JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M512128200 on December 12, 2005

J. Biol. Chem., Vol. 281, Issue 8, 4557-4563, February 24, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/8/4557    most recent
M512128200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vos, M. D.
Right arrow Articles by Clark, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vos, M. D.
Right arrow Articles by Clark, G. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The RASSF1A Tumor Suppressor Activates Bax via MOAP-1*

Michele D. Vos{ddagger}, Ashraf Dallol§, Kristin Eckfeld{ddagger}, Nadia P. C. Allen{ddagger}, Howard Donninger{ddagger}, Luke B. Hesson§, Diego Calvisi, Farida Latif§1, and Geoffrey J. Clark{ddagger}2

From the {ddagger} Department of Cell and Cancer Biology, NCI, National Institutes of Health, Rockville, Maryland 20850-3300, the Department of Biomedical Sciences, University of Sassari, 07110 Sassari, Italy, and the §Section of Medical and Molecular Genetics, Division of Reproductive and Child Health, University of Birmingham, Birmingham B15 2TT, United Kingdom

Received for publication, November 10, 2005


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The novel tumor suppressor RASSF1A is frequently inactivated during human tumorigenesis by promoter methylation. RASSF1A may serve as a node in the integration of signaling pathways controlling a range of critical cellular functions including cell cycle, genomic instability, and apoptosis. The mechanism of action of RASSF1A remains under investigation. We now identify a novel pathway connecting RASSF1A to Bax via the Bax binding protein MOAP-1. RASSF1A and MOAP-1 interact directly, and this interaction is enhanced by the presence of activated K-Ras. RASSF1A can activate Bax via MOAP-1. Moreover, activated K-Ras, RASSF1A, and MOAP-1 synergize to induce Bax activation and cell death. Analysis of a tumor-derived point mutant of RASSF1A showed that the mutant was defective for the MOAP-1 interaction and for Bax activation. Moreover, inhibition of RASSF1A by shRNA impaired the ability of K-Ras to activate Bax. Thus, we identify a novel pro-apoptotic pathway linking K-Ras, RASSF1A and Bax that is specifically impaired in some human tumors.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The RASSF1 gene is localized at the 3p21.3 site of frequent loss of heterozygosity in lung tumors (1). It produces multiple protein isoforms, the most commonly detected being RASSF1A and RASSF1C. Loss of expression of the RASSF1A isoform is a frequent event in primary human tumors (2–5), and re-expression of RASSF1A in human tumor cell lines inhibits their tumorigenic phenotype (1, 6). Moreover, knock-out mice defective for RASSF1A are prone to tumor development (7). These observations have led to the conclusion that RASSF1A is a tumor suppressor that plays a key role in the development of human cancer. Down-regulation of RASSF1A expression in human tumors typically occurs via promoter methylation (2–5). The frequency of RASSF1A silencing in human tumors is high, ranging from ~40–50% in breast, prostate, and ovarian tumors, to 30–80% in lung tumors and more than 90% in renal cell carcinomas (8). Thus, RASSF1A may be among the most important tumor suppressors yet identified. RASSF1 is the founding member of a family of six genes. Several other members of the family also exhibit biological properties compatible with a tumor suppressor function (9–12).

The most interesting structural features of the RASSF proteins are the presence of a Ras association (RA) domain and, in the cases of RASSF1A and Nore1 (RASSF5), a cysteine-rich domain (CRD).3 Both of these domains have the theoretical potential to directly bind the activated Ras oncoprotein (13–15). Nore1 (RASSF5) can be detected in an endogenous complex with Ras (16). RASSF1A can be co-precipitated with activated H-Ras in overexpression systems (17). Moreover, the RASSF1A RA domain can directly bind activated H-Ras in vitro (18). Although some authors have found the direct binding of RASSF1A to H-Ras to be relatively weak (17, 19), others have found that the predicted binding energy of Ras and the RA domain of RASSF1 is compatible with a physiological role for the interaction (20). Thus, Ras has the potential to modulate RASSF family activity.

RASSF proteins can induce cell cycle arrest and participate in apoptotic programs (8, 19–25), but the mechanism of action of RASSF1A (and other RASSF1 splice variants) remains under intense investigation. It is now apparent that RASSF1A has the potential to serve as a link between a diverse series of critical cellular processes. RASSF1A binds the p120 E4F transcription factor that forms a complex with both the Rb and p53 tumor suppressors (26). Thus, RASSF1A has the potential to influence the function of two of the most potent tumor suppressors in the cell. RASSF1A can interact with the scaffold molecule CNK, potentially linking RASSF1A to Ral, Rho, and Raf regulation (24). RASSF1A binds to and modulates the activity of the cdc20·APC complex, thus regulating cell cycle progression and influencing genomic stability (21). RASSF1A also binds to the pro-apoptotic kinases MST1 and MST2 (25). Furthermore, RASSF1A associates with tubulin and can modulate its polymerization (22, 27, 28). Thus, RASSF1A may influence the cell cycle, motility, and genomic stability via the control of microtubules. Although the physiological significance of some of these interactions remains to be confirmed, clearly RASSF1A has the potential to modulate and integrate a series of disparate, critical cellular processes involved in tumor suppression.

