell morphology and actin assembly within the neuroepithelium. We also showed that YB-1-/- MEFs failed to undergo morphological transformation in culture cells and suggested that YB-1 is involved in cell proliferation.

Although only 20% of YB-1 null mutant mice showed exencephaly (Table 1), this is not an unusual finding, as mouse embryos subjected to inactivation of a critical gene via homologous recombination rarely show NTDs with complete penetrance (25). As an NTD phenotype, exencephaly reflects the failure of neural fold elevation in well defined, mechanistically distinct elevation zones (26). The genes mutated in several mouse NTD models that are involved in actin regulation (Abl/Arg, Marcs, Mena/Profilin1, Mlp, Sprm, Vcl) support the postulated role for actin in neural fold elevation and suggest that the NTDs are caused by an absence of the morphogenetic force normally provided by the apical redistribution of actin (25). We observed that YB-1 impairs translation of the beta-actin transcript in a rabbit reticulocyte translation system (data not shown). Similar results have been reported for beta-actin (27) and {alpha}-globin mRNAs (28). The strong, nonspecific in vitro binding of YB-1 to mRNA inhibits translation (29) and is a possible mechanism for regulating actin activity or its availability in protein synthesis. This is consistent with our finding that disruption of YB-1 leads to low beta-actin levels and reduced actin assembly (Fig. 5).


Figure 7
View larger version (43K):
[in this window]
[in a new window]

  		FIGURE 7.
siRNA-mediated YB-1 knockdown in MEFs. A, immunoblot analysis of YB-1 siRNA-transfected MEFs. Wild-type MEFs were transfected with YB-1 siRNA, and total cell lysate (50 µg) was harvested at various time points following transfection and analyzed for indicated protein. Seventy two hours after transfection of siRNA, YB-1 protein levels had reduced by 20%. B, proliferation rate of siRNA-mediated MEFs. YB-1 siRNA-transfected cells demonstrated growth retardation compared with wild-type MEFs. C, cell size of siRNA mediated MEFs. The cell diameter of transfected MEFs was measured 0 and 72 h after transfection with a Coultertype cell size analyzer. siRNA-transfected cells demonstrated a larger size (average diameter 22 µm) compared with wild-type cells (average diameter 20 µm). Experiments were performed in triplicate. D, siRNA-transfected cells demonstrated reduced colony forming activity compared with wild-type MEFs, following 2% crystal violet staining.

 
Recently, the localization of beta-actin mRNA to sites of active actin polymerization has been shown to modulate cell migration and neurite outgrowth (30). This localization requires the oncofetal protein Zipcode-binding protein 1 (ZBP1), which promotes translocation of the beta-actin transcript to actin-rich protrusions in primary fibroblasts and neurons. ZBP1 associates with the beta-actin transcript in the nucleus and prevents premature translation in the cytoplasm by blocking translation initiation. Interestingly, Matsumoto et al. (27) reported an interaction between YB-1 and ZBP1, suggesting that both proteins might coordinate in their regulation of beta-actin mRNA localization, protection, and protein synthesis at the correct site. Further elucidation of this interaction should improve the understanding of the molecular mechanisms behind beta-actin regulation.

The role of YB-1 in cell proliferation might be executed through its interaction with actin (22), as actin filaments form the contractile ring that cleaves the cell during cytokinesis (31). Alternatively, cell proliferation might be regulated by the effect of YB-1 on the cell cycle proteins cyclin A and cyclin B1, as YB-1 was found to induce strongly elevated levels of cyclin B1 protein in the mitotic stage (32). The targeted disruption of one allele of the chicken Y-box protein gene in DT40 cells results in major defects in the cell cycle (33). In this study, no difference in cyclin A and cyclin B expression was observed in YB-1-/- mouse embryos or MEFs (data not shown), suggesting that the expression level of these proteins did not cause the embryonic lethality and abnormality of the YB-1-/- mice.

