|
Originally published In Press as doi:10.1074/jbc.M607676200 on November 10, 2006
J. Biol. Chem., Vol. 281, Issue 52, 40503-40514, December 29, 2006
Telomerase-independent Regulation of ATR by Human Telomerase RNA*
Martijn Kedde,
Carlos le Sage,
Anja Duursma,
Eitan Zlotorynski,
Bart van Leeuwen,
Wouter Nijkamp,
Roderick Beijersbergen, and
Reuven Agami1
From the
Division of Tumor Biology, The Netherlands Cancer Institute, Plesmanlaan 121, 1066CX Amsterdam, The Netherlands
Received for publication, August 11, 2006
, and in revised form, November 6, 2006.
 |
ABSTRACT
|
|---|
The human telomerase RNA (hTR), together with the telomerase reverse transcriptase, hTERT, constitute the core components of telomerase that is essential for telomere maintenance. While hTR is ubiquitously expressed, hTERT is normally restricted to germ cells and certain stem cells, but both are often deregulated during tumorigenesis. Here, we investigated the effects of changes in hTR cellular levels. Surprisingly, while inhibition of hTR expression triggers a rapid, telomerase-independent, growth arrest associated with p53 and CHK1 activation, its increased expression neutralizes activation of these pathways in response to genotoxic stress. These hTR effects are mediated through ATR and are sufficiently strong to impair ATR-mediated DNA-damage checkpoint responses. Furthermore, in response to low UV radiation, which activates ATR, endogenous hTR levels increase irrespective of telomerase status. Thus, we uncovered a novel, telomerase-independent, function of hTR that restrains ATR activity and participates in the recovery of cells from UV radiation.
 |
INTRODUCTION
|
|---|
Most human somatic cells have a limited replicative lifespan when propagated in vitro which is due to their inability to maintain chromosome ends, the telomeres (1, 2). Telomeres are specialized DNA-protein structures that preserve the integrity of the ends of the chromosomes and the stability of the genome (2). However, with each cell division telomeres are shortened and once one or more erode to a certain critical point, the shortening induces a DNA damage checkpoint, thereby posing a barrier to continued cell growth and, therefore, to cancer (3-8). Cells that escape replicative senescence by inactivating critical cell cycle checkpoint genes, such as p53, continue to erode their telomeres, eventually reaching a point that is called crisis (9). The only way to escape crisis is to ensure that telomeres are maintained. Most cells do this by reactivating telomerase, but alternative mechanisms (ALT),2 involving recombination, are also observed (10-12).
Telomerase, or TERT, is a ribonucleoprotein that copies a short RNA template into telomeric DNA, thereby maintaining eukaryotic chromosome ends and preventing replicative senescence (13, 14). Telomerase activity is low or absent in normal human cells but is high during development in certain stem cells, germ cells, and 80-90% of human cancers and immortalized human cell lines (10, 11, 15, 16). In fact, telomerase expression is sufficient for immortalization of primary human cells, rendering them insensitive to replicative senescence and crisis (17).
In humans, the core components of the telomerase complex are the protein catalytic subunit hTERT and the telomerase RNA subunit hTR (14, 18). hTR is transcribed by RNA polymerase II and is 3' processed to generate a 451-nucleotide-long mature transcript. Its secondary structure is very well conserved with telomerase RNAs from several vertebrate species, indicating an important role for RNA structure in telomerase function (19). Several proteins have been described to bind to hTR and these are involved in hTR stability, maturation, accumulation, and functional assembly of the telomerase ribonucleoprotein complex (2). Certain mutations or deletions in hTR lead to a rare skin and bone marrow failure syndrome called dyskeratosis congenita, which is believed to be caused by defective telomere maintenance in stem cells (20, 21). As expression of hTR has been found to be essential for telomere maintenance in human disease and also for telomere length maintenance in mouse models, it is expected to be up-regulated in cancer cells (22). Indeed, several studies have shown that hTR up-regulation is an early event in tumorigenesis and that hTR levels correlate better to tumor grade than telomerase activity or hTERT expression (23-31). Up-regulation of hTR was also found to be an early event in mouse models of tumorigenesis. Here, telomerase RNA levels did not parallel the amount of telomerase activity detected (32, 33). These studies show that even in tumors that lacked telomerase activity, telomerase RNA was up-regulated. Therefore, hTR may have functions that are separable from its role in telomerase activity (32). Contrasting these observations are mice in which mouse telomerase RNA (mTR) was deleted from the germ line. These mice are viable for six generations until telomeres have completely eroded (34). However, the first generation of these mice, which still have long telomeres, have less skin tumors than wild-type mice following skin chemical carcinogenesis, indicating for some telomerase-independent effects of mTR (35). This argues that most mTR function is dependent on telomerase. However, as germ line gene knock-out may allow for compensating events to occur while acute inhibition in somatic cells may not (36), inhibition of telomerase RNA by RNA interference in cancer cell lines may expose its telomerase independent functions.
Telomeres are intimately linked with DNA damage responses. Dysfuctional telomeres are recognized as damaged DNA and directly associate with many DNA damage response proteins (37). Moreover, the main cellular transducers of DNA damage, ATM and, to a lesser extent, ATR, have been shown to play an important role in telomere homeostasis (38, 39). ATM and ATR are phosphatidylinositol 3-kinase-like protein kinases (PIKKs) that coordinate the repair, cell cycle checkpoint, and apoptotic responses to DNA damage (40). Loss of ATM causes telomere decapping and shortening in every organism investigated thus far, and TRF2, a telomeric DNA binding protein, has been shown to bind and inhibit ATM activation (37, 41). Probing a telomeric function for ATR in mammalian cells has not been possible since ATR is essential for cell viability (42). Interestingly, a recent report has shown that in Arabidopsis ATR is required for maintenance of telomeric DNA (43). Thus, PIKKs function in telomere homeostasis and telomeres with their telomere-associated factors influence PIKKs activity.
Telomerase and telomeres are attractive targets for cancer therapies and have been extensively explored to this end (2). Inhibition of telomerase by antisense strategies or a dominant negative hTERT protein leads to the expected telomere shortening, although the growth inhibition induced by this mechanism requires a long lag period due to the number of cell divisions required for telomeres to become substantially shortened to induce growth arrest (44, 45). Recently, some studies have reported rapid cytotoxic responses of cancer cell lines in response to low levels of hTERT and hTR. A novel telomere-independent growth inhibitory response pathway was proposed (46, 47). Here, we investigated the effects exerted by hTR on the cellular growth and checkpoint controls and uncovered a novel, telomerase-independent, function of hTR to counterbalance the activity of endogenous ATR.
 |
EXPERIMENTAL PROCEDURES
|
|---|
Materials and AntibodiesUV radiation was performed with a Stratalinker (Stratagene), and ionizing irradiation was performed with a 2 x 415-Ci137Cs source. Prior to UV radiation, medium was reserved, and cells were washed with phosphate buffered saline (PBS). Antibodies used in this study were directed against cdk4 (C-22), p53 (DO1) (Santa Cruz Biotechnology), phospho-Ser-15 p53, phospho-Ser-317 Chk1, phospho-T68 Chk2 (Cell Signaling), FLAG (M2, Sigma), -H2AX (Ser-139, Upstate%20Biotechnology">Upstate Biotechnology), and ATR (ab2905, Abcam).
