|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 281, Issue 8, 4557-4563, February 24, 2006
The RASSF1A Tumor Suppressor Activates Bax via MOAP-1*![]() ![]() ![]() ![]() ![]() ![]() 1 2
From the
Received for publication, November 10, 2005
The novel tumor suppressor RASSF1A is frequently inactivated during human tumorigenesis by promoter methylation. RASSF1A may serve as a node in the integration of signaling pathways controlling a range of critical cellular functions including cell cycle, genomic instability, and apoptosis. The mechanism of action of RASSF1A remains under investigation. We now identify a novel pathway connecting RASSF1A to Bax via the Bax binding protein MOAP-1. RASSF1A and MOAP-1 interact directly, and this interaction is enhanced by the presence of activated K-Ras. RASSF1A can activate Bax via MOAP-1. Moreover, activated K-Ras, RASSF1A, and MOAP-1 synergize to induce Bax activation and cell death. Analysis of a tumor-derived point mutant of RASSF1A showed that the mutant was defective for the MOAP-1 interaction and for Bax activation. Moreover, inhibition of RASSF1A by shRNA impaired the ability of K-Ras to activate Bax. Thus, we identify a novel pro-apoptotic pathway linking K-Ras, RASSF1A and Bax that is specifically impaired in some human tumors.
The RASSF1 gene is localized at the 3p21.3 site of frequent loss of heterozygosity in lung tumors (1). It produces multiple protein isoforms, the most commonly detected being RASSF1A and RASSF1C. Loss of expression of the RASSF1A isoform is a frequent event in primary human tumors (25), and re-expression of RASSF1A in human tumor cell lines inhibits their tumorigenic phenotype (1, 6). Moreover, knock-out mice defective for RASSF1A are prone to tumor development (7). These observations have led to the conclusion that RASSF1A is a tumor suppressor that plays a key role in the development of human cancer. Down-regulation of RASSF1A expression in human tumors typically occurs via promoter methylation (25). The frequency of RASSF1A silencing in human tumors is high, ranging from 4050% in breast, prostate, and ovarian tumors, to 3080% in lung tumors and more than 90% in renal cell carcinomas (8). Thus, RASSF1A may be among the most important tumor suppressors yet identified. RASSF1 is the founding member of a family of six genes. Several other members of the family also exhibit biological properties compatible with a tumor suppressor function (912). The most interesting structural features of the RASSF proteins are the presence of a Ras association (RA) domain and, in the cases of RASSF1A and Nore1 (RASSF5), a cysteine-rich domain (CRD).3 Both of these domains have the theoretical potential to directly bind the activated Ras oncoprotein (1315). Nore1 (RASSF5) can be detected in an endogenous complex with Ras (16). RASSF1A can be co-precipitated with activated H-Ras in overexpression systems (17). Moreover, the RASSF1A RA domain can directly bind activated H-Ras in vitro (18). Although some authors have found the direct binding of RASSF1A to H-Ras to be relatively weak (17, 19), others have found that the predicted binding energy of Ras and the RA domain of RASSF1 is compatible with a physiological role for the interaction (20). Thus, Ras has the potential to modulate RASSF family activity.
RASSF proteins can induce cell cycle arrest and participate in apoptotic programs (8, 1925), but the mechanism of action of RASSF1A (and other RASSF1 splice variants) remains under intense investigation. It is now apparent that RASSF1A has the potential to serve as a link between a diverse series of critical cellular processes. RASSF1A binds the p120 E4F transcription factor that forms a complex with both the Rb and p53 tumor suppressors (26). Thus, RASSF1A has the potential to influence the function of two of the most potent tumor suppressors in the cell. RASSF1A can interact with the scaffold molecule CNK, potentially linking RASSF1A to Ral, Rho, and Raf regulation (24). RASSF1A binds to and modulates the activity of the cdc20·APC complex, thus regulating cell cycle progression and influencing genomic stability (21). RASSF1A also binds to the pro-apoptotic kinases MST1 and MST2 (25). Furthermore, RASSF1A associates with tubulin and can modulate its polymerization (22, 27, 28). Thus, RASSF1A may influence the cell cycle, motility, and genomic stability via the control of microtubules. Although the physiological significance of some of these interactions remains to be confirmed, clearly RASSF1A has the potential to modulate and integrate a series of disparate, critical cellular processes involved in tumor suppression. We have now identified a further key cellular process that may be modified by RASSF1A: the regulation of Bcl-2 family proteins. We found that RASSF1A directly binds the protein Modulator of Apoptosis-1 (MOAP-1) (29) in a two-hybrid screen. MOAP-1 binds Bcl-2 family proteins, including the pro-apoptotic member Bax (29, 30). We have determined that RASSF1A and MOAP-1 can interact in mammalian cells and that the interaction is enhanced in the presence of activated K-Ras. Further analysis demonstrated that wild type RASSF1A but not a tumor derived point mutant can activate Bax via MOAP-1. K-Ras not only enhanced the interaction of RASSF1A and MOAP-1 but also stimulated the ability of RASSF1A to activate Bax and induce cell death. Finally, using an shRNA construct against RASSF1A, we found that the ability of K-Ras 12v to activate Bax is dependent upon RASSF1A. Thus, we identify a novel pro-apoptotic pathway connecting RASSF1A to Bax.