Bergmann et al. (34) showed that transgenic mice expressing human hemagglutinin-tagged YB-1 developed diverse breast carcinomas through the induction of genetic instability caused by mitotic failure and centrosome amplification. We observed the spontaneous transformation of wild-type MEFs but showed that YB-1-/- MEFs failed to undergo morphological transformation and remained contact-inhibited (Fig. 6B). Re-expression of YB-1 restored the transformation activity suggesting that YB-1 is necessary for tumor promotion. Indeed, overexpression of YB-1 mRNA and protein is a hallmark of several human malignant diseases (2, 34), whereas the level of YB-1 protein expression has been linked with the prognosis of breast cancer patients and resistance to chemotherapeutic agents (5).

The nuclear translocation of YB-1 requires phosphorylation by the signal transduction protein Akt (35), which plays a role in tumor formation and progression. Evdokimova et al. (36) reported that phosphorylation by Akt also regulates the association of YB-1 with the capped 5' terminus of mRNA and that activated Akt might relieve translational repression of YB-1-bound mRNA. We investigated the level of Akt protein in wild-type and siRNA-mediated YB-1 knockdown MEFs, but no difference was detected (Figs. 4A and 7A), suggesting that YB-1 does not affect Akt protein levels in MEFs.

Target of rapamycin is a downstream kinase in the PI3K/Akt signaling pathway that phosphorylates S6K and translation initiation factor 4E-binding protein (4EBP), thus regulating translation (37). We also observed that S6K protein levels were reduced in YB-1 null mouse embryos, suggesting that YB-1 might be involved in this PI3K signaling pathway. Indeed, YB-1 is transcriptionally down-regulated in PI3K-transformed and Akt-transformed cells (29, 38). YB-1 acts downstream of the target of rapamycin, as the phosphorylation levels of S6K and 4EBP are unchanged in YB-1-overexpressing cells (39). An independent line of evidence has revealed the essential role of protein synthesis in PI3K- and Akt-induced transformation (40).

Activation of eukaryotic elongation factor 1A (eEF-1A) through phosphorylation by S6K (41, 42) enables it to bind to actin and regulate its activity or its availability in protein synthesis (43, 44). eEF-1A mutants have severe defects in cell morphology, the actin cytoskeleton, and actin bundling (44). In mammalian systems, disruption of the actin cytoskeleton results in reduced translation. In this study, we observed that YB-1 co-precipitated with eEF-1A (supplemental Fig. S2), suggesting that eEF-1A might compensate for the function of YB-1 in YB-1-/- embryos and MEFs. We also observed that another translational regulatory protein, EF-1, was overexpressed in YB-1-/- E11.5 embryos and siRNA-mediated YB-1 knockdown MEFs (Fig. 4A and 7A), indicative of an alternative compensatory mechanism.

In conclusion, we have described the function of YB-1 in the mouse embryo and in MEFs. We show that it is involved in mouse embryo development, neural tube defects, and cell proliferation.


   FOOTNOTES
 
* This work was supported by a grant-in-aid for scientific research on the priority area of ABC proteins, Core Research for Evolutional Science and Technology (CREST) of the Japan Science and Technology Corp. (JST), the second-term comprehensive 10-year strategy for cancer control from the Ministry of Health and Welfare of Japan, and the Cancer Research fund from Ministry of Education, Culture, Sports, Science, and Technology, Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Experimental Procedures and Figs. S1 and S2. Back

1 To whom correspondence should be addressed. Tel.: 81-93-691-7423; Fax: 81-93-692-6233; E-mail: uchiumi{at}med.uoeh-u.ac.jp.