ConstructshTR knockdown constructs were cloned in pSuper, pRetroSuper(pRS)-Hygro (48), and pRS-GFP (49). The sequences used were as follows: hTRkd#1, GTCTAACCCTAACTGAGAAGG; hTRkd2, CCGTTCATTCTAGAGCAAAC; hTRkd3, GAGTTGGGCTCTGTCAGCC. The CMV-hTR expression construct was cloned by PCR in pcDNA3.1 vector (Invitrogen) to contain 149 nucleotides downstream of the full-length hTR for proper processing; H/ACA box snoRNA constructs were also cloned into this vector. pRS-p53kd and pRS-Rb were described previously (49). ATRkd sequences used were as follows: #1, GACGGTGTGCTCATGCGGC; #2, CCTGATGGAGTGGCCGGAG; we used a combination of the two constructs cloned in pSuper. We cloned the ATR cDNA from the pBJ5.1-Flag-ATR (a kind gift from Professor Steve Jackson) vector into the pZome1N vector (Cellzome) downstream of the TAP tag (50). The GST-p53 (amino acids 1-101) construct was cloned by PCR into pGEX-1N (Amrad). pTRI-GAPDH and -cyclophilin constructs for the RNase protection assay (RPA) were from Ambion, and the hTR RPA vector was cloned by PCR into pTRI (Ambion) from nucleotides 105-370 in reverse orientation.
Cell Culture, Retroviral Transduction, and TransfectionAll cells described here were cultured in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal calf serum in 5% CO2 at 37 °C. BJ cells were transduced at population doubling 35. The generation of BJ-tert cells has been described previously (49); GM847 cells were a kind gift from Professor Batsheva Kerem. MCF7, U2OS, and TIG3 cell lines expressing the ecotropic receptor were infected with ecotropic retroviral supernatants as described previously (48) to generate polyclonal pools of cells. Except for kinase assays, transfection was done by electroporation as described previously (51). For kinase assays, HEK293, U2OS, and MCF7 cells were transiently transfected using calcium phosphate precipitation.
Western Blotting, Cell Cycle Profile Analysis, and Competitive Growth AssaysFor Western blot analysis, whole-cell extracts were prepared and separated on 10% SDS-PAGE gels, and ATR immunoblots were separated on 5% SDS-PAGE gels and transferred to Immobilon-P membranes (Milipore). Western blots were developed with Supersignal (Pierce), and densitometric quantitation of Western blots was performed with Aida 3.40 software (Raytek, Sheffield, UK). Cell cycle profile analysis was performed as described before by Duursma et al. (52). For competitive growth assays, cells were infected with pRS-GFP-hTRkd or pRS-GFP retrovirus and allowed to recover for 4 days; the initial percentage of GFP-positive cells varied between 15 and 50%. The cells were analyzed by flow cytometry with the CellQuest program (BD Bioscience).
Telomerase Activity Assays, Quantitative RT-PCR, and RNase Protection AssaysMCF7 extracts were assayed for telomerase activity using a PCR-based telomeric repeat amplification protocol (TRAP) assay (53). For RT-PCR, cDNA was transcribed using SuperSCRIPT III (Invitrogen) with random hexamers following the manufacturer's instructions. Quantitative PCR was performed with a SYBR Green master mix (Applied Biosystems), and the samples were amplified and analyzed by an ABI-prism 7000 sequence detection system (Applied Biosystems). Primers for OAS1 (2'5'-oligoadenylate synthetase) were described before (54), and Ct values were normalized for -actin. RPAs were performed using the HybSpeed RPA and MAXIscript kits from Ambion according to manufacturer's instructions. We used 5-8 µg of RNA per reaction. In vitro transcription of pTRI-hTR yielded an RNA of 300 nucleotides, 265 nucleotides of which are complementary to hTR.
Immunoprecipitation Kinase AssaysTo determine ATR activity, TAP-ATR was immunoprecipitated from extracts of transfected HEK293, MCF7, or U2OS cells using rabbit IgG-Sepharose (Sigma). Prior to immunoprecipitation, cells were UV irradiated with either 80 or 20 J/m2 or mock treated. Beads were washed three times with ELB lysis buffer (125 mM NaCl, 50 mM Hepes, pH 7.5, 0.1% Nonidet P-40, 0.5% Tween 20, 0.5 mM NaOV, 2 mM -glycerophosphate, and protease inhibitor mixture (Roche Applied Science)) and ATR was cleaved from the beads by addition of recombinant TEV protease (Invitrogen) for 2 h at 8°C according to manufacturer's instructions. The substrate, GST-p53-(1-101) bound to glutathione beads (Amersham Biosciences), was washed three times with kinase buffer (20 mM HEPES (pH 7.5), 50 mM NaCl, 10 mM MgCl2, 10 mM MnCl2, 1 mM dithiothreitol, 0.5 mM NaOV, and 2 mM -glycerophosphate). Reactions were carried out in a 50-µl volume of kinase buffer with cleaved ATR, 10 µg of GST-p53-(1-101), 10 µCi of [ -32P]ATP (500 mCi/mmol, Amersham Biosciences) at 30 °C for 15 min. In samples with RNase A, 0.5 µg was added to the kinase reaction prior to the addition of the substrate; we added 1 µg of in vitro transcribed hTR or H/ACA snoRNA to the indicated samples, which was produced from linearized CMV-hTR/snoRNA plasmid with a MAXIscript in vitro transcription kit (Ambion) according to manufacturer's instructions. The beads with GST-p53-(1-101) were then extensively washed and subjected to 10% SDS-PAGE, and the gel was dried, stained with Coomassie Blue, and exposed to a phospho imager screen for quantitation on a Basreader 3000 (Fuji) with Aida 3.40 software (Raytek, Sheffield, UK).
Immunofluorescence, Mitotic Entry, and Fragile Site AssaysMCF7 cells were transfected by electroporation (>90% efficiency) with the indicated constructs. Cells were washed with PBS, fixed, permeabilized in 4% formaldehyde and 0.2% Triton X-100, and washed with PBS containing 0.05% saponin. Slides were blocked with 10% normal goat serum in PBS with 0.05% saponin. Cells were stained with antibody directed against phosphorylated H2AX; fluorescein isothiocyanate-conjugated goat anti-mouse antibodies were used as secondary antibodies. Images were recorded with a Leica TCS SP2-AOBS (Leica Microsystems, Heidelberg, Germany) confocal system. For counting mitotic entry, after 72 h, transfected MCF7 cells were treated with 5 Gy ionizing radiation (IR) or mock treated and incubated with nocodazole (0.25 µg/ml) for 24 h. Cells were fixed with 3.7% formaldehyde, permeabilized for 5 min with 0.1% Triton X-100 (Sigma) and stained with Hoechst. Mitotic cells were scored double blind with a Zeiss RS III microscope. For each sample, 600 cells were counted. For fragile site assays, cells were grown on coverslips, and common fragile sites were induced by growing the cells in M-199 medium in the presence of 0.4 µM aphidicolin and 0.5% ethanol, for 24 h prior to the fixation of chromosomes by standard procedures. Images were obtained with a Zeiss Axiovert 100 TV inverted microscope controlled by SmartCapture2 software. For each sample, 400 chromosomes were counted double blind.