Yeast Two-hybrid ScreenYeast two-hybrid screening was performed as described previously (26). Briefly, the bait vector pGBKT7-RASSF1A was transformed in yeast strain Saccharomyces cerevisiae AH109 (RASSF1A-BD) using the LiAc/polyethylene glycol method and selected on Trpplates. Strain AH109 includes four reporter genes ADE2, HIS3, lacZ, and MEL1 whose expression is regulated by GAL4 responsive upstream activating sequences and promoter elements. The bait RASSF1A-BD was then used to screen a pretransformed MATCHMAKER brain library (Clontech, Palo Alto, CA), cloned in pACT2, by mating with the yeast strain
S. cerevisiae Y187A total of 6 x 106 clones were screened, of which 103 were positive for Plasmids and DNAThe coding region of MOAP-1 was cloned by PCR using expressed sequence tag BC015044 [GenBank] IMAGE clone 3922055 with primers incorporating EcoRI and XhoI restriction sites. The PCR products were fully sequenced and cloned into pCMV-MyC (Clontech) or pEGFP-C2 (using EcoRI/BamHI). Bax plasmids were a generous gift (R. J. Youle, NCI, National Institutes of Health), Ras, and RASSF1A reagents have been described previously (18). The BH3 domain of MOAP-1 was cloned in pCDNAF (18) by PCR with primers incorporating BamHI and EcoRI restriction sites at the 5' and 3' ends, respectively. An RA domain mutant of RASSF1A was made using a QuikChange kit (Stratagene, La Jolla, CA) to convert residues 299231 from LRK to QQE. Cell Culture and Assays293-T cells were grown in Dulbecco's modified Eagle's medium, 10% fetal calf serum; H1792 and H1299 human tumor cell lines were grown in RPMI, 10% fetal calf serum at 37 °C in 10% C02. 293-T cell death assays were performed by transfecting cells with 5 µg of each plasmid using Lipofectamine 2000 (Invitrogen). After 72 h, cells were stained with 0.04% trypan blue and dead cells (stained blue) counted, as described previously (10). Bax activation assays (mitochondrial relocalization) were performed by transiently transfecting human lung tumor cell lines with either 1 µg of vector or RASSF1A and 100 ng of GFP-Bax. Cells were examined after 2448 h and scored positive or negative for Bax clustering. Cytofluorescence studies were performed in cells grown on glass bottom microwell dishes (MatTek Corp., Ashland, MA). Live cell images were taken with an Olympus 1X50-FLA inverted fluorescent microscope (Optical Elements Corp., Dulles, VA) with an attached Spot Junior digital camera. Stable lines of H1299 cells expressing endogenous equivalent levels of RASSF1A wild type or mutant were generated by transfecting the cells with pZIP-NeoHA (18) and selecting clones in 0.5 mg/ml G418.