2 The abbreviations used are: PCNA, proliferating cell nuclear antigen; MEF, mouse embryonic fibroblasts; PBS, phosphate-buffered saline; siRNA, small interfering RNA; FITC, fluorescein isothiocyanate; PI3K, phosphatidylinositol 3-kinase; NTD, neural tube defect; E, embryonic day; S6K, p70 S6K. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Makino, Y., Ohga, T., Toh, S., Koike, K., Okumura, K., Wada, M., Kuwano, M., and Kohno, K. (1996) Nucleic Acids Res. 24, 1873-1878[Abstract/Free Full Text]
  2. Kohno, K., Izumi, H., Uchiumi, T., Ashizuka, M., and Kuwano, M. (2003) BioEssays 25, 691-698[CrossRef][Medline] [Order article via Infotrieve]
  3. Didier, D. K., Schiffenbauer, J., Woulfe, S. L., Zacheis, M., and Schwartz, B. D. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 7322-7326[Abstract/Free Full Text]
  4. Ladomery, M., and Sommerville, J. (1995) BioEssays 17, 9-11[CrossRef][Medline] [Order article via Infotrieve]
  5. Kohno, K., Uchiumi, T., Niina, I., Wakasugi, T., Igarashi, T., Momii, Y., Yoshida, T., Matsuo, K., Miyamoto, N., and Izumi, H. (2005) Eur. J. Cancer 41, 2577-2586[CrossRef][Medline] [Order article via Infotrieve]
  6. Asakuno, K., Kohno, K., Uchiumi, T., Kubo, T., Sato, S., Isono, M., and Kuwano, M. (1994) Biochem. Biophys. Res. Commun. 199, 1428-1435[CrossRef][Medline] [Order article via Infotrieve]
  7. Ohga, T., Uchiumi, T., Makino, Y., Koike, K., Wada, M., Kuwano, M., and Kohno, K. (1998) J. Biol. Chem. 273, 5997-6000[Abstract/Free Full Text]
  8. Swamynathan, S. K., Nambiar, A., and Guntaka, R. V. (1998) FASEB J. 12, 515-522[Abstract/Free Full Text]
  9. Sommerville, J. (1999) BioEssays 21, 319-325[CrossRef][Medline] [Order article via Infotrieve]
  10. Ashizuka, M., Fukuda, T., Nakamura, T., Shirasuna, K., Iwai, K., Izumi, H., Kohno, K., Kuwano, M., and Uchiumi, T. (2002) Mol. Cell. Biol. 22, 6375-6383[Abstract/Free Full Text]
  11. Fukuda, T., Ashizuka, M., Nakamura, T., Shibahara, K., Maeda, K., Izumi, H., Kohno, K., Kuwano, M., and Uchiumi, T. (2004) Nucleic Acids Res. 32, 611-622[Abstract/Free Full Text]
  12. Koike, K., Uchiumi, T., Ohga, T., Toh, S., Wada, M., Kohno, K., and Kuwano, M. (1997) FEBS Lett. 417, 390-394[CrossRef][Medline] [Order article via Infotrieve]
  13. Okamoto, T., Izumi, H., Imamura, T., Takano, H., Ise, T., Uchiumi, T., Kuwano, M., and Kohno, K. (2000) Oncogene 19, 6194-6202[CrossRef][Medline] [Order article via Infotrieve]
  14. Sorokin, A. V., Selyutina, A. A., Skabkin, M. A., Guryanov, S. G., Nazimov, I. V., Richard, C., Th'ng, J., Yau, J., Sorensen, P. H., Ovchinnikov, L. P., and Evdokimova, V. (2005) EMBO J. 24, 3602-3612[CrossRef][Medline] [Order article via Infotrieve]
  15. Kuwano, M., Oda, Y., Izumi, H., Yang, S. J., Uchiumi, T., Iwamoto, Y., Toi, M., Fujii, T., Yamana, H., Kinoshita, H., Kamura, T., Tsuneyoshi, M., Yasumoto, K., and Kohno, K. (2004) Mol. Cancer Ther. 3, 1485-1492[Abstract/Free Full Text]