We have now identified a further key cellular process that may be modified by RASSF1A: the regulation of Bcl-2 family proteins. We found that RASSF1A directly binds the protein Modulator of Apoptosis-1 (MOAP-1) (29) in a two-hybrid screen. MOAP-1 binds Bcl-2 family proteins, including the pro-apoptotic member Bax (29, 30). We have determined that RASSF1A and MOAP-1 can interact in mammalian cells and that the interaction is enhanced in the presence of activated K-Ras. Further analysis demonstrated that wild type RASSF1A but not a tumor derived point mutant can activate Bax via MOAP-1. K-Ras not only enhanced the interaction of RASSF1A and MOAP-1 but also stimulated the ability of RASSF1A to activate Bax and induce cell death. Finally, using an shRNA construct against RASSF1A, we found that the ability of K-Ras 12v to activate Bax is dependent upon RASSF1A. Thus, we identify a novel pro-apoptotic pathway connecting RASSF1A to Bax.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Yeast Two-hybrid Screen—Yeast two-hybrid screening was performed as described previously (26). Briefly, the bait vector pGBKT7-RASSF1A was transformed in yeast strain Saccharomyces cerevisiae AH109 (RASSF1A-BD) using the LiAc/polyethylene glycol method and selected on Trp–plates. Strain AH109 includes four reporter genes ADE2, HIS3, lacZ, and MEL1 whose expression is regulated by GAL4 responsive upstream activating sequences and promoter elements. The bait RASSF1A-BD was then used to screen a pretransformed MATCHMAKER brain library (Clontech, Palo Alto, CA), cloned in pACT2, by mating with the yeast strain

S. cerevisiae Y187—A total of 6 x 106 clones were screened, of which 103 were positive for beta-galactosidase expression. Positive clones were sequenced and identified using NCBI BLASTN/BLASTX. Clones were rescued and retransformed into yeast to confirm positive interactions using co-transformation assays. For yeast co-transformation assays, AH109 yeast cells were transformed with the appropriate vectors using the LiAc/polyethylene glycol method and yeastmaker yeast transformation system 2 (Clontech). Cells were plated onto selection medium with added 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside and incubated for 4–8 days.

Plasmids and DNA—The coding region of MOAP-1 was cloned by PCR using expressed sequence tag BC015044 [GenBank] IMAGE clone 3922055 with primers incorporating EcoRI and XhoI restriction sites. The PCR products were fully sequenced and cloned into pCMV-MyC (Clontech) or pEGFP-C2 (using EcoRI/BamHI). Bax plasmids were a generous gift (R. J. Youle, NCI, National Institutes of Health), Ras, and RASSF1A reagents have been described previously (18). The BH3 domain of MOAP-1 was cloned in pCDNAF (18) by PCR with primers incorporating BamHI and EcoRI restriction sites at the 5' and 3' ends, respectively. An RA domain mutant of RASSF1A was made using a QuikChange kit (Stratagene, La Jolla, CA) to convert residues 299–231 from LRK to QQE.

Cell Culture and Assays—293-T cells were grown in Dulbecco's modified Eagle's medium, 10% fetal calf serum; H1792 and H1299 human tumor cell lines were grown in RPMI, 10% fetal calf serum at 37 °C in 10% C02. 293-T cell death assays were performed by transfecting cells with 5 µg of each plasmid using Lipofectamine 2000 (Invitrogen). After 72 h, cells were stained with 0.04% trypan blue and dead cells (stained blue) counted, as described previously (10). Bax activation assays (mitochondrial relocalization) were performed by transiently transfecting human lung tumor cell lines with either 1 µg of vector or RASSF1A and 100 ng of GFP-Bax. Cells were examined after 24–48 h and scored positive or negative for Bax clustering. Cytofluorescence studies were performed in cells grown on glass bottom microwell dishes (MatTek Corp., Ashland, MA). Live cell images were taken with an Olympus 1X50-FLA inverted fluorescent microscope (Optical Elements Corp., Dulles, VA) with an attached Spot Junior digital camera. Stable lines of H1299 cells expressing endogenous equivalent levels of RASSF1A wild type or mutant were generated by transfecting the cells with pZIP-NeoHA (18) and selecting clones in 0.5 mg/ml G418.

shRNA Studies—An shRNA expression cassette containing the hairpin sequence, ATGAAGCCGCCACAGAGGCCACACCACATCCAAACGTGGTGCGACCTCTGTGGCGACTTCAT, was cloned in the pSHAG-MAGIC1 (pSM2) vector. H1792 cells were transfected with 1–5 µg of shRNA vector and selected in puromycin. Selected cells were examined for loss of RASSF1A expression by Western analysis using a RASSF1A polyclonal antibody (22) and by qRT-PCR. qRT-PCR was performed on an iCycler real-time detection system (Bio-Rad) using the Quantitect SYBR Green RT-PCR Kit (Qiagen, Inc., Valencia, CA) as per the manufacturer's instructions. The fold change for the RASSF1A gene was calculated using the 2–{Delta}{Delta}CT method and using beta-actin as the reference gene.

Protein Binding Assays—Protein interactions were examined by transfecting 293-T cells using Lipofectamine 2000 (Invitrogen) with 5 µg of each different epitope tag containing plasmid DNA. After 48 h cells were lysed in RIPA buffer (50 mM Tris, pH 7.5, 1% Nonidet P-40, 150 mM NaCl) and immunoprecipitated for 4 h. The immunoprecipitate was washed three times and subjected to Western analysis.