 |
RESULTS
|
|---|
Inhibition of hTR Expression Induces a Rapid Cellular Growth ArrestTo inhibit hTR expression we designed shRNA constructs to target sequences in different regions of the hTR molecule. We aimed our constructs to three distinct single stranded (loops) regions of the hTR molecule, as predicted by its very strong and conserved secondary structure (19) (Fig. 1A). To assess the efficacy of inhibition of hTR expression, we transfected MCF7 breast carcinoma cells with the shRNA constructs or a vector control. We used RPA with RNA probes partially complementary to hTR or cyclophilin control to assess hTR RNA levels in cell extracts (Fig. 1B). Quantitative analysis revealed that hTRkd#1 and hTRkd#2 reduced the levels of endogenous hTR to 19 and 67%, respectively, whereas no hTR reduction was seen by hTRkd#3. U2OS osteosarcoma cells, which lack expression of hTR and hTERT but maintain their telomeres by ALT (55, 56), were used as a control. Indeed, no hTR expression was observed in U2OS cells, which could be re-expressed through transfection of a CMV-hTR plasmid (Fig. 1B). We also verified the extent of hTR knockdown in nuclear and cytoplasmic extracts to exclude knockdown of hTR only in cytoplasmic fractions (supplemental Figs. S1 and S2). We found that hTR resides mainly in the nucleus, and upon expression of hTRkd#1, hTR levels in both nuclear and cytoplasmic fractions were dramatically decreased. To assess the effects of inhibition of hTR on telomerase activity we performed a TRAP assay with extracts of MCF7 cells transfected with the hTRkd constructs or control plasmid. As expected we found almost no telomerase activity in hTRkd#1-transfected cells, and hTRkd#2 gave a moderate reduction, whereas hTRkd#3 did not inhibit telomerase activity.
To investigate the effect of hTR knockdown on cell growth, we transfected MCF7 cells with the three hTRkd constructs and analyzed them 2 days later by flow cytometry. Surprisingly, the introduction of hTRkd#1 shRNA vector induced a cell cycle arrest at both G1 and G2 (Fig. 1D), whereas the hTRkd#2 arrest was reduced, and hTRkd#3 had no effect (data not shown). To verify this result we tested additional hTR-targeting siRNAs with RPA and flow cytometric analysis in MCF7 cells (supplemental Figs. S3 and S4). Transfection of these siRNAs suppressed the expression of hTR and elicited a comparable rapid growth arrest as hTRkd#1. Consistent with these results, the long term survival of hTRkd#1-transfected MCF7 cells (Fig. 1E) and virally transduced hTRkd#1-MCF7 cells (Fig. 1F) was markedly impaired. The observed inhibition of proliferation by hTRkd#1 was not a consequence of non-relevant toxicity as this vector induced no interferon response (Fig. 1G). Furthermore, no anti-proliferative response was seen in U2OS cells, as these express no hTR (Fig. 1B). Both by flow cytometry as well as by competitive growth assays, hTRkd#1 was not toxic to U2OS cells but was highly toxic in MCF7 cells (Fig. 1, H and I). hTRkd#2 inhibited growth of MCF7 cells to intermediate levels, reflecting its capacity to knockdown hTR. These results are further strengthened by the use of additional siRNA reagents targeting hTR (supplemental Figs. S2 and S3). This shows that the growth inhibition triggered by the knockdown of hTR in MCF7 cells is dependent on the level of knockdown of hTR. The same anti-proliferative effect of hTRkd#1 was also obtained in other human cell lines, such as HaCaT immortalized keratinocytes, HeLa cervical carcinoma cells, and T47D mammary carcinoma cells (supplemental Fig. S5). Altogether, these results show that inhibition of hTR expression by shRNA elicits a rapid anti-proliferative response in human cells.


View larger version (89K):
[in this window]
[in a new window]
|
FIGURE 1. Reduction of telomerase activity and rapid growth inhibition by reduction of hTR expression. A, schematic representation of the hTR RNA. Boxed regions correspond to targeted sequences by shRNAs 1, 2, and 3, and the template sequence is shown in a closed box. B, RPA was used to detect the levels of hTR and the control cyclophilin. The full-length probes and protected fragments are indicated, and 10% of the input probe was loaded on the gel. Quantification was performed by densitometry. C, a TRAP assay was performed to detect telomerase activity in extracts of MCF7 cells transfected with the indicated constructs. D, MCF7 cells were transfected with hTRkd#1 or vector constructs and subjected to flow cytometric analysis. The percentages of cells in G1, S, and G2 phases are shown. S.D. is from three independent experiments. E, a colony growth assay of MCF7 cells transfected with the hTR knockdown constructs or a vector control. Cells were selected with hygromycin for 10 days and stained with Coomassie Blue. F, colony growth assay of virally transduced MCF7 cells. G, MCF7 cells were transfected with indicated constructs, and RNA was extracted after 3 days. OAS1 mRNA levels were measured by quantitative RT-PCR, shown relative to -actin mRNA. S.D. is from three independent experiments. H, flow cytometry is the same as in D only that U2OS cells were used. I, competitive growth assay the U2OS and MCF7 cells were transduced with indicated pRS-GFP constructs. Fluorescence was monitored by flow cytometry at the indicated time points after transduction. J, competitive growth assay performed on transduced primary BJ fibroblasts as in I. ctr, control.
|
|
Due to the continuous rapid proliferation of cancer cell lines and emergence of critically short telomeres, the inhibition of hTR expression may induce a stress response. To examine this, we studied hTR inhibition in young primary human cells (passage 35) that express hTR and contain sufficiently long telomeres to maintain proliferation for 30-40 additional passages. Also in these cells, suppression of hTR inhibited cell growth depending on the level of hTR knockdown (Fig. 1J). Altogether, our results indicate that inhibition of hTR expression induces a cell cycle arrest, which is not caused by critically short telomeres.
Cell Cycle Arrest Induced by Inhibition of hTR Expression Requires p53 and CHK1To elucidate the response of cells to reduced hTR levels we monitored p53 levels, a tumor suppressor and a major transducer of cell cycle arrest in response to oncogenic and genotoxic stresses. We transfected MCF7 cells with p53kd (57) and hTRkd or control constructs and found p53 protein levels to be three times higher in the hTRkd#1-transfected cells compared with controls (Fig. 2A). This suggests that the growth arrest observed in hTRkd cells involves p53 activation. To test this directly, we performed competitive growth assays using MCF7-p53kd and MCF7 control cells that were virally transduced with the GFP-hTRkd#1 or GFP control vector. Fig. 2B shows that loss of p53 expression, which completely abrogates a DNA damage response (57), only partially rescued the arrest induced by loss of hTR. A similar result was obtained in TIG3 primary fibroblasts (supplemental Fig. S6).
Activation of p53 can be a result of activation of the kinases ATM and ATR, which in turn activate CHK2 and CHK1, respectively (40). To examine whether the cell cycle arrest induced by the loss of hTR depends on the combination of p53 and CHK1, we performed a GFP competition assay with BJ and BJ-p53kd cells in the presence of the CHK1 inhibitor UCN-01 or vehicle as control (58, 59). Fig. 2C shows that hTRkd#1-induced toxicity was almost completely abrogated when both p53 expression and CHK1 activity were inhibited. Similar results were obtained in MCF7 cells (data not shown). These results indicate that loss of hTR activates both p53 and CHK1 to elicit a rapid cell cycle arrest, indicating the involvement of ATR in this process.
hTR Inhibits ATR ActivityOur results suggest an inverse correlation between hTR levels and ATR activity. Reduction in hTR levels induces p53 and CHK1, two main substrates of ATR. To examine this further, we asked whether the presence of hTR inhibits ATR activity. ATR is activated by DNA damage assaults such as UV radiation, thereby inducing the phosphorylation of p53S15 and CHK1S317, respectively (60-62). To test the role of hTR in this process we used U2OS cells, which express no hTR, and ectopically expressed hTR (Fig. 1A). Importantly, the levels of expressed hTR in U2OS cells were lower than the endogenous levels observed in MCF7 cells and could not complement for telomerase activity due to the lack of hTERT expression in these cells (data not shown). We irradiated hTR expressing and control cells with UV and followed the phosphorylation kinetics of CHK1S317and p53S15 in time. Interestingly, upon radiation, the phosphorylations of both CHK1S317 and p53S15 were severely attenuated in U2OS cells expressing hTR (Fig. 3A). In addition, p53 stability was not increased upon radiation in hTR-expressing cells as compared with control cells.