shRNA StudiesAn shRNA expression cassette containing the hairpin sequence, ATGAAGCCGCCACAGAGGCCACACCACATCCAAACGTGGTGCGACCTCTGTGGCGACTTCAT, was cloned in the pSHAG-MAGIC1 (pSM2) vector. H1792 cells were transfected with 15 µg of shRNA vector and selected in puromycin. Selected cells were examined for loss of RASSF1A expression by Western analysis using a RASSF1A polyclonal antibody (22) and by qRT-PCR. qRT-PCR was performed on an iCycler real-time detection system (Bio-Rad) using the Quantitect SYBR Green RT-PCR Kit (Qiagen, Inc., Valencia, CA) as per the manufacturer's instructions. The fold change for the RASSF1A gene was calculated using the 2 Protein Binding AssaysProtein interactions were examined by transfecting 293-T cells using Lipofectamine 2000 (Invitrogen) with 5 µg of each different epitope tag containing plasmid DNA. After 48 h cells were lysed in RIPA buffer (50 mM Tris, pH 7.5, 1% Nonidet P-40, 150 mM NaCl) and immunoprecipitated for 4 h. The immunoprecipitate was washed three times and subjected to Western analysis. Endogenous associations were detected in primary liver samples (Liver Tissue Procurement and Distribution System; Minneapolis, MN; Richmond, VA; and Pittsburgh, PA). Tissue was homogenized in 30 mM Tris, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0,1% SDS. 0.5% sodium deoxycholate, 10% glycerol, and 2 mM EDTA with protease inhibitors. 600 µg of clarified homogenate was immunoprecipitated using the catch and release reversible immunoprecipitation system (Upstate, Charlottesville, VA) according to the manufacturer's protocol and either a mouse monoclonal anti-RASSF antibody (eBioscience, San Diego, CA) or a rabbit anti-MAP-1 antobody (Novus Biologicals, Littleton, CO).
RASSF family proteins can promote G1 and G2/M cell cycle arrest (19, 21, 23). The G2/M arrest may be due to the interaction of RASSF1A with cdc20 (21) and tubulin (22, 23, 27), whereas the G1 arrest could be due to the interaction of RASSF1A with p120 E4F (26). RASSF family proteins can also participate in apoptotic programs (810, 12, 24, 25) and form endogenous complexes with the pro-apoptotic kinases MST1 and MST2 (25). We have now identified a further component of the apoptotic machinery that can be modulated by RASSF1A: MOAP-1. RASSF1A Directly Binds MOAP-1The pro-apoptotic protein MOAP-1 (Modulator of Apoptosis-1) was determined to be a RASSF1A interaction partner in a yeast two-hybrid screen. The yeast two-hybrid analysis was performed using a full-length RASSF1A clone (26). Upon sequencing, one of the positive interacting clones was found to be amino acids 61351 of MOAP-1 (NP_071434 [GenBank] ). The interaction between RASSF1A and MOAP-1 was confirmed in yeast by co-transformation assays with pGBKT7 + pACT2 MOAP-1 and pGBKT7 RASSF1A + pACT2-MOAP-1. These experiments confirmed MOAP-1 interacts specifically with RASSF1A and not with the GAL4 DNA binding domain encoded within the pGBKT7 vector (data not shown). RASSF1A and MOAP-1 Interact in CellsTo determine whether RASSF1A and MOAP-1 have the ability to interact in mammalian cells, we co-transfected RFP-RASSF1A and GFP-MOAP-1 into 293-T cells and examined expressing cells by fluorescence microscopy. RASSF1A has been shown repeatedly to localize to to microtubules (22, 27). Fig. 1a shows that in the absence of RASSF1A, MOAP-1 localizes generally to the cytoplasm. However, in the presence of RASSF1A, MOAP-1 is recruited to microtubule structures with RASSF1A. As further confirmation of the microtubular location of the complex, transfected cells were treated with Taxol. In these cells, the RASSF1A·MOAP-1 complex localized to the Taxol-induced cytoplasmic asters. To confirm that the interaction was of a physiological nature, we immunoprecipitated liver lysates with a mouse monoclonal RASSF1A antibody and detected the presence of endogenous MOAP-1 (Fig. 1b) in the immunoprecipitate with an anti-MOAP-1 antibody. Interestingly, the co-immunoprecipitation of RASSF1A and MOAP-1 was only readily detectable in the samples derived form the stromal tissue surrounding the tumors. Oncogenic K-Ras Promotes the Stabilization of RASSF1A·MOAP-1 Complexes-Further examination (Fig. 1c) showed that MYC-tagged MOAP-1 could be co-precipitated with hemagglutinin-tagged RASSF1A when both proteins were expressed in 293-T cells. It was noticeable that the interaction appeared to be much weaker than was suggested by the results of the fluorescent microscopy. However, upon the addition of activated K-Ras to the transfection (Fig. 1c), the level of MOAP-1 co-precipitation with RASSF1A increased substantially. This result suggests that K-Ras may serve to enhance or stabilize the interaction of RASSF1A and MOAP-1. This provides a potential mechanistic explanation for the pro-apoptotic properties of K-Ras and why K-Ras activates the pro-apoptotic ability of RASSF1A.