Endogenous associations were detected in primary liver samples (Liver Tissue Procurement and Distribution System; Minneapolis, MN; Richmond, VA; and Pittsburgh, PA). Tissue was homogenized in 30 mM Tris, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0,1% SDS. 0.5% sodium deoxycholate, 10% glycerol, and 2 mM EDTA with protease inhibitors. 600 µg of clarified homogenate was immunoprecipitated using the catch and release reversible immunoprecipitation system (Upstate, Charlottesville, VA) according to the manufacturer's protocol and either a mouse monoclonal anti-RASSF antibody (eBioscience, San Diego, CA) or a rabbit anti-MAP-1 antobody (Novus Biologicals, Littleton, CO).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
RASSF family proteins can promote G1 and G2/M cell cycle arrest (19, 21, 23). The G2/M arrest may be due to the interaction of RASSF1A with cdc20 (21) and tubulin (22, 23, 27), whereas the G1 arrest could be due to the interaction of RASSF1A with p120 E4F (26). RASSF family proteins can also participate in apoptotic programs (8–10, 12, 24, 25) and form endogenous complexes with the pro-apoptotic kinases MST1 and MST2 (25). We have now identified a further component of the apoptotic machinery that can be modulated by RASSF1A: MOAP-1.

RASSF1A Directly Binds MOAP-1—The pro-apoptotic protein MOAP-1 (Modulator of Apoptosis-1) was determined to be a RASSF1A interaction partner in a yeast two-hybrid screen. The yeast two-hybrid analysis was performed using a full-length RASSF1A clone (26). Upon sequencing, one of the positive interacting clones was found to be amino acids 61–351 of MOAP-1 (NP_071434 [GenBank] ). The interaction between RASSF1A and MOAP-1 was confirmed in yeast by co-transformation assays with pGBKT7 + pACT2 MOAP-1 and pGBKT7 RASSF1A + pACT2-MOAP-1. These experiments confirmed MOAP-1 interacts specifically with RASSF1A and not with the GAL4 DNA binding domain encoded within the pGBKT7 vector (data not shown).

RASSF1A and MOAP-1 Interact in Cells—To determine whether RASSF1A and MOAP-1 have the ability to interact in mammalian cells, we co-transfected RFP-RASSF1A and GFP-MOAP-1 into 293-T cells and examined expressing cells by fluorescence microscopy. RASSF1A has been shown repeatedly to localize to to microtubules (22, 27). Fig. 1a shows that in the absence of RASSF1A, MOAP-1 localizes generally to the cytoplasm. However, in the presence of RASSF1A, MOAP-1 is recruited to microtubule structures with RASSF1A. As further confirmation of the microtubular location of the complex, transfected cells were treated with Taxol. In these cells, the RASSF1A·MOAP-1 complex localized to the Taxol-induced cytoplasmic asters. To confirm that the interaction was of a physiological nature, we immunoprecipitated liver lysates with a mouse monoclonal RASSF1A antibody and detected the presence of endogenous MOAP-1 (Fig. 1b) in the immunoprecipitate with an anti-MOAP-1 antibody. Interestingly, the co-immunoprecipitation of RASSF1A and MOAP-1 was only readily detectable in the samples derived form the stromal tissue surrounding the tumors.

Oncogenic K-Ras Promotes the Stabilization of RASSF1A·MOAP-1 Complexes-—Further examination (Fig. 1c) showed that MYC-tagged MOAP-1 could be co-precipitated with hemagglutinin-tagged RASSF1A when both proteins were expressed in 293-T cells. It was noticeable that the interaction appeared to be much weaker than was suggested by the results of the fluorescent microscopy. However, upon the addition of activated K-Ras to the transfection (Fig. 1c), the level of MOAP-1 co-precipitation with RASSF1A increased substantially. This result suggests that K-Ras may serve to enhance or stabilize the interaction of RASSF1A and MOAP-1. This provides a potential mechanistic explanation for the pro-apoptotic properties of K-Ras and why K-Ras activates the pro-apoptotic ability of RASSF1A.


Figure 1
View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 1.
Interaction of RASSF1A and MOAP-1. a, MOAP-1 co-localizes with RASSF1A in live 293-T cells. Cells were transfected with RFP (i), GFP-MOAP-1 (ii), RFP-RASSF1A (iii), and RFP-RASSF1A and GFP-MOAP-1 (iv). RFP-RASSF1A recruits GFP-MOAP-1 to microtubule structures. The lower panel demonstrates relocalization of MOAP-1 to asters in the presence of Taxol and RASSF1A. b, RASSF1A and MOAP-1 can be co-immunoprecipitated as an endogenous complex from stromal cells surrounding liver tumors. PC, positive control lysate; NC, negative control (immunoprecipitation without antibody); NL, normal liver; SL, stromal tissue, HCC, hepatocellularcarcinoma. c, i: MOAP-1 co-immunoprecipitates with wild type (WT or wt) but not C65R mutant RASSF1A. 293-T cells were co-transfected with HA-RASSF1A and MYC-MOAP-1 in the presence or absence of activated K-Ras. The lower two panels show a Western analysis of the cell lysate; the upper panel shows the immunoprecipitation followed by Western analysis. Precipitation of MOAP-1 with RASSF1A is enhanced in the presence of activated K-Ras. The C65R point mutant of RASSF1A is defective for association with MOAP-1. ii: cytofluorescence of GFP-RASSF1A in cells showing that the C65R mutant retains the ability to complex with microtubules. d, i: co-immunoprecipitation experiments showing that an RA domain mutant of RASSF1A (F1A.RA*) is impaired for the ability to complex with activated K-Ras in 293-T cells. ii: the RA domain mutant is defective for Ras stimulated binding to MOAP-1. iii: the Y40C effector mutant of K-Ras 12v is impaired for the ability to co-immunoprecipitate RASSF1A. iv: the Y40C effector mutant of K-Ras12v is impaired for the ability to stimulate the association of RASSF1A and MAOP-1. IP, immunoprecipitated; IB, immunoblotted.