View larger version (26K):
[in this window]
[in a new window]
|
FIGURE 2. Chk1 and p53 are required for induction of the hTRkd-mediated cell cycle arrest. A, MCF7 cells were transfected with indicated constructs and subjected to immunoblot analysis to detect p53 and the control CDK4. Band intensity was calculated by densitometry. B, MCF7 cells were transduced with p53kd or control vector, drug-selected, and transduced with pRS-GFP control and hTRkd#1-GFP. Competitive growth assays were performed as described in the legend to Fig. 1I. C, competitive growth assays with BJ cells as in B. Cells were either treated with UCN-01 (10 nM, dashed lines) or with vehicle (dimethyl sulfoxide (DMSO), solid lines).
|
|
Since U2OS cells express neither hTR nor hTERT, it seems that hTR inhibits ATR in an hTERT independent manner. To examine this issue we aimed at testing the effects of hTR knockdown in a telomerase negative cell line. Therefore, we used GM847 human fibroblasts; these cells elongate telomeres by the ALT mechanism and express hTR but not hTERT (12). We transfected cells with the hTRkd#1 construct, treated the cells with UV radiation (3 J/m2), and monitored phosphorylation of CHK1S317 and p53S15 using immunoblot analysis. We found that reduction in endogenous hTR levels triggered CHK1S317 and p53S15 phosphorylation, as well as p53 stabilization, indicating ATR activation (Fig. 3B, time 0'). To exclude off target effects of hTR knockdown, we tested additional siRNAs that inhibit hTR expression. We found also those to elicit a rapid cell cycle arrest and to trigger CHK1S317 and p53S15 phosphorylation and p53 stabilization (supplemental Figs. S3, S4, and S7). This strongly suggests that inhibition of hTR causes the reduction in cell proliferation capacity and activation of DNA damage checkpoints. Interestingly, hTR depletion activated the DNA damage response to almost full extent as treating hTRkd cells with UV resulted in only a slight activation of p53 and CHK1 compared with control cells (3B). Altogether, these results suggest that endogenous levels of hTR are functioning to balance ATR activity, a function that is telomerase-independent.
To study the effects of hTR on ATR kinase activity in more detail, we used an ATR construct with a TAP (tandem affinity purification) tag containing a TEV protease cleavage site (50). We transfected HEK293 cells with TAP-ATR or TAP control, purified them from extracts by immunoprecipitation using IgG beads (Fig. 3C, lanes B), and released using TEV protease (lanes S). We studied effects of hTR on ATR-kinase activity using GST-coupled p53 (amino acids 1-101) as its substrate. Fig. 3D shows that our purified ATR could phosphorylate p53, as expected (lane ctrl). When hTR is incubated with ATR a clear and potent decrease in ATR activity is observed (lane hTR). As control we used a truncated hTR RNA encompassing the first 211 nucleotides of hTR (lane hTR 211). This truncated hTR inhibited ATR activity in vitro to a lesser extent than the full-length hTR, indicating for the specificity of the hTR effect. Additionally, since hTR contains a H/ACA box (2, 19), we tested related H/ACA snoRNAs for their ability to influence ATR kinase activity. We found that these RNAs hardly affect ATR kinase activity, indicating that the inhibition of ATR by hTR is specific (supplemental Fig. S8). As HEK293 cells express hTR, we reasoned that addition of RNase should increase ATR activity. Indeed, when RNase was added to ATR, or to ATR and hTR, kinase activity was relatively increased. These results indicate that ATR kinase activity is inhibited by hTR in vitro.
To further examine the effects of hTR on ATR kinase activity we performed kinase assays with TAP-ATR in U2OS cells that lack hTR expression. Cells were transfected with TAP-ATR or TAP-control plasmid and cotransfected with CMV-hTR or control plasmids. Three days after transfection, cells were either left untreated or UV irradiated to activate ATR, and subsequently ATR was purified and subjected to a kinase assay. Fig. 3E shows that exogenous ATR is active in mock treated U2OS cells and is slightly activated when cells are irradiated (lanes 1 and 2). However, when hTR is coexpressed with TAP-ATR, ATR activity is markedly decreased, almost to the levels of the control transfection (lanes 5 and 6). Next, we performed a similar experiment using MCF7 cells that, unlike U2OS cells, express hTR. Fig. 3F shows ATR activation upon UV radiation (lanes 1-4). However, reduction in hTR levels induced ATR activity already in the untreated cells (lane 5), which was not further activated by UV at this time point after treatment (lane 6).

View larger version (48K):
[in this window]
[in a new window]
|
FIGURE 3. hTR inhibits ATR kinase activity. A, U2OS cells were transfected with the hTRkd or control, irradiated after 3 days with 3 J/m2 UV, and harvested at the indicated time points. Whole cell extracts were immunoblotted to detect CHK1S317 phosphorylation, p53S15 phosphorylation, p53, and CDK4 as a loading control. B, GM847 fibroblasts were transfected with hTRkd or control and treated as in A. C, HEK293 cells were transfected with TAP-ctr or TAP-ATR and immunoprecipitated with IgG. TAP-ATR was cleaved with TEV protease, and beads (B) and supernatant (S) were immunoblotted to detect ATR. WB, Western blot. D, kinase assay performed with immunoprecipitation and TEV cleaved TAP-ATR from HEK293 cells with GST-p53 (residues 1-101) as a substrate. Cleaved ATR was split, and hTR, RNase, and mock were added prior to kinase reaction. Samples were separated by 10% SDS-PAGE and stained with Coomassie Blue to detect GST-p53 protein, and autoradiography was performed to detect kinase activity. Band intensities were measured by densitometry. E, U2OS cells were transfected with the indicated constructs and kinase assays were performed as in B. F, MCF7 cells were transfected with the indicated constructs, and kinase assays were performed as in B. G, immunofluorescence images of MCF7 cells transfected with hTRkd#1, vector, or control irradiated cells (5 Gy IR), stained with -H2AX antibody. Nuclei are stained with DAPI (blue). Pictures were made with x200 magnification. vec, vector.
|
|
As shown above, ATR signaling is activated when hTR is depleted. Our results so far suggest that the effect of hTR on ATR activity is direct. ATR is normally activated by DNA damage, upon which it activates p53 and CHK1 but also phosphorylates histone H2AX (40). Phosphorylated H2AX ( -H2AX) colocalizes with other factors, such as p53BP1, MRE11, and SMC1, to foci marking sites of DNA damage, thereby facilitating the assembly of checkpoint and DNA repair factors (40). Such foci are also found at dysfunctional telomeres (5, 37). To test whether hTR depletion acts directly through ATR or indirectly via induction of DNA damage, we stained hTRkd cells for -H2AX foci. MCF7 cells were transfected with hTRkd or vector control or irradiated as positive control. While IR generated -H2AX foci, no increase in foci formation above control was observed in cells expressing hTRkd shRNA, hTRkd siRNA (data not shown) (Fig. 3G). A similar result was obtained previously with 53BP1 foci in LOX cells (46). Thus, we found no evidence of DNA damage in cells depleted of hTR supporting the notion that the effects of hTR on ATR are direct. Altogether, our results show that the expression of hTR influences ATR kinase activity in vivo.