The C65R Point Mutant of RASSF1A Is Defective for the Interaction with MOAP-1Although RASSF1A is most frequently down-regulated by promoter methylation during human tumor development, several point mutations in RASSF1A have also been found in primary tumors that appear to impair some of its growth inhibitory properties (8). One of these mutations inactivates a serine phosphorylation site within RASSF1A (19). However, another mutation has been detected in the CRD of RASSF1A that also appears to impair RASSF1A function, C65R (28). The Ras effector Raf also contains a CRD, and this domain plays an important role in the function of Raf (14, 15, 31, 32). Consequently, we examined the effects of this mutation on the interaction of RASSF1A with MOAP-1. Using co-immunoprecipitation studies, we found that the C65R mutant of RASSF1A is defective for MOAP-1 binding and does not exhibit enhanced MOAP-1 binding in the presence of activated K-Ras (Fig. 1c). This mutation is specific in its effects as the C65R form of RASSF1A retains the ability to associate with tubulin (Fig. 1c, ii). Thus, the RASSF1A/MOAP-1 pathway is precisely inactivated by a point mutation in some primary human tumors. This argues that it is an important physiological component of the tumor suppressor function of RASSF1A. The mechanism of by which K-Ras stimulates the interaction with MOAP-1 appears to involve the direct interaction of K-Ras with the RA domain of RASSF1A as a mutant form of RASSF1A with a triple point mutation in the RA domain (RASSF1A.RA*) is impaired for the ability to co-immunoprecipitated with K-Ras and is impaired for Ras enhanced binding to MOAP-1 (Fig. 1d, iii). Moreover an effector domain mutant of K-Ras (K-ras12v-40C) that is impaired for RASSF1A binding is also impaired for the ability to stimulate RASSF1A/MOAP-1 association (Fig. 1d, iiiiv). RASSF1A, MOAP-1, and K-Ras12v Synergize to Promote Cell Death As we found that activated K-Ras promoted the formation of a complex between RASSF1A and MOAP-1, we examined the biological effects of co-transfection of K-Ras 12v, RASSF1A, and MOAP-1. Cell death assays were performed by transient transfection of 293-T cells followed by trypan blue staining after 48 h. Dead cells were detected by positive staining for trypan blue. Co-transfection of all three genes together induced synergistic cell death (Fig. 2a). The C65R mutant of RASSF1A was found to be severely impaired in its ability to induce cell death in these assays. Further assays demonstrated that a mutant form of RASSF1A that was defective for binding K-Ras was impaired for the ability to synergize with K-Ras and MOAP-1 (Fig. 2b). The 40C effector mutant of K-Ras, which is impaired for RASSF1A binding, was also impaired for the ability to promote synergistic cell death (Fig. 2b). These data suggest that that K-Ras may act directly on RASSF1A to stimulate MOAP-1 function. RASSF1A Activates Bax via MOAP-1MOAP-1 was originally cloned as a pro-apoptotic Bax interacting protein (29). Bax is a proapoptotic member of the Bcl-2 family (30). Bax operates by inducing mitochondrial membrane permeabilization and, upon activation, Bax relocalizes from the cytosol to coalesce into punctate, mitochondrial associated clusters (33). Consequently, it is possible to use Bax clustering as an assay for Bax activation in live cells. Although the pro-apoptotic activities of MOAP-1 were shown to be dependent upon Bax binding, the effects of MOAP-1 on Bax activation were not determined (29). To determine whether RASSF1A could activate Bax, and if this was due to MOAP-1, we first co-transfected GFP-Bax and RFP-RASSF1A into H1299 human lung tumor cells. We then examined the effects of RASSF1A on Bax activation in live cells by fluorescent microscopy. Fig. 3a shows that RASSF1A induces the relocalization and clustering of Bax. The assays are quantified in the Fig. 3b. Treatment with the apoptosis-inducing agent staurosporine served as a positive control. Thus, RASSF1A can activate Bax.