 
The C65R Point Mutant of RASSF1A Is Defective for the Interaction with MOAP-1—Although RASSF1A is most frequently down-regulated by promoter methylation during human tumor development, several point mutations in RASSF1A have also been found in primary tumors that appear to impair some of its growth inhibitory properties (8). One of these mutations inactivates a serine phosphorylation site within RASSF1A (19). However, another mutation has been detected in the CRD of RASSF1A that also appears to impair RASSF1A function, C65R (28). The Ras effector Raf also contains a CRD, and this domain plays an important role in the function of Raf (14, 15, 31, 32). Consequently, we examined the effects of this mutation on the interaction of RASSF1A with MOAP-1.

Using co-immunoprecipitation studies, we found that the C65R mutant of RASSF1A is defective for MOAP-1 binding and does not exhibit enhanced MOAP-1 binding in the presence of activated K-Ras (Fig. 1c). This mutation is specific in its effects as the C65R form of RASSF1A retains the ability to associate with tubulin (Fig. 1c, ii). Thus, the RASSF1A/MOAP-1 pathway is precisely inactivated by a point mutation in some primary human tumors. This argues that it is an important physiological component of the tumor suppressor function of RASSF1A.

The mechanism of by which K-Ras stimulates the interaction with MOAP-1 appears to involve the direct interaction of K-Ras with the RA domain of RASSF1A as a mutant form of RASSF1A with a triple point mutation in the RA domain (RASSF1A.RA*) is impaired for the ability to co-immunoprecipitated with K-Ras and is impaired for Ras enhanced binding to MOAP-1 (Fig. 1d, i–ii). Moreover an effector domain mutant of K-Ras (K-ras12v-40C) that is impaired for RASSF1A binding is also impaired for the ability to stimulate RASSF1A/MOAP-1 association (Fig. 1d, iii–iv).

RASSF1A, MOAP-1, and K-Ras12v Synergize to Promote Cell Death— As we found that activated K-Ras promoted the formation of a complex between RASSF1A and MOAP-1, we examined the biological effects of co-transfection of K-Ras 12v, RASSF1A, and MOAP-1. Cell death assays were performed by transient transfection of 293-T cells followed by trypan blue staining after 48 h. Dead cells were detected by positive staining for trypan blue. Co-transfection of all three genes together induced synergistic cell death (Fig. 2a). The C65R mutant of RASSF1A was found to be severely impaired in its ability to induce cell death in these assays. Further assays demonstrated that a mutant form of RASSF1A that was defective for binding K-Ras was impaired for the ability to synergize with K-Ras and MOAP-1 (Fig. 2b). The 40C effector mutant of K-Ras, which is impaired for RASSF1A binding, was also impaired for the ability to promote synergistic cell death (Fig. 2b). These data suggest that that K-Ras may act directly on RASSF1A to stimulate MOAP-1 function.

RASSF1A Activates Bax via MOAP-1—MOAP-1 was originally cloned as a pro-apoptotic Bax interacting protein (29). Bax is a proapoptotic member of the Bcl-2 family (30). Bax operates by inducing mitochondrial membrane permeabilization and, upon activation, Bax relocalizes from the cytosol to coalesce into punctate, mitochondrial associated clusters (33). Consequently, it is possible to use Bax clustering as an assay for Bax activation in live cells. Although the pro-apoptotic activities of MOAP-1 were shown to be dependent upon Bax binding, the effects of MOAP-1 on Bax activation were not determined (29). To determine whether RASSF1A could activate Bax, and if this was due to MOAP-1, we first co-transfected GFP-Bax and RFP-RASSF1A into H1299 human lung tumor cells. We then examined the effects of RASSF1A on Bax activation in live cells by fluorescent microscopy. Fig. 3a shows that RASSF1A induces the relocalization and clustering of Bax. The assays are quantified in the Fig. 3b. Treatment with the apoptosis-inducing agent staurosporine served as a positive control. Thus, RASSF1A can activate Bax.


Figure 2
View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 2.
RASSF1A, MOAP-1, and activated K-Ras synergize to promote cell death. a, 293-T cells were transfected with various combinations of expression plasmids to examine the effects of RASSF1A wild type (WT or wt) and mutant, activated K-Ras and MOAP-1 on cell death. Assays were quantified by trypan blue staining. Error bars show standard error. b, an RA domain mutant of RASSF1A (F1A*) and a K-Ras effector mutant (Y40C) are defective for synergizing with MOAP-1 to induce cell death.

 
MOAP-1 binds Bax via its BH3 domain (29); thus, the isolated BH3 domain of MOAP-1 may serve as a competitive inhibitor for the interaction between full-length MOAP-1 and Bax. Co-transfection of the BH3 domain of MOAP-1 blocked the ability of RASSF1A to activate Bax (Fig. 3c), suggesting that RASSF1A activates Bax via MOAP-1.

As the C65R mutant of RASSF1A is impaired for MOAP-1 binding (Fig. 1c), we performed similar Bax activation assays with this mutant to determine whether the mutation correlated with a loss of the ability to activate Bax. We found that RASSF1A C65R is defective for Bax activation in H1299 lung tumor cells (Fig. 3c). Thus, tumor cells that retain expression of this mutant allele are likely to be impaired for Bax activation.