Partial Abrogation of the G2/M Checkpoint and Enhanced Appearance of Fragile Sites by hTR ExpressionATR has been shown to be involved in the radiation-induced G2/M phase checkpoint in eukaryotic cells as it prevents mitotic entry of cells mainly in the late phase of the response to IR and cooperates with ATM in the early phase of the response (42). Since our results show that hTR inhibits ATR, we studied the effects of hTR expression on the G2/M checkpoint. We monitored mitotic entry of MCF7 cells in response to IR as a measure for the number of cells able to arrest in G2/M. We transfected MCF7 cells with CMV-hTR and as controls ATRkd, p53kd, or CMV-control constructs (for validation of the ATRkd constructs, see supplemental Fig. S9). Three days later we irradiated cells with 5 Gy IR and treated the cells with nocodazole to inhibit progression of the cell cycle in mitosis. Cells were then fixed, stained with Hoechst and mitotic cells were counted (Fig. 4A). While we found no difference in the accumulation of mitotic cells in unirradiated controls, hTR overexpression, ATRkd and p53kd, showed a partial override of the G2/M arrest. In contrast, cells expressing a truncated form of hTR (hTR211) behaved as control cells. Notably, hTR levels are only moderately increased in MCF7 cells upon expression of CMV-hTR (a 35% increase, supplemental Fig. S10). Altogether, these results indicate that an increase in hTR levels impairs ATR-mediated DNA damage responses in a manner similar to those induced by loss of ATR.

View larger version (43K):
[in this window]
[in a new window]
|
FIGURE 4. hTR partially abrogates the G2/M checkpoint and enhances the expression of fragile sites. A, MCF7 cells were transfected with the indicated constructs irradiated with 5 Gy IR or mock treated 3 days later and incubated with nocodazole. Twenty-our hours later, cells were fixed and stained with Hoechst, and mitotic entry was scored. S.D. from three independent experiments is shown. B, the expression of fragile sites in U2OS cells transfected with the indicated constructs. Pictures were made with x1000 magnification. C, quantification of the expression of fragile sites in U2OS cells as shown in Fig. 4B. The number of fragile sites expressed in 400 chromosomes is shown; data are representative of three independent experiments.
|
|
To further investigate whether hTR expression perturbs ATR function, we studied fragile sites stability in U2OS cells. Common fragile sites are specific chromosomal loci that appear as constrictions, gaps, or breaks on metaphase chromosomes from cells that have been exposed to partial inhibition of DNA replication (63). Addition of low levels of the DNA polymerase inhibitor aphidicolin to cells in culture has been shown to induce fragile sites. ATR recognizes stalled and collapsed DNA replication forks and activates their repair and the restarting of replication. Fragile sites are believed to be expressed when stalled forks escape the ATR replication surveillance (64). We transfected U2OS cells with CMV-hTR, ATRkd, or CMV-ctrl, and treated the cells for 24 h with aphidicolin. Chromosomes were fixed, stained, and dropped onto slides to count chromosomes and fragile sites. Upon inhibition of replication, we found fragile sites instability in control cells, which was exacerbated by either loss of ATR or expression of hTR (Fig. 4B). Quantification of the frequency of fragile sites expression showed a 2-fold increase in the number of fragile sites in the hTR expressing cells as well as in the ATRkd cells (Fig. 4C). As maintaining low levels of fragile site expression are a prime function of ATR, our results indicate that hTR inhibits ATR activity. Altogether, these results show that hTR inhibits ATR activity to a level sufficient to impair different ATR-mediated DNA-damage checkpoint responses, implying a novel function for hTR.

View larger version (37K):
[in this window]
[in a new window]
|
FIGURE 5. Up-regulation of hTR levels following UV radiation. A, RPA performed on extracts from BJ cells and BJ cells immortalized with hTERT irradiated with 3 J/m2 UV or 4 Gy ionizing radiation. Cells were harvested after irradiation at the indicated time points, and quantification was performed by densitometry. B, quantification of RPAs on extracts of BJ cells irradiated with either 3 J/m2 UV or 4Gy ionizing radiation. Samples were harvested at indicated time points after irradiation. S.D. is from three independent experiments; band intensities were quantified by densitometry. C, RPA performed on extracts of GM847 cells irradiated with 3 J/m2 UV as in A. D, quantification of RPAs on extracts of the indicated cells irradiated with 3 J/m2 UV. UCN-01 was added to a final concentration of 100 nM 1 h prior to irradiation. S.D. is from three independent experiments. Ctr, control; Vec, vector.
|
|
hTR Up-regulation following UV RadiationWe next set out to elucidate the function of the inhibitory effect of hTR on ATR. To this end, we investigated whether stimuli that activate ATR also influence the expression of hTR. We treated primary BJ fibroblasts and BJ cells overexpressing hTERT (BJ-ET) with 3 J/m2 UV light and extracted RNA at several time points after radiation. Subsequently, we subjected these RNA extracts to RPA with an hTR probe and cyclophilin or GAPDH as controls. Fig. 5A shows that following UV radiation, but not IR (4 Gy), hTR levels increase in parent BJ cells. In BJ-ET cells, as published previously (30), higher levels of hTR are detected in untreated cells. Still, a clear up-regulation of hTR levels following UV treatment is detected (Fig. 5A). The increase in hTR level following UV radiation was not due to a cell cycle arrest of the cells, as hTR levels did not increase in IR-treated cells (Fig. 5, A and B).
Next, we characterized the response of hTR to UV. First, we examined dependence on hTERT by using GM847 cells that express hTR but not hTERT. Also in these cells hTR was up-regulated in response to UV radiation (Fig. 5C), indicating that the up-regulation of hTR is independent of hTERT. Second, we investigated whether the up-regulation of hTR is dependent upon p53 or CHK1 activity by using BJ-p53kd cells and cells treated with UCN-01. In these experiments, hTR was still up-regulated in response to UV radiation when compared with control time points, indicating that p53 and CHK1 are not involved in the up-regulation of hTR in response to UV radiation (Fig. 5D). Collectively, we uncovered that hTR is specifically up-regulated in response to low levels of UV radiation. This up-regulation is not observed in response to ionizing radiation and is independent of p53, CHK1, and hTERT.
 |
DISCUSSION
|
|---|
We have identified a causative genetic interaction between the hTR and the checkpoint kinase ATR. Ectopic expression of hTR inhibits ATR, while reduction in hTR levels stimulates ATR activity. This interaction is independent of telomerase activity and telomere length as it was observed in cells lacking hTERT and in young primary human cells with telomeres long enough to allow proliferation for at least 20 to 30 passages. Interestingly, the effect of hTR on ATR activity was strong enough to influence cellular pathways. Inhibition of hTR expression elicited a p53/CHK1-dependent cell cycle arrest in the absence of apparent DNA damage, while increased expression of hTR caused defects in ATR-dependent checkpoints, such as override of the G2/M arrest in response to DNA damage and the enhanced induction of fragile sites. These effects are specific since the hTR knockdowns do not elicit any interferon response and phenotypically depend on the endogenous expression of hTR, and the effects were observed with mild (less than 50% above endogenous) overexpression of hTR. Notably, such a mild increase in hTR expression is also observed when cells are UV irradiated, indicating that such an increase is sufficient to impair ATR dependent checkpoints (Fig. 5B). An important observation is that both the inhibition of ATR activity by hTR and the up-regulation of hTR by UV damage are independent of hTERT. Activation of ATR in response to UV is very rapid, occurring within minutes (Fig. 3, A and B), whereas the increase in hTR levels takes several hours and is comparable with the increase seen in MCF7 cells following hTR overexpression resulting in checkpoint suppression (Fig. 5B and supplemental Fig. S10). These kinetics are consistent with the idea that cell cycle inhibition has to be rapid while the recovery takes several hours, depending on the extent of damage. Based on these findings, our results imply a model where up-regulation of hTR in response to UV constitutes a feedback loop bringing down ATR activity to reinitiate cell cycle progression (Fig. 6).