MOAP-1 binds Bax via its BH3 domain (29); thus, the isolated BH3 domain of MOAP-1 may serve as a competitive inhibitor for the interaction between full-length MOAP-1 and Bax. Co-transfection of the BH3 domain of MOAP-1 blocked the ability of RASSF1A to activate Bax (Fig. 3c), suggesting that RASSF1A activates Bax via MOAP-1. As the C65R mutant of RASSF1A is impaired for MOAP-1 binding (Fig. 1c), we performed similar Bax activation assays with this mutant to determine whether the mutation correlated with a loss of the ability to activate Bax. We found that RASSF1A C65R is defective for Bax activation in H1299 lung tumor cells (Fig. 3c). Thus, tumor cells that retain expression of this mutant allele are likely to be impaired for Bax activation. RASSF1A Links K-Ras to BaxAs the interaction between MOAP-1 and RASSF1A is enhanced by oncogenic K-Ras, we sought to determine whether oncogenic K-Ras activates Bax via RASSF1A/MOAP-1 and if the C65R mutant of RASSF1A was defective for this action. We used expression vectors to generate H1299 cell lines (negative for endogenous RASSF1A expression) that stably re-express exogenous wild type or mutant RASSF1A protein at a level that is comparable with the endogenous protein levels found in the RASSF1A-positive cell H1792 (Fig. 4a). We then transfected the H1299 cells +/ for RASSF1A wild type or C65R with GFP Bax and examined the cells for Bax activation. H1299 cells with restored wild type RASSF1A protein expression demonstrated enhanced activation of Bax. The C65R mutant of RASSF1A demonstrated only a relatively weak increase in Bax activation (Fig. 4b). We then transfected activated K-Ras into the H1299 cells +/ for RASSF1A expression. A strong activation of Bax by K-Ras12v was only detected in the cells expressing RASSF1A (Fig. 4c).
K-Ras Requires RASSF1A to Activate BaxTo confirm that K-Ras promoted Bax activation via RASSF1A, we selected a RASSF1A-positive cell line (H1792) and transfected it with an shRNA construct designed against RASSF1A. RT-PCR and Western analysis confirmed that RASSF1A expression was suppressed by the shRNA construct (Fig. 5a). The shRNA construct was specific for RASSF1A as it failed to down-regulate the closely related RASSF5 protein (Fig. 5b). We then performed co-transfection experiments with RFP-K-Ras 12v and GFP-Bax to measure the degree of Bax activation in the cells. Fig. 5c shows that the cells where the expression of endogenous RASSF1A is inhibited by the shRNA construct are defective for K-Ras12v mediated Bax activation.
Thus, when we restore RASSF1A expression to H1299 cells we enhance the ability of K-Ras to activate Bax and when we remove RASSF1A from H1792 cells we impair the ability of K-Ras to activate Bax.
Recent knock-out mouse studies have now confirmed the hypothesis that RASSF1A is a tumor suppressor (7). The high frequency of RASSF1A down-regulation in human tumors suggests that it will prove to be one of the more important components in the development of human cancer (8). The regulation and mechanism of action of RASSF1A remains a topic of intense investigation. It appears that like other critical tumor suppressors, RASSF1A is multifunctional. Thus, inactivation of RASSF1A may impact many different facets of tumor biology (8). Intriguingly for a tumor suppressor, RASSF1A contains a Ras association domain and can form a complex with activated Ras when overexpressed (17). This suggests that it may be an effector for Ras or Ras-related proteins. Although intuitively one might expect an oncoprotein such as Ras to inhibit the function of RASSF1A, in fact, it appears to activate it. We have hypothesized that RASSF family proteins may serve as effectors that mediate some of the growth inhibitory aspects of Ras, including Ras-induced apoptosis (18). Thus, subversion of RASSF family protein function may be important to the development of Ras-dependent tumors. Indeed, there is evidence that loss of function of RASSF1A may correlate with the presence of activated Ras in some tumor systems (8).