RASSF1A Links K-Ras to Bax—As the interaction between MOAP-1 and RASSF1A is enhanced by oncogenic K-Ras, we sought to determine whether oncogenic K-Ras activates Bax via RASSF1A/MOAP-1 and if the C65R mutant of RASSF1A was defective for this action. We used expression vectors to generate H1299 cell lines (negative for endogenous RASSF1A expression) that stably re-express exogenous wild type or mutant RASSF1A protein at a level that is comparable with the endogenous protein levels found in the RASSF1A-positive cell H1792 (Fig. 4a). We then transfected the H1299 cells +/– for RASSF1A wild type or C65R with GFP Bax and examined the cells for Bax activation. H1299 cells with restored wild type RASSF1A protein expression demonstrated enhanced activation of Bax. The C65R mutant of RASSF1A demonstrated only a relatively weak increase in Bax activation (Fig. 4b). We then transfected activated K-Ras into the H1299 cells +/– for RASSF1A expression. A strong activation of Bax by K-Ras12v was only detected in the cells expressing RASSF1A (Fig. 4c).


Figure 3
View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 3.
RASSF1A wild type but not C65R induces the MOAP-1-dependent activation of Bax in H1299 human lung tumor cells. a, H1299 cells were transfected with GFP-Bax and RFP-RASSF1A. Activation of Bax by wild type RASSF1A is detected by induced localization of GFP-Bax to mitochondrial clusters. Treatment with 1 µM concentration of the apoptosis-inducing agent staurosporine (STS) served as a positive control for Bax activation. b, quantification of a (average of three separate experiments). c, RASSF1A activation of Bax can be blocked by co-transfection with a dominant negative fragment of MOAP-1(BH3D) and is not induced by the C65R point mutant of RASSF1A. Error bars show standard error.

 
K-Ras Requires RASSF1A to Activate Bax—To confirm that K-Ras promoted Bax activation via RASSF1A, we selected a RASSF1A-positive cell line (H1792) and transfected it with an shRNA construct designed against RASSF1A. RT-PCR and Western analysis confirmed that RASSF1A expression was suppressed by the shRNA construct (Fig. 5a). The shRNA construct was specific for RASSF1A as it failed to down-regulate the closely related RASSF5 protein (Fig. 5b). We then performed co-transfection experiments with RFP-K-Ras 12v and GFP-Bax to measure the degree of Bax activation in the cells. Fig. 5c shows that the cells where the expression of endogenous RASSF1A is inhibited by the shRNA construct are defective for K-Ras12v mediated Bax activation.


Figure 4
View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 4.
Oncogenic K-Ras activates Bax in a RASSF1A-dependent manner in human tumor cells. a, H1299 cells that do not express RASSF1A were transfected with wild type (WT) RASFF1A and RASSF1A(C65R) mutant expression constructs. Clones were selected that expressed exogenous RASSF1A at levels equivalent to the H1792 cell line that expresses endogenous RASSF1A. b, H1299 cells expressing RASSF1A, no RASSF1A (vector), or the C65R mutant were transfected with GFP-Bax. The wild type RASSF1A-expressing cells show activation of Bax. c, when the same cells were transfected with oncogenic K-Ras and GFP-Bax, significant enhancement of Bax activation was seen only in the H1299 RASSF1A wild type-expressing cell line. Thus, Ras activates the ability o RASSF1A to stimulate Bax. Error bars show standard error.

 
Thus, when we restore RASSF1A expression to H1299 cells we enhance the ability of K-Ras to activate Bax and when we remove RASSF1A from H1792 cells we impair the ability of K-Ras to activate Bax.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Recent knock-out mouse studies have now confirmed the hypothesis that RASSF1A is a tumor suppressor (7). The high frequency of RASSF1A down-regulation in human tumors suggests that it will prove to be one of the more important components in the development of human cancer (8). The regulation and mechanism of action of RASSF1A remains a topic of intense investigation. It appears that like other critical tumor suppressors, RASSF1A is multifunctional. Thus, inactivation of RASSF1A may impact many different facets of tumor biology (8).

Intriguingly for a tumor suppressor, RASSF1A contains a Ras association domain and can form a complex with activated Ras when overexpressed (17). This suggests that it may be an effector for Ras or Ras-related proteins. Although intuitively one might expect an oncoprotein such as Ras to inhibit the function of RASSF1A, in fact, it appears to activate it. We have hypothesized that RASSF family proteins may serve as effectors that mediate some of the growth inhibitory aspects of Ras, including Ras-induced apoptosis (18). Thus, subversion of RASSF family protein function may be important to the development of Ras-dependent tumors. Indeed, there is evidence that loss of function of RASSF1A may correlate with the presence of activated Ras in some tumor systems (8).


Figure 5
View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 5.
shRNA inhibition of RASSF1A impairs the ability of Ras to activate Bax. a, i: lysates from H1792 cells transfected with an shRNA construct directed against RASSF1A were examined for RASSF1A expression using a RASSF1A polyclonal antibody (22). ii: qRT-PCR analysis of RASSF1A expression in the same H1792 human lung tumor cells. b, the specificity of the shRNA construct was confirmed by co-transfecting it with GFP-RASSF1A and GFP-RASSF5 into 293-T cells. After 24 h the cells were lysed and subjected to Western analysis using a GFP antibody. The shRNA construct reduced the expression of RASSF1A but not the related RASSF5 protein. c, H1792 cells stably transfected with a RASSF1A shRNA construct are impaired for RFP-K-Ras 12v-mediated GFP-Bax activation. Data presented show activation of GFP-Bax in RFP-K-Ras12v-positive cells in two assays performed in triplicate. Error bars show standard error.

 
Although the growth inhibitory effects of RASSF1A have been ascribed to the induction of cell cycle arrest (19, 21), we have detected pro-apoptotic properties for RASSF family proteins. Consequently, we were intrigued to identify the protein MOAP-1 as a potential binding partner for RASSF1A.

MOAP-1 was originally described as a pro-apoptotic protein that binds multiple members of the Bcl-2 family of proteins, including Bax (29). Bax is a key component of the pro-apoptotic machinery that upon activation plays an important role in permeabilizing mitochondrial membranes during apoptosis (30). Thus, the interaction between RASSF1A and MOAP-1 serves to connect RASSF1A with some of the most potent apoptotic machinery in the cell.

RASSF1A is typically inactivated by promoter methylation. However, several point mutations have been identified in RASSF1A in human tumors that impair its biological activity. These mutants may provide vital tools to define which RASSF1A properties are particularly important to the development of disease (8). We were particularly interested by the C65R mutation of RASSF1A that falls within the CRD. Our modeling predictions suggested that this mutation severely disrupts the secondary structure of the CRD. In the Ras effector Raf, the CRD is the site of binding of multiple regulator molecules, including Ras, 14-3-3, and phosphatidylserine (14, 15, 31, 32). Thus, it seemed likely that the CRD of RASSF1A would play an important role in the function of the protein. Our determination that the tumor-derived C65R mutant of RASSF1A is defective for MOAP-1 association and Bax activation suggests the interaction of RASSF1A with MOAP-1 is a significant component of its tumor suppressor function.

Although we can detect interactions between RASSF1A and MOAP-1 in the absence of K-Ras12v in 293-T cells, the association is enhanced in the presence of activated K-Ras. Our analysis of primary liver samples demonstrated that the interaction between RASSF1 AND MOAP-1 is difficult to detect in normal tissue and tumor tissue. Presumably normal tissue has low levels of activated Ras, and the tumors may have acquired defects in the system functionally comparable with the C65R mutant. However, we could detect the interaction in the stroma surrounding the tumors. This suggests that the stromal cells are being stimulated toward apoptosis by the tumor and that this pathway involves RASSF1A. It has previously been suggested that enhanced stromal cell apoptosis can contribute to tumor development (34).

K-Ras has previously been linked to Bax activation (35). Here we identify a mechanism for this effect by showing that the activation of Bax by K-Ras is at least partially dependent upon the presence of RASSF1A. Thus, cells with defective RASSF1A are less susceptible to apoptosis induced by activated K-Ras and hence are likely to be more sensitive to K-Ras-mediated transformation. As MOAP-1 interacts with multiple members of the Bcl-2 family, including Bax, this gives K-Ras the potential to modulate other members of the family too.

RASSF family proteins have previously been implicated in mediating the apoptotic effects of activated Ras via the Ste-20 like kinases MST1 and MST2 (18, 25, 36). The identification of a direct association between RASSF1A and MOAP-1, leading to Bax activation, demonstrates a second pro-apoptotic RASSF signaling pathway. This pathway is likely to be shared by at least some other family members as we can also detect binding between RASSF6 and MOAP-1 (data not shown).

The MST and MOAP-1 pathways may be functionally connected. MST kinases phosphorylate and activate the kinases LATs1 and LATs2 (37). These kinases have been shown to promote apoptosis and Lats2 can down-regulate the Bax-inhibiting protein Bcl-2 (38, 39). Therefore, RASSF1A may induce apoptosis by activating Bax via MOAP-1 and at the same time down-regulate Bcl-2 via the MST/LATs pathway. Thus, RASSF1A may be able to modulate synergistic apoptotic pathways. Cells defective for RASSF1A are likely to be resistant to apoptotic stimuli, and this may contribute to the high frequency of RASSF1A inactivation detected in human tumors.


   FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Supported in part by the Association for International Cancer Research. Back

2 To whom correspondence should be addressed: Dept. of Cell and Cancer Biology, NCI, 9610 Medical Center Dr., Rockville, MD 20850-3300. Tel.: 301-594-7288; Fax: 301-402-4422; E-mail: gclark{at}mail.nih.gov.

3 The abbreviations used are: CRD, cysteine-rich domain; shRNA, short hairpin RNA; qRT, quantitative reverse transcription; GFP, green fluorescent protein. Back


   ACKNOWLEDGMENTS
 
We thank Holly Symonds for critical comments.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Dammann, R., Li, C., Yoon, J. H., Chin, P. L., Bates, S., and Pfeifer, G. P. (2000) Nat. Genet. 25, 315–319[CrossRef][Medline] [Order article via Infotrieve]
  2. Agathanggelou, A., Honorio, S., Macartney, D. P., Martinez, A., Dallol, A., Rader, J., Fullwood, P., Chauhan, A., Walker, R., Shaw, J. A., Hosoe, S., Lerman, M.I., Minna, J.D., Maher, E. R., and Latif, F. (2001) Oncogene 20, 1509–1518[CrossRef][Medline] [Order article via Infotrieve]
  3. Harada, K., Toyooka, S., Maitra, A., Maruyama, R., Toyooka, K. O., Timmons, C. F., Tomlinson, G.E., Mastrangelo, D., Hay, R. J., Minna, J. D., and Gazdar, A. F. (2002) Oncogene 21, 4345–4349[CrossRef][Medline] [Order article via Infotrieve]
  4. Dammann, R., Yang, G., and Pfeifer, G. P. (2001) Cancer Res. 61, 3105–3109[Abstract/Free Full Text]
  5. Burbee, D. G., Forgacs, E., Zochbauer-Muller, S., Shivakumar, L., Fong, K., Gao, B., Randle, D., Kondo, M., Virmani, A., Bader, S., Sekido, Y., Latif, F., Milchgrub, S., Toyooka, S., Gazdar, A. F., Lerman, M. I., Zabarovsky, E., White, M., and Minna, J. D. (2001) J. Natl. Cancer Inst. 93, 691–699[Abstract/Free Full Text]
  6. Kuzmin, I., Gillespie, J. W., Protopopov, A., Geil, L., Dreijerink, K., Yang, Y., Vocke, C. D., Duh, F. M., Zabarovsky, E., Minna, J. D., Rhim, J. S., Emmert-Buck, M. R., Linehan, W. M., and Lerman, M. I. (2002) Cancer Res. 62, 3498–3502[Abstract/Free Full Text]
  7. Tommasi, S., Dammann, R., Zhang, Z., Wang, Y., Liu, L., Tsark, W. M., Wilczynski, S. P., Li, J., You, M., and Pfeifer, G. P. (2005) Cancer Res. 65, 92–98[Abstract/Free Full Text]
  8. Agathanggelou, A., Cooper, W.N., and Latit, F. (2005) Cancer Res. 65, 3497–3508[Abstract/Free Full Text]
  9. Vos, M. D., Ellis, C. A., Elam, C., Ulku, A. S., Taylor, B. J., and Clark, G. J. (2003) J. Biol. Chem. 278, 28045–28051[Abstract/Free Full Text]
  10. Vos, M. D., and Clark, G. J. (2003) J. Biol. Chem. 278, 21938–21943[Abstract/Free Full Text]
  11. Chen, J., Lui, W. O., Vos, M. D., Clark, G. J., Takahashi, M., Schoumans, J., Khoo, S. K., Petillo, D., Lavery, T., Sugimura, J., Astuti, D., Zhang, C., Kagawa, S., Maher, E. R., Larsson, C., Alberts, A. S., Kanayama, H. O., and Teh, B. T. (2003) Cancer Cell 4, 405–413[CrossRef][Medline] [Order article via Infotrieve]
  12. Eckfeld, K., Hesson, L., Vos, M. D., Bieche, I., Latif, F., and Clark, G. J. (2004) Cancer Res. 64, 8688–8693[Abstract/Free Full Text]
  13. Ponting, C. P., and Benjamin, D. R. (1996) Trends Biochem. Sci. 21, 422–425[CrossRef][Medline] [Order article via Infotrieve]
  14. Brtva, T. R., Drugan, J. K., Ghosh, S., Terrell, R. S., Campbell-Burk, S., Bell, R. M., and Der, C. J. (1995) J. Biol. Chem. 270, 9809–9812[Abstract/Free Full Text]
  15. Luo, Z., Diaz, B., Marshall, M. S., and Avruch, J. (1997) Mol. Cell. Biol. 17, 46–53[Abstract]
  16. Vavvas, D., Li, X., Avruch, J., and Zhang, X. F. (1998) J. Biol. Chem. 273, 5439–5442[Abstract/Free Full Text]
  17. Rodriguez-Viciana, P., Sabatier, C., and McCormick, F. (2004) Mol. Cell. Biol. 24, 4943–4954[Abstract/Free Full Text]
  18. Vos, M. D., Ellis, C. A., Bell, A., Birrer, M. J., and Clark, G. J. (2000) J. Biol. Chem. 275, 35669–35672[Abstract/Free Full Text]
  19. Shivakumar, L., Minna, J., Sakamaki, T., Pestell, R., and White, M. A. (2002) Mol. Cell. Biol. 22, 4309–4318[Abstract/Free Full Text]
  20. Kiel, C., Wohlgemuth, S., Rousseau, F., Schymkowitz, J., Ferkinghoff-Borg, J., Wittinghofer, F., and Serrano, L. J. (2005) Mol. Biol. 348, 759–775[CrossRef][Medline] [Order article via Infotrieve]
  21. Song, M. S., Song, S. J., Ayad, N. G., Chang, J. S., Lee, J. H., Hong, H. K., Lee, H., Choi, N., Kim, J., Kim, H., Kim, J. W., Choi, E. J., Kirschner, M. W., and Lim, D. S. (2004) Nat. Cell Biol. 6, 129–137[CrossRef][Medline] [Order article via Infotrieve]
  22. Vos, M. D., Martinez, A., Elam, C., Dallol, A., Taylor, B. J., Latif, F., and Clark, G. J. (2004) Cancer Res. 64, 4244–4250[Abstract/Free Full Text]
  23. Rong, R., Jin, W., Zhang, J., Saeed, S. M., and Huang, Y. (2004) Oncogene 23, 8216–8230[CrossRef][Medline] [Order article via Infotrieve]
  24. Rabizadeh, S., Xavier, R. J., Ishiguro, K., Bernabeortiz, J., Lopez-Ilasaca, M., Khokhlatchev, A., Mollahan, P., Pfeifer, G. P., Avruch, J., and Seed, B. (2004) J. Biol. Chem. 279, 29247–29254[Abstract/Free Full Text]