View larger version (16K):
[in this window]
[in a new window]
|
FIGURE 6. Model for the hTR-mediated negative feedback loop on ATR activity in response to UV. Low levels of UV radiation activate the ATR kinase early in the UV response, which phosphorylates downstream targets, among which are p53 and Chk1, leading to a cell cycle arrest and induction of DNA repair. Independently, hTR levels are increased by a yet unknown mechanism. These increased hTR levels inhibit ATR at a later stage.
|
|
Our results show that reduction in endogenous hTR levels leads to ATR activation without the induction of apparent DNA damage. These results prompted us to investigate whether ATR and hTR interact directly. Interestingly, homologues of ATR in yeast and Arabidopsis are involved in telomere metabolism and in yeast Mec1p (ATR homolog) associates with telomeres (38, 43, 65, 66). We were unable to demonstrate a direct interaction of ATR and hTR. Thus, our further experiments should elucidate by which mechanism hTR influences ATR activity. ATR was previously shown to be involved in signaling pathways activated by replication arrest and DNA damage assault in cells in S and G2 phases (42, 62, 67). Common fragile sites are known to be susceptible hotspots to chromosomal breakage, rearrangement, and deletion and have been implicated in the genomic instability frequently observed in cancer (63). ATR is involved in maintaining the stability of fragile sites, as its inhibition leads to an increase in the expression of fragile sites (64). Our findings demonstrate that hTR expression induces the appearance of fragile sites to an extent similar to ATRkd, thus suggesting that an increase in hTR levels can lead to genomic instability. Supporting this conclusion is our observation that an increase in hTR levels weakens the G2/M arrest, a checkpoint controlled also by ATR. These results also suggest that hTR expression can lead to reduced fidelity of the ATR-dependent checkpoints and therefore to increased genomic instability.
Recently, the group of Elizabeth Blackburn has shown that reduction in hTR levels in cancer cells elicits a rapid anti-proliferative response (46). However, when comparing hTR knockdown in HCT116 cells with p53-null HCT116 cells they conclude that the growth inhibitory response is p53 independent. Our results, on the other hand, indicate a partial dependence on p53 function. One obvious reason for this discrepancy can be that Li et al. (46) based their conclusion on results obtained with two HCT116 cell lines with very different growth rates, the p53-null cell line grows an order of magnitude slower than the wild type cell line, making a comparison between growth inhibitions very difficult. In contrast, we used in our study primary human BJ and TIG3 fibroblasts as well as MCF7 breast carcinoma cells and directly compared them with corresponding knockdown p53 cells. Furthermore, our results clearly indicate that the regulation of ATR by hTR is sufficient to affect cellular pathways.
Our results seem to contrast the findings that mTR-/- mice have no obvious phenotype in the first generations (34). The fact that first generation mTR-/- mice are less prone to developing skin tumors upon chemical carcinogenesis can be explained by mild activation of some DNA damage checkpoints induced by loss of mTR (35). Whether this effect is mediated through ATR remains to be elucidated. Additionally, there are several differences between mouse and human telomere homeostasis that complicate extending findings from mouse models to the human setting. First, murine cells have extremely long and hypervariable telomeres, and telomerase activity is detectable in most somatic tissues (68, 69). Second, although telomerase is activated and mTR is up-regulated in vivo in several mouse tumor models, it appears not to be required for growth during the cell divisions necessary for tumor formation, suggesting that mTR and/or telomerase have additional functions to telomere extension (32-34). In addition, telomere dysfunction in mice appears to be solely dependent on p53, whereas in human cells the pRB pathway is also activated (70, 71). Third, while RNA interference causes a fast reduction in hTR levels, knock-out of telomerase RNA in germ line cells may allow for compensation events to occur (36). Thus, our results may indicate for either a difference in telomerase RNA biology between mice and men or to differences in methods used. Further experiments with murine cells are required to establish whether mTR also regulates ATR.
Last, our results may provide an explanation why in the vast majority of somatic human cells, hTR is ubiquitously expressed, whereas both hTERT and telomerase activity are mostly absent. hTR regulates DNA damage pathways in a telomerase and hTERT-independent manner. Our results, thus, can explain observations suggesting that hTR plays a role in the initiation of tumorigenicity and that it is frequently up-regulated in human cancer cell lines (23-33).
 |
FOOTNOTES
|
|---|
* This work was supported by grants from the Dutch Cancer Society (Koningin Wilhelmina Fonds) (to M. K. and R. A.) and by a EURYI award (to R. A.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1-S10. 
This article was selected as a Paper of the Week. 
1 To whom correspondence should be addressed: Division of Tumor Biology, The Netherlands Cancer Institute, Plesmanlaan 121, 1066CX, Amsterdam, The Netherlands. Tel.: 31-20-512-2079; Fax: 31-20-512-2029; E-mail: r.agami{at}nki.nl
2 The abbreviations used are: ALT, alternative lengthening of telomeres; TERT, telomerase reverse transcriptase; hTR, human telomerase RNA; mTR, mouse telomerase RNA; ATM, ataxia-telangiectasia-mutated protein; ATR, ataxia-telangiectasia and Rad3-related protein; PIKK, phosphatidylinositol 3-kinase-like protein kinase; PBS, phosphate-buffered saline; CMV, cytomegalovirus; TAP, tandem affinity purification; GST, glutathione S-transferase; RT, reverse transcriptase; TRAP, telomeric repeat amplification protocol; TEV, tobacco etch virus; snoRNA, small nucleolar RNA; Gy, gray; RPA, RNase protection assay; siRNA, small interfering RNA; shRNA, short hairpin RNA; IR, ionizing radiation. 
 |
ACKNOWLEDGMENTS
|
|---|
We thank all members of the Agami laboratory for stimulating discussions and Steve Jackson and Batsheva Kerem for reagents.