Although the growth inhibitory effects of RASSF1A have been ascribed to the induction of cell cycle arrest (19, 21), we have detected pro-apoptotic properties for RASSF family proteins. Consequently, we were intrigued to identify the protein MOAP-1 as a potential binding partner for RASSF1A. MOAP-1 was originally described as a pro-apoptotic protein that binds multiple members of the Bcl-2 family of proteins, including Bax (29). Bax is a key component of the pro-apoptotic machinery that upon activation plays an important role in permeabilizing mitochondrial membranes during apoptosis (30). Thus, the interaction between RASSF1A and MOAP-1 serves to connect RASSF1A with some of the most potent apoptotic machinery in the cell. RASSF1A is typically inactivated by promoter methylation. However, several point mutations have been identified in RASSF1A in human tumors that impair its biological activity. These mutants may provide vital tools to define which RASSF1A properties are particularly important to the development of disease (8). We were particularly interested by the C65R mutation of RASSF1A that falls within the CRD. Our modeling predictions suggested that this mutation severely disrupts the secondary structure of the CRD. In the Ras effector Raf, the CRD is the site of binding of multiple regulator molecules, including Ras, 14-3-3, and phosphatidylserine (14, 15, 31, 32). Thus, it seemed likely that the CRD of RASSF1A would play an important role in the function of the protein. Our determination that the tumor-derived C65R mutant of RASSF1A is defective for MOAP-1 association and Bax activation suggests the interaction of RASSF1A with MOAP-1 is a significant component of its tumor suppressor function. Although we can detect interactions between RASSF1A and MOAP-1 in the absence of K-Ras12v in 293-T cells, the association is enhanced in the presence of activated K-Ras. Our analysis of primary liver samples demonstrated that the interaction between RASSF1 AND MOAP-1 is difficult to detect in normal tissue and tumor tissue. Presumably normal tissue has low levels of activated Ras, and the tumors may have acquired defects in the system functionally comparable with the C65R mutant. However, we could detect the interaction in the stroma surrounding the tumors. This suggests that the stromal cells are being stimulated toward apoptosis by the tumor and that this pathway involves RASSF1A. It has previously been suggested that enhanced stromal cell apoptosis can contribute to tumor development (34). K-Ras has previously been linked to Bax activation (35). Here we identify a mechanism for this effect by showing that the activation of Bax by K-Ras is at least partially dependent upon the presence of RASSF1A. Thus, cells with defective RASSF1A are less susceptible to apoptosis induced by activated K-Ras and hence are likely to be more sensitive to K-Ras-mediated transformation. As MOAP-1 interacts with multiple members of the Bcl-2 family, including Bax, this gives K-Ras the potential to modulate other members of the family too. RASSF family proteins have previously been implicated in mediating the apoptotic effects of activated Ras via the Ste-20 like kinases MST1 and MST2 (18, 25, 36). The identification of a direct association between RASSF1A and MOAP-1, leading to Bax activation, demonstrates a second pro-apoptotic RASSF signaling pathway. This pathway is likely to be shared by at least some other family members as we can also detect binding between RASSF6 and MOAP-1 (data not shown). The MST and MOAP-1 pathways may be functionally connected. MST kinases phosphorylate and activate the kinases LATs1 and LATs2 (37). These kinases have been shown to promote apoptosis and Lats2 can down-regulate the Bax-inhibiting protein Bcl-2 (38, 39). Therefore, RASSF1A may induce apoptosis by activating Bax via MOAP-1 and at the same time down-regulate Bcl-2 via the MST/LATs pathway. Thus, RASSF1A may be able to modulate synergistic apoptotic pathways. Cells defective for RASSF1A are likely to be resistant to apoptotic stimuli, and this may contribute to the high frequency of RASSF1A inactivation detected in human tumors.
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported in part by the Association for International Cancer Research. 2 To whom correspondence should be addressed: Dept. of Cell and Cancer Biology, NCI, 9610 Medical Center Dr., Rockville, MD 20850-3300. Tel.: 301-594-7288; Fax: 301-402-4422; E-mail: gclark{at}mail.nih.gov.
3 The abbreviations used are: CRD, cysteine-rich domain; shRNA, short hairpin RNA; qRT, quantitative reverse transcription; GFP, green fluorescent protein.
We thank Holly Symonds for critical comments.
This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||