  25. Khokhlatchev, A., Rabizadeh, S., Xavier, R., Nedwidek, M., Chen, T., Zhang, X. F., Seed, B., and Avruch, J. (2002) Curr. Biol. 12, 253–265[CrossRef][Medline] [Order article via Infotrieve]
  26. Fenton, S. L., Dallol, A., Agathanggelou, A., Hesson, L., Ahmed-Choudhury, J., Baksh, S., Sardet, C., Dammann, R., Minna, J. D., Downward, J., Maher, E. R., and Latif, F. (2004) Cancer Res. 64, 102–107[Abstract/Free Full Text]
  27. Liu, L., Tommasi, S., Lee, D. H., Dammann, R., and Pfeifer, G. P. (2003) Oncogene 22, 8125–8136[CrossRef][Medline] [Order article via Infotrieve]
  28. Dallol, A., Agathanggelou, A., Fenton, S. L., Ahmed-Choudhury, J., Hesson, L., Vos, M. D., Clark, G. J., Downward, J., Maher, E. R., and Latif, F. (2004) Cancer Res. 64, 4112–4116[Abstract/Free Full Text]
  29. Tan, K. O., Tan, K. M., Chan, S. L., Yee, K. S., Bevort, M., Ang, K. C., and Yu, V. C. (2001) J. Biol. Chem. 276, 2802–2807[Abstract/Free Full Text]
  30. Sharpe, J. C., Arnoult, D., and Youle, R. J. (2004) Biochim. Biophys. Acta. 1644, 107–113[Medline] [Order article via Infotrieve]
  31. Clark, G. J., Drugan, J. K., Rossman, K. L., Carpenter, J. W., Rogers-Graham, K., Fu, H., Der, C. J., and Campbell, S. L. (1997) J. Biol. Chem. 272, 20990–20993[Abstract/Free Full Text]
  32. McPherson, R. A., Harding, A., Roy, S., Lane, A., and Hancock, J. F. (1999) Oncogene 18, 3862–3869[CrossRef][Medline] [Order article via Infotrieve]
  33. Wolter, K. G., Hsu, Y. T., Smith, C. L., Nechushtan, A., Xi, X. G., and Youle, R. J. (1997) J. Cell Biol. 139, 1281–1292[Abstract/Free Full Text]
  34. Kveiborg, M., Fröhlich, C., Albrechtsen, R., Tischler, V., Dietrich, N., Holck, P., Kronqvist, P., Rank, F., Mercurio, A. M., and Wewer, U. M. (2005) Cancer Res. 65, 4754–4761[Abstract/Free Full Text]
  35. Choi, J. A., Park, M. T., Kang, C. M., Um, H. D., Bae, S., Lee, K. H., Kim, T. H., Kim, J. H., Cho, C. K., Lee, Y. S., Chung, H. Y., and Lee, S. J. (2004) Oncogene 23, 9–20[CrossRef][Medline] [Order article via Infotrieve]
  36. Praskova, M., Khoklatchev, A., Ortiz-Vega, S., and Avruch, J. (2004) Biochem. J. 381, 453–482[CrossRef][Medline] [Order article via Infotrieve]
  37. Chan, E. H., Nousiainen, M., Chalamalasetty, R. B., Schafer, A., Nigg, E. A., and Sillje, H. H. (2005) Oncogene 24, 2076–2086[CrossRef][Medline] [Order article via Infotrieve]
  38. Xia, H., Qi, H., Li, Y., Pei, J., Barton, J., Blackstad, M., Xu, T., and Tao, W. (2002) Oncogene 21, 1233–1241[CrossRef][Medline] [Order article via Infotrieve]
  39. Ke, H., Pei, J., Ni, Z., Xia, H., Qi, H., Woods, T., Kelekar, A., and Tao, W. (2004) Exp. Cell Res. 298, 329–338[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
C. J. Foley, H. Freedman, S. L. Choo, C. Onyskiw, N. Y. Fu, V. C. Yu, J. Tuszynski, J. C. Pratt, and S. Baksh
Dynamics of RASSF1A/MOAP-1 Association with Death Receptors
Mol. Cell. Biol., July 15, 2008; 28(14): 4520 - 4535.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. Milstein, C. K. Mooser, H. Hu, M. Fejzo, D. Slamon, L. Goodglick, S. Dry, and J. Colicelli
RIN1 Is a Breast Tumor Suppressor Gene
Cancer Res., December 15, 2007; 67(24): 11510 - 11516.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
H. Donninger, M. D. Vos, and G. J. Clark
The RASSF1A tumor suppressor
J. Cell Sci., September 15, 2007; 120(18): 3163 - 3172.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
N. Y. Fu, S. K. Sukumaran, and V. C. Yu
Inhibition of ubiquitin-mediated degradation of MOAP-1 by apoptotic stimuli promotes Bax function in mitochondria
PNAS, June 12, 2007; 104(24): 10051 - 10056.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
A. Dallol, W. N. Cooper, F. Al-Mulla, A. Agathanggelou, E. R. Maher, and F. Latif
Depletion of the Ras Association Domain Family 1, Isoform A-Associated Novel Microtubule-Associated Protein, C19ORF5/MAP1S, Causes Mitotic Abnormalities
Cancer Res., January 15, 2007; 67(2): 492 - 500.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/8/4557    most recent
M512128200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vos, M. D.
Right arrow Articles by Clark, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vos, M. D.
Right arrow Articles by Clark, G. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.