 |
REFERENCES
|
|---|
- Hayflick, L., and Moorhead, P. S. (1961) Exp. Cell Res. 25, 585-621[CrossRef][Medline]
[Order article via Infotrieve]
- Cong, Y. S., Wright, W. E., and Shay, J. W. (2002) Microbiol. Mol. Biol. Rev. 66, 407-425, table of contents[Abstract/Free Full Text]
- Harley, C. B., Futcher, A. B., and Greider, C. W. (1990) Nature 345, 458-460[CrossRef][Medline]
[Order article via Infotrieve]
- Hemann, M. T., Strong, M. A., Hao, L. Y., and Greider, C. W. (2001) Cell 107, 67-77[CrossRef][Medline]
[Order article via Infotrieve]
- d'Adda di Fagagna, F., Reaper, P. M., Clay-Farrace, L., Fiegler, H., Carr, P., Von Zglinicki, T., Saretzki, G., Carter, N. P., and Jackson, S. P. (2003) Nature 426, 194-198[CrossRef][Medline]
[Order article via Infotrieve]
- Stewart, S. A., Ben-Porath, I., Carey, V. J., O'Connor, B. F., Hahn, W. C., and Weinberg, R. A. (2003) Nat. Genet. 33, 492-496[CrossRef][Medline]
[Order article via Infotrieve]
- Takai, H., Smogorzewska, A., and de Lange, T. (2003) Curr. Biol. 13, 1549-1556[CrossRef][Medline]
[Order article via Infotrieve]
- Herbig, U., Jobling, W. A., Chen, B. P., Chen, D. J., and Sedivy, J. M. (2004) Mol. Cell 14, 501-513[CrossRef][Medline]
[Order article via Infotrieve]
- Shay, J. W., Pereira-Smith, O. M., and Wright, W. E. (1991) Exp. Cell Res. 196, 33-39[CrossRef][Medline]
[Order article via Infotrieve]
- Kim, N. W., Piatyszek, M. A., Prowse, K. R., Harley, C. B., West, M. D., Ho, P. L., Coviello, G. M., Wright, W. E., Weinrich, S. L., and Shay, J. W. (1994) Science 266, 2011-2015[Abstract/Free Full Text]
- Shay, J. W., and Bacchetti, S. (1997) Eur. J. Cancer 33, 787-791[CrossRef][Medline]
[Order article via Infotrieve]
- Bryan, T. M., Englezou, A., Gupta, J., Bacchetti, S., and Reddel, R. R. (1995) EMBO J. 14, 4240-4248[Medline]
[Order article via Infotrieve]
- Greider, C. W., and Blackburn, E. H. (1985) Cell 43, 405-413[CrossRef][Medline]
[Order article via Infotrieve]
- Lingner, J., Hughes, T. R., Shevchenko, A., Mann, M., Lundblad, V., and Cech, T. R. (1997) Science 276, 561-567[Abstract/Free Full Text]
- Masutomi, K., Yu, E. Y., Khurts, S., Ben-Porath, I., Currier, J. L., Metz, G. B., Brooks, M. W., Kaneko, S., Murakami, S., DeCaprio, J. A., Weinberg, R. A., Stewart, S. A., and Hahn, W. C. (2003) Cell 114, 241-253[CrossRef][Medline]
[Order article via Infotrieve]
- Wright, W. E., Piatyszek, M. A., Rainey, W. E., Byrd, W., and Shay, J. W. (1996) Dev. Genet. 18, 173-179[CrossRef][Medline]
[Order article via Infotrieve]
- Counter, C. M., Avilion, A. A., LeFeuvre, C. E., Stewart, N. G., Greider, C. W., Harley, C. B., and Bacchetti, S. (1992) EMBO J. 11, 1921-1929[Medline]
[Order article via Infotrieve]
- Feng, J., Funk, W. D., Wang, S. S., Weinrich, S. L., Avilion, A. A., Chiu, C. P., Adams, R. R., Chang, E., Allsopp, R. C., Yu, J., Le, S., West, W. D., Harley, C. B., Andrews, W. H., Greider, C. W., and Villeponteau, B. (1995) Science 269, 1236-1241[Abstract/Free Full Text]
- Chen, J. L., Blasco, M. A., and Greider, C. W. (2000) Cell 100, 503-514[CrossRef][Medline]
[Order article via Infotrieve]
- Mitchell, J. R., Wood, E., and Collins, K. (1999) Nature 402, 551-555[CrossRef][Medline]
[Order article via Infotrieve]
- Vulliamy, T., Marrone, A., Goldman, F., Dearlove, A., Bessler, M., Mason, P. J., and Dokal, I. (2001) Nature 413, 432-435[CrossRef][Medline]
[Order article via Infotrieve]
- Chiang, Y. J., Hemann, M. T., Hathcock, K. S., Tessarollo, L., Feigenbaum, L., Hahn, W. C., and Hodes, R. J. (2004) Mol. Cell. Biol. 24, 7024-7031[Abstract/Free Full Text]
- Soder, A. I., Hoare, S. F., Muir, S., Going, J. J., Parkinson, E. K., and Keith, W. N. (1997) Oncogene 14, 1013-1021[CrossRef][Medline]
[Order article via Infotrieve]
- Brown, D. F., Gazdar, A. F., White, C. L., 3rd, Yashima, K., Shay, J. W., and Rushing, E. J. (1997) J. Neuropathol. Exp. Neurol. 56, 1349-1355[Medline]
[Order article via Infotrieve]
- Rushing, E. J., Yashima, K., Brown, D. F., White, C. L., III, Shay, J. W., Risser, R. C., and Gazdar, A. F. (1997) J. Neuropathol. Exp. Neurol. 56, 1142-1146[Medline]
[Order article via Infotrieve]
- Morales, C. P., Lee, E. L., and Shay, J. W. (1998) Cancer 83, 652-659[CrossRef][Medline]
[Order article via Infotrieve]
- Maitra, A., Yashima, K., Rathi, A., Timmons, C. F., Rogers, B. B., Shay, J. W., and Gazdar, A. F. (1999) Cancer 85, 741-749[CrossRef][Medline]
[Order article via Infotrieve]
- Yashima, K., Litzky, L. A., Kaiser, L., Rogers, T., Lam, S., Wistuba, I. I., Milchgrub, S., Srivastava, S., Piatyszek, M. A., Shay, J. W., and Gazdar, A. F. (1997) Cancer Res. 57, 2373-2377[Abstract/Free Full Text]
- Yashima, K., Milchgrub, S., Gollahon, L. S., Maitra, A., Saboorian, M. H., Shay, J. W., and Gazdar, A. F. (1998) Clin. Cancer Res. 4, 229-234[Abstract]
- Yi, X., Tesmer, V. M., Savre-Train, I., Shay, J. W., and Wright, W. E. (1999) Mol. Cell. Biol. 19, 3989-3997[Abstract/Free Full Text]
- Dome, J. S., Bockhold, C. A., Li, S. M., Baker, S. D., Green, D. M., Perlman, E. J., Hill, D. A., and Breslow, N. E. (2005) J. Clin. Oncol. 23, 9138-9145[Abstract/Free Full Text]
- Blasco, M. A., Rizen, M., Greider, C. W., and Hanahan, D. (1996) Nat. Genet. 12, 200-204[CrossRef][Medline]
[Order article via Infotrieve]
- Broccoli, D., Godley, L. A., Donehower, L. A., Varmus, H. E., and de Lange, T. (1996) Mol. Cell. Biol. 16, 3765-3772[Abstract]
- Blasco, M. A., Lee, H. W., Hande, M. P., Samper, E., Lansdorp, P. M., DePinho, R. A., and Greider, C. W. (1997) Cell 91, 25-34[CrossRef][Medline]
[Order article via Infotrieve]
- Gonzalez-Suarez, E., Samper, E., Flores, J. M., and Blasco, M. A. (2000) Nat. Genet. 26, 114-117[CrossRef][Medline]
[Order article via Infotrieve]
- Sage, J., Miller, A. L., Perez-Mancera, P. A., Wysocki, J. M., and Jacks, T. (2003) Nature 424, 223-228[CrossRef][Medline]
[Order article via Infotrieve]
- d'Adda di Fagagna, F., Teo, S.-H., and Jackson, S. P. (2004) Genes Dev. 18, 1781-1799[Abstract/Free Full Text]
- Takata, H., Kanoh, Y., Gunge, N., Shirahige, K., and Matsuura, A. (2004) Mol. Cell 14, 515-522[CrossRef][Medline]
[Order article via Infotrieve]
- Verdun, R. E., Crabbe, L., Haggblom, C., and Karlseder, J. (2005) Mol. Cell 20, 551-561[CrossRef][Medline]
[Order article via Infotrieve]
- Sancar, A., Lindsey-Boltz, L. A., Unsal-Kacmaz, K., and Linn, S. (2004) Annu. Rev. Biochem. 73, 39-85[CrossRef][Medline]
[Order article via Infotrieve]
- Karlseder, J., Hoke, K., Mirzoeva, O. K., Bakkenist, C., Kastan, M. B., Petrini, J. H., and de Lange, T. (2004) PLoS Biol. 2, E240[CrossRef][Medline]
[Order article via Infotrieve]
- Brown, E. J., and Baltimore, D. (2003) Genes Dev. 17, 615-628[Abstract/Free Full Text]
- Vespa, L., Couvillion, M., Spangler, E., and Shippen, D. E. (2005) Genes Dev. 19, 2111-2115[Abstract/Free Full Text]
- Hahn, W. C., Stewart, S. A., Brooks, M. W., York, S. G., Eaton, E., Kurachi, A., Beijersbergen, R. L., Knoll, J. H., Meyerson, M., and Weinberg, R. A. (1999) Nat. Med. 5, 1164-1170[CrossRef][Medline]
[Order article via Infotrieve]
- Herbert, B., Pitts, A. E., Baker, S. I., Hamilton, S. E., Wright, W. E., Shay, J. W., and Corey, D. R. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 14276-14281[Abstract/Free Full Text]
- Li, S., Crothers, J., Haqq, C. M., and Blackburn, E. H. (2005) J. Biol. Chem. 280, 23709-23717[Abstract/Free Full Text]
- Li, S., Rosenberg, J. E., Donjacour, A. A., Botchkina, I. L., Hom, Y. K., Cunha, G. R., and Blackburn, E. H. (2004) Cancer Res. 64, 4833-4840[Abstract/Free Full Text]
- Brummelkamp, T. R., Bernards, R., and Agami, R. (2002) Cancer Cell 2, 243-247[CrossRef][Medline]
[Order article via Infotrieve]
- Voorhoeve, P. M., and Agami, R. (2003) Cancer Cell 4, 311-319[CrossRef][Medline]
[Order article via Infotrieve]
- Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., and Seraphin, B. (1999) Nat. Biotechnol. 17, 1030-1032[CrossRef][Medline]
[Order article via Infotrieve]
- Agami, R., and Bernards, R. (2000) Cell 102, 55-66[CrossRef][Medline]
[Order article via Infotrieve]
- Duursma, A., and Agami, R. (2005) Mol. Cell. Biol. 25, 6937-6947[Abstract/Free Full Text]
- Kim, N. W., and Wu, F. (1997) Nucleic Acids Res. 25, 2595-2597[Abstract/Free Full Text]
- Scherr, M., Battmer, K., Schultheis, B., Ganser, A., and Eder, M. (2005) Gene Ther. 12, 12-21[CrossRef][Medline]
[Order article via Infotrieve]
- Bryan, T. M., Englezou, A., Dalla-Pozza, L., Dunham, M. A., and Reddel, R. R. (1997) Nat. Med. 3, 1271-1274[CrossRef][Medline]
[Order article via Infotrieve]
- Scheel, C., Schaefer, K. L., Jauch, A., Keller, M., Wai, D., Brinkschmidt, C., van Valen, F., Boecker, W., Dockhorn-Dworniczak, B., and Poremba, C. (2001) Oncogene 20, 3835-3844[CrossRef][Medline]
[Order article via Infotrieve]
- Brummelkamp, T. R., Bernards, R., and Agami, R. (2002) Science 296, 550-553[Abstract/Free Full Text]
- Busby, E. C., Leistritz, D. F., Abraham, R. T., Karnitz, L. M., and Sarkaria, J. N. (2000) Cancer Res. 60, 2108-2112[Abstract/Free Full Text]
- Graves, P. R., Yu, L., Schwarz, J. K., Gales, J., Sausville, E. A., O'Connor, P. M., and Piwnica-Worms, H. (2000) J. Biol. Chem. 275, 5600-5605[Abstract/Free Full Text]
- Tibbetts, R. S., Brumbaugh, K. M., Williams, J. M., Sarkaria, J. N., Cliby, W. A., Shieh, S. Y., Taya, Y., Prives, C., and Abraham, R. T. (1999) Genes Dev. 13, 152-157[Abstract/Free Full Text]
- Zhao, H., and Piwnica-Worms, H. (2001) Mol. Cell. Biol. 21, 4129-4139[Abstract/Free Full Text]
- Heffernan, T. P., Simpson, D. A., Frank, A. R., Heinloth, A. N., Paules, R. S., Cordeiro-Stone, M., and Kaufmann, W. K. (2002) Mol. Cell. Biol. 22, 8552-8561[Abstract/Free Full Text]
- Schwartz, M., Zlotorynski, E., and Kerem, B. (2006) Cancer Lett. 232, 13-26[CrossRef][Medline]
[Order article via Infotrieve]
- Casper, A. M., Nghiem, P., Arlt, M. F., and Glover, T. W. (2002) Cell 111, 779-789[CrossRef][Medline]
[Order article via Infotrieve]
- Ritchie, K. B., Mallory, J. C., and Petes, T. D. (1999) Mol. Cell. Biol. 19, 6065-6075[Abstract/Free Full Text]
- Takata, H., Tanaka, Y., and Matsuura, A. (2005) Mol. Cell 17, 573-583[CrossRef][Medline]
[Order article via Infotrieve]
- Shechter, D., Costanzo, V., and Gautier, J. (2004) Nat. Cell Biol. 6, 648-655[CrossRef][Medline]
[Order article via Infotrieve]
- Kipling, D., and Cooke, H. J. (1990) Nature 347, 400-402[CrossRef][Medline]
[Order article via Infotrieve]
- Prowse, K. R., and Greider, C. W. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 4818-4822[Abstract/Free Full Text]
- Smogorzewska, A., and de Lange, T. (2002) EMBO J. 21, 4338-4348[CrossRef][Medline]
[Order article via Infotrieve]
- Chin, L., Artandi, S. E., Shen, Q., Tam, A., Lee, S. L., Gottlieb, G. J., Greider, C. W., and DePinho, R. A. (1999) Cell 97, 527-538[CrossRef][Medline]
[Order article via Infotrieve]

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. K. Garcia, W. E. Wright, and J. W. Shay
Human diseases of telomerase dysfunction: insights into tissue aging
Nucleic Acids Res.,
December 3, 2007;
35(22):
7406 - 7416.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hsu, M. J. McEachern, A. T. Dandjinou, Y. Tzfati, E. Orr, E. H. Blackburn, and N. F. Lue
Telomerase core components protect Candida telomeres from aberrant overhang accumulation
PNAS,
July 10, 2007;
104(28):
11682 - 11687.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|