  16. Torigoe, T., Izumi, H., Ishiguchi, H., Yoshida, Y., Tanabe, M., Yoshida, T., Igarashi, T., Niina, I., Wakasugi, T., Imaizumi, T., Momii, Y., Kuwano, M., and Kohno, K. (2005) Curr. Med. Chem. Anticancer Agents 5, 15-27
  17. Shibahara, K., Uchiumi, T., Fukuda, T., Kura, S., Tominaga, Y., Maehara, Y., Kohno, K., Nakabeppu, Y., Tsuzuki, T., and Kuwano, M. (2004) Cancer Sci. 95, 348-353[CrossRef][Medline] [Order article via Infotrieve]
  18. Yoshida, S., Ohbo, K., Takakura, A., Takebayashi, H., Okada, T., Abe, K., and Nabeshima, Y. (2001) Dev. Biol. 240, 517-530[CrossRef][Medline] [Order article via Infotrieve]
  19. Ohga, T., Koike, K., Ono, M., Makino, Y., Itagaki, Y., Tanimoto, M., Kuwano, M., and Kohno, K. (1996) Cancer Res. 56, 4224-4228[Abstract/Free Full Text]
  20. Fleming, A., and Copp, A. J. (2000) Hum. Mol. Genet. 9, 575-581[Abstract/Free Full Text]
  21. Harris, M. J., and Juriloff, D. M. (1999) Teratology 60, 292-305[CrossRef][Medline] [Order article via Infotrieve]
  22. Ruzanov, P. V., Evdokimova, V. M., Korneeva, N. L., Hershey, J. W., and Ovchinnikov, L. P. (1999) J. Cell Sci. 112, 3487-3496[Abstract]
  23. Chen, C. Y., Gherzi, R., Andersen, J. S., Gaietta, G., Jurchott, K., Royer, H. D., Mann, M., and Karin, M. (2000) Genes Dev. 14, 1236-1248[Abstract/Free Full Text]
  24. Lu, Z. H., Books, J. T., and Ley, T. J. (2005) Mol. Cell. Biol. 25, 4625-4637[Abstract/Free Full Text]
  25. Juriloff, D. M., and Harris, M. J. (2000) Hum. Mol. Genet. 9, 993-1000[Abstract/Free Full Text]
  26. Harris, M. J., and Juriloff, D. M. (1997) Teratology 56, 177-187[CrossRef][Medline] [Order article via Infotrieve]
  27. Matsumoto, K., Tanaka, K. J., and Tsujimoto, M. (2005) Mol. Cell. Biol. 25, 1779-1792[Abstract/Free Full Text]
  28. Skabkin, M. A., Kiselyova, O. I., Chernov, K. G., Sorokin, A. V., Dubrovin, E. V., Yaminsky, I. V., Vasiliev, V. D., and Ovchinnikov, L. P. (2004) Nucleic Acids Res. 32, 5621-5635[Abstract/Free Full Text]
  29. Evdokimova, V. M., and Ovchinnikov, L. P. (1999) Int. J. Biochem. Cell Biol. 31, 139-149[CrossRef][Medline] [Order article via Infotrieve]
  30. Huttelmaier, S., Zenklusen, D., Lederer, M., Dictenberg, J., Lorenz, M., Meng, X., Bassell, G. J., Condeelis, J., and Singer, R. H. (2005) Nature 438, 512-515[CrossRef][Medline] [Order article via Infotrieve]
  31. Robinson, D. N., and Spudich, J. A. (2004) Curr. Opin. Cell Biol. 16, 182-188[CrossRef][Medline] [Order article via Infotrieve]
  32. Jurchott, K., Bergmann, S., Stein, U., Walther, W., Janz, M., Manni, I., Piaggio, G., Fietze, E., Dietel, M., and Royer, H. D. (2003) J. Biol. Chem. 278, 27988-27996[Abstract/Free Full Text]
  33. Swamynathan, S. K., Varma, B. R., Weber, K. T., and Guntaka, R. V. (2002) Biochem. Biophys. Res. Commun. 296, 451-457[CrossRef][Medline] [Order article via Infotrieve]
  34. Bergmann, S., Royer-Pokora, B., Fietze, E., Jurchott, K., Hildebrandt, B., Trost, D., Leenders, F., Claude, J. C., Theuring, F., Bargou, R., Dietel, M., and Royer, H. D. (2005) Cancer Res. 65, 4078-4087[Abstract/Free Full Text]
  35. Sutherland, B. W., Kucab, J., Wu, J., Lee, C., Cheang, M. C., Yorida, E., Turbin, D., Dedhar, S., Nelson, C., Pollak, M., Leighton Grimes, H., Miller, K., Badve, S., Huntsman, D., Blake-Gilks, C., Chen, M., Pallen, C. J., and Dunn, S. E. (2005) Oncogene 24, 4281-4292[CrossRef][Medline] [Order article via Infotrieve]
  36. Evdokimova, V., Ruzanov, P., Anglesio, M. S., Sorokin, A. V., Ovchinnikov, L. P., Buckley, J., Triche, T. J., Sonenberg, N., and Sorensen, P. H. (2006) Mol. Cell. Biol. 26, 277-292[Abstract/Free Full Text]
  37. Hay, N., and Sonenberg, N. (2004) Genes Dev. 18, 1926-1945[Abstract/Free Full Text]
  38. Nekrasov, M. P., Ivshina, M. P., Chernov, K. G., Kovrigina, E. A., Evdokimova, V. M., Thomas, A. A., Hershey, J. W., and Ovchinnikov, L. P. (2003) J. Biol. Chem. 278, 13936-13943[Abstract/Free Full Text]
  39. Bader, A. G., Felts, K. A., Jiang, N., Chang, H. W., and Vogt, P. K. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 12384-12389[Abstract/Free Full Text]
  40. Bader, A. G., and Vogt, P. K. (2005) Mol. Cell. Biol. 25, 2095-2106[Abstract/Free Full Text]
  41. Chang, Y. W., and Traugh, J. A. (1997) J. Biol. Chem. 272, 28252-28257[Abstract/Free Full Text]
  42. Traugh, J. A. (2001) Prog. Mol. Subcell. Biol. 26, 33-48[Medline] [Order article via Infotrieve]
  43. Edmonds, B. T., Wyckoff, J., Yeung, Y. G., Wang, Y., Stanley, E. R., Jones, J., Segall, J., and Condeelis, J. (1996) J. Cell Sci. 109, 2705-2714[Abstract]
  44. Gross, S. R., and Kinzy, T. G. (2005) Nat. Struct. Mol. Biol. 12, 772-778[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J Exp BotHome page
K. Nakaminami, K. Hill, S. E. Perry, N. Sentoku, J. A. Long, and D. T. Karlson
Arabidopsis cold shock domain proteins: relationships to floral and silique development
J. Exp. Bot., March 1, 2009; 60(3): 1047 - 1062.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. Fujii, A. Kawahara, Y. Basaki, S. Hattori, K. Nakashima, K. Nakano, K. Shirouzu, K. Kohno, T. Yanagawa, H. Yamana, et al.
Expression of HER2 and Estrogen Receptor {alpha} Depends upon Nuclear Localization of Y-Box Binding Protein-1 in Human Breast Cancers
Cancer Res., March 1, 2008; 68(5): 1504 - 1512.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. Shiota, H. Izumi, T. Onitsuka, N. Miyamoto, E. Kashiwagi, A. Kidani, A. Yokomizo, S. Naito, and K. Kohno
Twist Promotes Tumor Cell Growth through YB-1 Expression
Cancer Res., January 1, 2008; 68(1): 98 - 105.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. M. Paranjape and E. Harris
Y Box-binding Protein-1 Binds to the Dengue Virus 3'-Untranslated Region and Mediates Antiviral Effects
J. Biol. Chem., October 19, 2007; 282(42): 30497 - 30508.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
281/52/40440    most recent
M605948200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Uchiumi, T.
Right arrow Articles by Kohno, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Uchiumi, T.
Right arrow Articles by Kohno, K.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement