Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M505688200 on December 27, 2005

J. Biol. Chem., Vol. 281, Issue 9, 5750-5759, March 3, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
281/9/5750    most recent
M505688200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Clohessy, J. G.
Right arrow Articles by Brady, H. J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Clohessy, J. G.
Right arrow Articles by Brady, H. J. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Mcl-1 Interacts with Truncated Bid and Inhibits Its Induction of Cytochrome c Release and Its Role in Receptor-mediated Apoptosis*Formula

John G. Clohessy{ddagger}12, Jianguo Zhuang{ddagger}23, Jasper de Boer{ddagger}, Gabriel Gil-Gómez§, and Hugh J. M. Brady{ddagger}4

From the {ddagger}Molecular Haematology and Cancer Biology Unit, Institute of Child Health and Great Ormond Street Hospital for Children, University College London, London WC1N 1EH, United Kingdom and §Unitat de Biologia Cellular i Molecular, Institut Municipal d'Investigació Mèdica-Universitat Pompeu Fabra (IMIM-UPF), E-03003 Barcelona, Spain

Received for publication, May 24, 2005 , and in revised form, November 11, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Engagement of death receptors such as tumor necrosis factor-R1 and Fas brings about the cleavage of cytosolic Bid to truncated Bid (tBid), which translocates to mitochondria to activate Bax/Bak, resulting in the release of cytochrome c. The mechanism underlying the activation, however, is not fully understood. Here, we have identified the anti-apoptotic Bcl-2 family member Mcl-1 as a potent tBid-binding partner. Site-directed mutagenesis reveals that the Bcl-2 homology (BH)3 domain of tBid is essential for binding to Mcl-1, whereas all three BH domains (BH1, BH2, and BH3) of Mcl-1 are required for interaction with tBid. In vitro studies using isolated mitochondria and recombinant proteins demonstrate that Mcl-1 strongly inhibits tBid-induced cytochrome c release. In addition to its ability to interact directly with Bax and Bak, tBid also binds Mcl-1 and displaces Bak from the Mcl-1-Bak complex. Importantly, overexpression of Mcl-1 confers resistance to the induction of apoptosis by both TRAIL and tumor necrosis factor-{alpha} in HeLa cells, whereas targeting Mcl-1 by RNA interference sensitizes HeLa cells to TRAIL-induced apoptosis. Therefore, our study demonstrates a novel regulation of tBid by Mcl-1 through protein-protein interaction in apoptotic signaling from death receptors to mitochondria.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The commitment of cells to apoptosis in response to diverse physiological cues and cytotoxic agents is primarily regulated by proteins of the Bcl-2 family that are evolutionarily conserved from nematodes to humans (1, 2). Bcl-2 family proteins share one or more Bcl-2 homology (BH)5 domains and are divided into two main groups based on their pro- or anti-apoptotic activities. The anti-apoptotic members include Bcl-2, Bcl-xL, A1, Bcl-w, and Mcl-1. The pro-apoptotic family members are further divided according to whether they contain multiple BH domains (such as Bax and Bak) or only the BH3 domain (such as Bid and Bim). The BH3 domain-only proteins require cooperation of other multidomain family members to induce apoptosis (3-7).

In mammals two distinct apoptotic signaling pathways have been identified (8, 9). In the extrinsic pathway, apoptosis is initiated through ligand binding to cell surface receptors of the tumor necrosis factor (TNF) family such as TNF-R1 and Fas. Upon ligation these receptors initiate the formation of a death-inducing signaling complex, which consists of adaptor molecules such as the Fas-associated death domain protein and procaspase-8. Within the complex, caspase-8 undergoes autoproteolytic activation. Once activated, caspase-8 can activate downstream caspases, for example, caspase-3 and -7, leading to orderly degradation of intracellular substrates and cell death. The cell-intrinsic pathway is initiated when the integrity of the outer mitochondrial membrane is lost in response to diverse apoptotic stimuli. This results in the release of cytochrome c and other apoptotic proteins into the cytoplasm, where cytochrome c binds to apoptotic protease-activating factor 1 (Apaf-1). Apaf-1 in turn recruits procaspase-9 to form a multimeric complex, which leads to the autoproteolytic activation of caspase-9. The active caspase-9 then efficiently activates other downstream caspases, bringing about the morphological changes characteristic of apoptosis. This intrinsic pathway is thus mitochondria-dependent and tightly controlled by the Bcl-2 family proteins.

Although the two apoptotic pathways can function independently, an existing link between them is the BH3 domain-only protein Bid that is cleaved by active caspase-8 following engagement of death receptor Fas (10, 11). Cleaved Bid, also known as truncated Bid (tBid), translocates to mitochondria to induce oligomerization of Bax and/or Bak and cytochrome c release (4, 12). In both Bax-/- and Bak-/- cells, tBid fails to induce cytochrome c release and apoptosis, suggesting that it requires Bax and/or Bak to exert its mitochondrial pro-apoptotic activity (5). However, the underlying mechanism and, in particular, the sequence of events that occurs after Bid cleavage and prior to cytochrome c release are not completely defined. In this study we investigated the mechanism of tBid-induced activation of the mitochondrial apoptotic pathway by searching for novel tBid-interacting proteins using a yeast two-hybrid screen. We identified the anti-apoptotic Bcl-2 family protein Mcl-1 as a genuine tBid-binding partner. Further studies demonstrate that Mcl-1 effectively inhibits tBid-induced cytochrome c release from mitochondria and protects HeLa cells from apoptosis induced by both tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and TNF-{alpha}.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials and Cell Culture—All media and cell culture reagents were purchased from Invitrogen. Other chemicals, unless otherwise stated, were obtained from Sigma. Human cervical carcinoma HeLa cells were obtained from American Type Culture Collection (Rockville, MD) and cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 2 mM glutamine, 0.5 units/ml penicillin, and 0.5 mg/ml streptomycin.

Cloning of cDNAs and Plasmids Construction—Mouse tBid cDNA was amplified by PCR from a murine pcDNA3-Bid template (a gift from Dr. S. Korsmeyer, Harvard Medical School, Boston, MA) and inserted into EcoRI-BamHI sites downstream of the GAL4-DBD in the vector pGBKT7 (Clontech). A cDNA encoding mouse Bax{alpha} lacking the C-terminal hydrophobic domain (Bax{alpha}21) was amplified by PCR from a pcDNA3-Bax{alpha} template (13) and cloned downstream of the GAL4-AD in pGADT7 vector (Clontech). A pUC18-bcl-2 construct (Clonexpress, Gaithersburg, MD) was used to clone the human Bcl-2 cDNA. This construct was digested with EcoRI and HindIII to release the Bcl-2 cDNA, which was then ligated into the corresponding sites in pcDNA3.1/myc-HIS©(-) (Invitrogen). Human Bid and tBid cDNA were generated by reverse transcriptase PCR using oligo(dT) primer with total RNA obtained from human leukemic Jurkat T cells. Both cDNAs were then cloned at the EcoRI-BamHI sites downstream of the HA-tag in pcDNA3.1-HA (Invitrogen) (14). The construct expressing HA-tagged human Mcl-1 was generated as previously described (14). GST fusion protein constructs were generated by PCR using pcDNA3.1-HA-Bid and -tBid as templates and cloned into the EcoRI-XhoI sites in the pGEX-6P-2 vector (Amersham Biosciences). Mutations in the BH domains of tBid and Mcl-1 proteins were generated by site-directed mutagenesis using the GeneTailorTM site-directed mutagenesis system according to manufacturer's instruction (Invitrogen). The G94E mutation of BH3 domain of tBid was generated by PCR using the pGEX-tBid construct as a template. Using pcDNA3.1-HA-Mcl-1 as a template for PCR of all Mcl-1 mutants, we generated the G262E mutation at BH1 domain, the W305A and W312A double mutations for BH2 domain, and the G217E and D218A double mutations of BH3 domain of Mcl-1. The cDNA fragment encoding human Mcl-1 generated by PCR was inserted into the NdeI and SapI sites of the pTYB1 vector for the expression of recombinant human Mcl-1 protein (New England Biolabs, Beverly, MA). The accuracy of the molecular identity of all constructs was confirmed by sequencing. For details of the PCR primers used see the supplemental data.

Yeast Two-hybrid Assay—All yeast two-hybrid procedures were carried out according to the manufacturer's protocol (Clontech). The cDNA for mouse-truncated Bid was cloned into the pGBKT7 vector as described earlier. The cDNA library was generated from mouse primary thymocytes that had been treated with 5 gray of {gamma}-irradiation and cultured for 5 h to induce apoptosis. The RNA was then isolated from these cells, and the cDNA library was prepared by oligo(dT) priming and directionally cloned in the EcoRI-XhoI sites of the prey vector pAD-Gal4-2.1 (Stratagene, La Jolla, CA). The library was amplified once and found to have over 90% recombinants with an average insert size of 1.5 Kb. Screening was carried out by sequential transformation of the tBid construct followed by the cDNA library into yeast strain Y190. After transformation, the yeast were grown for 15 days on selection plates containing 17 mM 3-amino-1,2,4-triazole. Colonies that grew on the plates were tested for activity of the beta-galactosidase reporter gene by filter-lift assay. Plasmids from the positive colonies were isolated and subjected to PCR and sequencing to identify the prey cDNAs. The specificity of the interaction was confirmed by retransformation.

GST Fusion Protein Production and Binding Assay—GST fusion proteins were produced in BL21 Escherichia coli following the induction of expression by isopropyl 1-thio-beta-D-galactopyranoside (Insight Biotechnology, Middlesex, UK) and purified using glutathione-Sepharose beads (Amersham Biosciences). In vitro translated proteins labeled with [35S]methionine were prepared using the TNT® T7 Quick-Coupled Transcription/Translation System (Promega, Madison, WI), using pcDNA3.1-HA constructs as templates. The 35S-labeled prey proteins were incubated with GST, GST-Bid, or GST-tBid fusion proteins bound to glutathione-Sepharose beads in bead-binding buffer (50 mM potassium phosphate, pH 7.5, 150 mM KCl, 1 mM MgCl2, 10% glycerol, 1% Triton X-100) and protease inhibitors mixture from Roche Applied Science. The mixtures were incubated at 4 °C for 2 h with rotation. The beads were then pelleted and washed five times in ice-cold bead-binding buffer. Finally, beads were resuspended in SDS sample buffer, and the proteins were resolved on SDS-polyacrylamide gels, which were fixed, vacuum-dried onto 3MM paper, and then visualized using a PhosphorImager (Typhoon 8600, Amersham Biosciences).

Immunoprecipitation—For each immunoprecipitation experiment, HeLa cells were transfected with HA-tBid in pcDNA3.1 or empty vector in the presence of 75 µM Z-VAD-fmk (Enzyme System, Dublin, CA). Immunoprecipitation was essentially carried out as described (15). Briefly, 24 h after transfection, cells were harvested and resuspended in ice-cold lysis buffer containing 2% CHAPS, 20 mM Tris/HCl (pH 7.4), 137 mM NaCl, 2 mM EDTA, 10% glycerol, 1% Triton X-100, and protease inhibitor mixture (Roche Applied Science). Lysates were precleared and then incubated with either mouse anti-HA monoclonal antibody (clone 12CA5, Roche) or rabbit anti-Mcl-1 polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at 4 °C for 1 h, and protein A-Sepharose beads (Pharmacia, Piscataway, NJ) were added to pull down the immunocomplexes. The beads were washed five times in washing buffer containing 0.2% Triton X-100, 20 mM Tris/HCl (pH 7.4), 137 mM NaCl, 2 mM EDTA, 10% glycerol before being resuspended in SDS sample buffer and subjected to SDS-PAGE. Immunoblotting was performed using, where appropriate, goat anti-Bid polyclonal antibody (R&D Systems, Minneapolis, MN), rabbit anti-Mcl-1 polyclonal antibody (Santa Cruz), rabbit anti-Bcl-2 polyclonal antibody (Santa Cruz), mouse anti-Mcl-1 monoclonal antibody (Chemicon International, Temecula, CA), rabbit anti-Bak (NT) polyclonal antibody (Upstate%20Biotechnology">Upstate Biotechnology, Lake Placid, NY), or rabbit anti-Bax (NT) polyclonal antibody (Upstate). For quantification of Bak and Mcl-1 levels, bands representing respective Bak and Mcl-1 from membranes of three independent immunoprecipitation experiments were scanned and analyzed using a GS-800 Calibrated Densitometer with Quantity One software (Bio-Rad).

Immunoblotting—SDS-PAGE and immunoblotting were performed essentially as described (16). Briefly, cellular proteins were resolved on the polyacrylamide gels and transferred to nitrocellulose membrane (Amersham Biosciences). The membranes were probed with, where appropriate, goat anti-Bid polyclonal antibody, rabbit anti-Mcl-1 polyclonal antibody, mouse anti-cytochrome c monoclonal antibody (clone 7H8.2C12, Pharmingen), mouse anti-cytochrome oxidase subunit II monoclonal antibody (clone 12C4-F12, Molecular Probes, Eugene, OR), mouse anti-PARP monoclonal antibody (clone C2-10, R&D Systems), or rat anti-{alpha}-tubulin monoclonal antibody (Serotec, Oxford, UK). After incubating with respective secondary antibodies conjugated with horseradish peroxidase, the membranes were visualized by ECL Kit (Amersham Biosciences).

In Vitro Assay for Mitochondrial Cytochrome c Release—This assay was performed as described (17) with minimum modification. In brief, 20 x 106 HeLa cells were harvested and washed once in ice-cold phosphate-buffered saline. The cell pellet was resuspended in 5x volume of buffer A (20 mM HEPES, pH 7.4, 250 mM sucrose, 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, and protease inhibitor mixture from Roche Applied Science) and incubated on ice for 15 min. Cells were then disrupted by passing them through a 23-gauge needle 25 times before undergoing centrifugation in two sequential steps: 1000 x g and 10,000 x g. The 10,000 x g pellet was collected as mitochondrial fraction and resuspended at a 5 µg/µl concentration in buffer A supplemented with 150 mM NaCl. Resuspended mitochondria were incubated either alone or with caspase-8-cleaved recombinant human Bid (R&D Systems) at indicated concentrations at 37 °C for 15 min. Following incubation, the mitochondria were centrifuged, with the resulting supernatant collected for examination of cytochrome c release by immunoblotting and the pellet was cross-examined for loss of cytochrome c and cytochrome oxidase subunit II as sample loading control.

Preparation of Recombinant Human Mcl-1—The cDNAs of full-length human Mcl-1 and mutant Mcl-1mtBH3 were cloned into pTYB1 vector (New England Biolabs), which were used to transform BL21 cells, respectively. The recombinant proteins were induced with the addition of isopropyl 1-thio-beta-D-galactopyranoside and purified according to manufacturer's instruction (New England Biolabs). The proteins were further concentrated using centrifugal filter devices (Amicon Ultra-4 30,000 MWCO) (Millipore, Bedford, MA).

Generation of Stably Transfected Cell Lines and Induction of Apoptosis—HeLa cells were split to 40-50% confluence in 10-cm dishes the day prior to transfection and transfected with 10 µg of pcDNA3.1-HA or pcDNA3.1-HA-Mcl-1 using Lipofectamine 2000 reagent (Invitrogen), according to the manufacturer's instructions. 24 h after transfection cells were split and cultured under selection with 1 mg/ml G418 (Invitrogen). Single cell clones were picked and expanded to establish the stable Mcl-1 overexpressing cells. Overexpression of the Mcl-1 protein was confirmed by immunoblotting. To induce apoptosis, wild type, vector-only, and HA-Mcl-1 overexpressing stable HeLa cells were all treated with soluble recombinant human TRAIL (Alexis Biochemicals, San Diego, CA) at indicated concentrations for 14 h. Cells were also treated with TNF-{alpha} (15 ng/ml) in the presence of cycloheximide (30 µg/ml) for 22 h. Apoptosis was assessed by flow cytometry for cells with sub-G1 DNA content following propidium iodide staining and PARP cleavage as previous described (16).

Lentivirus Generation and Expression of Mcl-1 Short Hairpin RNA—A BLOCK-iT Lentiviral RNAi Expression System (Invitrogen) was used according to manufacturer's instruction. Briefly, the RNA interference sequence for human Mcl-1, GGACTGGCTAGTTAAACAAAG, was identified using manufacturer's RNAi Designer program, and the corresponding oligonucleotides were cloned into pENTRTM/U6 vector (Invitrogen). The RNA interference sequence for mouse eleven-nineteen leukemia (ENL) gene, GCTGTGAGAAGCTCACCTTCA, was used to produce control short hairpin RNA (shRNA), and its oligonucleotides were also cloned into the vector. DH5{alpha} E. coli (Invitrogen) were transformed, and clones were verified by sequencing. The correctly identified clones were transferred via a gateway reaction to a modified pLenti6/BLOCK-iTTM-DEST vector (Invitrogen), a promoterless lentiviral destination vector in which the blasticidin resistance marker is replaced with tailless human CD2 as a marker. 293 cells were transfected with the plasmids using Lipofectamine reagent to produce the virus. 48 h later, the lentivirus-containing supernatants were harvested to infect HeLa cells in the presence of Polybrene. The infected HeLa cells were harvested 48 h later for the analysis of Mcl-1 expression by immunoblotting. Induction of apoptosis by TRAIL was performed essentially as described above.


Figure 1
View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 1.
Identification of interaction of tBid with Mcl-1 by yeast two-hybrid screening. A, alignment of in-frame amino acid sequences from three clones containing cDNA encoding Mcl-1 with full-length murine Mcl-1 protein (mMcl-1). B, the activity of the beta-galactosidase reporter gene was examined by filter-lift assay after retransformation of yeast containing either vector alone or tBid cDNA with plasmids from positive clones representing cDNA encoding Mcl-1 (upper panel) and Bcl-2 (middle panel). As a positive control, mouse Bax{alpha}cDNA was used in the retransformation (lower panel).

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Truncated Bid Interacts with Mcl-1—We initially performed a yeast two-hybrid screen using truncated Bid as the bait protein and identified a number of tBid-interacting proteins. These included two anti-apoptotic Bcl-2 family proteins Mcl-1 and Bcl-2. Only one positive clone representing a cDNA of Bcl-2 was found to interact with tBid, consistent with a previous report that Bid interacted with Bcl-2 (18). There were, however, three independent positive clones identified representing cDNAs encoding Mcl-1, and the in-frame amino acid sequences from each clones were aligned against the full-length murine Mcl-1 (19) as shown in Fig. 1A. One positive clone (clone 85) containing the shortest Mcl-1 cDNA lacked the 5'-region encoding for the first 144 amino acids, suggesting that the C terminus fragment of the Mcl-1 protein containing the BH1, BH2, and BH3 domains was responsible for interacting with tBid. To exclude the possibility of false interaction, the plasmids from the positive clones were isolated and retransformed into yeast containing the plasmid of tBid cDNA, and the activity of the beta-galactosidase reporter gene was examined using the filter-lift assay. As Bid has also been reported to interact with Bax (18), we used Bax as positive control with the mouse Bax{alpha} cDNA cloned in the pGADT7 vector during retransformation. The filter-lift assay detected the beta-galactosidase activity in the clone transformed with plasmid containing Bax cDNA in the presence of tBid (Fig. 1B, lower right panel). Interestingly, the clone identified as expressing the Mcl-1 fusion protein showed a much greater intensity of beta-galactosidase staining than the clone expressing the Bcl-2 fusion protein (Fig. 1B, compare upper right panel with middle right panel).


Figure 2
View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 2.
Truncated Bid interacts with Mcl-1 in vitro and in vivo. A, in vitro translated [35S]methionine-labeled Mcl-1 (upper panel) and Bcl-2 (lower panel) were incubated with GST alone, GST-Bid, or GST-tBid immobilized on glutathione-Sepharose beads. Bound proteins were visualized using a PhosphorImager after protein separation by SDS-PAGE. B, HeLa cells were transfected with either pcDNA3.1 vector alone or a HA-tBid construct in the presence of 75 µM Z-VAD-fmk. 24 h after transfection, cells were lysed and subject to immunoprecipitation (IP) using anti-HA antibody (upper panel) or anti-Mcl-1 antibody (lower panel). Precipitated immunocomplexes were analyzed by SDS-PAGE and immunoblotting (IB) using anti-Mcl-1 antibody (upper panel), anti-Bcl-2 antibody (middle panel), or anti-Bid antibody (lower panel).

 
To see whether the interaction of Mcl-1 with tBid could be confirmed by an independent method, we performed GST fusion protein pulldown experiments. GST-Bid and GST-tBid fusion proteins were immobilized on glutathione-Sepharose beads, respectively, and incubated with either [35S]-methionine labeled Mcl-1 or Bcl-2 (Fig. 2A). This assay identified Mcl-1 as a protein specifically interacting with tBid rather than the full-length Bid (Fig. 2A, compare lane 4 with lane 3, upper panel). Bcl-2 was also seen to preferentially interact with the truncated form of Bid (Fig. 2A, compare lane 4 with lane 3, lower panel). Similar to the result shown in Fig. 1B, tBid fusion protein again showed a higher affinity for Mcl-1 than Bcl-2 (Fig. 2A).

Next, we carried out co-immunoprecipitation experiments to check whether this interaction occurs within cells. A HA-tagged tBid construct was generated and subsequently used to overexpress tBid in HeLa cells in the presence of the pan caspase inhibitor Z-VAD-fmk to delay cell death. Cells were lysed 24 h after transfection, and immunoprecipitation was done using an anti-HA antibody. The endogenous Mcl-1 was detected in complex with HA-tBid by immunoblotting (Fig. 2B, upper panel). In addition, endogenous Bcl-2 was also detected in complex with HA-tBid (Fig. 2B, middle panel), in agreement with an early report (18). Similarly, when an anti-Mcl-1 antibody was used to immunoprecipitate Mcl-1 complex from lysates of cells overexpressing HA-tBid, tBid was clearly observed to interact with Mcl-1 (Fig. 2B, lower panel). It is important to mention that the endogenous full-length Bid was not immunoprecipitated by the anti-Mcl-1 antibody under the experimental conditions used (data not shown), further underlining the specificity of the interaction between Mcl-1 and the truncated form of the Bid protein.


Figure 3
View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 3.
BH domains of both tBid and Mcl-1 are required for interaction. A, requirement of BH3 domain of tBid to bind Mcl-1. In vitro translated [35S]methionine-labeled Mcl-1 was incubated with GST alone, GST-tBid, or mutant GST-tBid (mtBH3) (G94E) immobilized on glutathione-Sepharose beads. B, BH1, BH2, and BH3 domains of Mcl-1 contribute to interaction with tBid. GST alone and GST-tBid were immobilized on glutathione-Sepharose beads and incubated with in vitro translated [35S]methionine-labeled Mcl-1 (upper panel) or Mcl-1mtBH1 (G262E mutation) (upper middle panel) or Mcl-1mtBH2 (W305A and W312A double mutations) (lower middle panel) or Mcl-1mtBH3 (G217E and D218A double mutations) (lower panel). All bound proteins were analyzed using a PhosphorImager.

 
BH3 Domain of tBid and All Three BH Domains of Mcl-1 Are Required for Interaction—We then investigated the binding sites responsible for the interaction between tBid and Mcl-1. Based on previous reports describing the amino acids critical for interactions between Bcl-2 family proteins (18, 20-22) and our observation from the yeast two-hybrid experiment that the C terminus fragment of Mcl-1 was required for interaction, we hypothesized that the interaction between Mcl-1 and tBid involved the BH domains of both proteins. To test this hypothesis we generated a number of constructs that contained cDNAs encoding for Mcl-1 and tBid but with their BH domains mutated. First, we compared the abilities of GST-tBid with mutant GST-tBid (mtBH3) (containing G94E mutation at BH3 domain) to interact with [35S]methionine-labeled Mcl-1. GST-tBid, but not mutant GST-tBid (mtBH3), was shown to interact with Mcl-1 (Fig. 3A, compare lane 3 with lane 4). This indicated that the BH3 domain of tBid was required for interaction with Mcl-1. Next, we compared the binding ability of wild type Mcl-1 to GST-tBid with that of Mcl-1 proteins that had mutations at BH1 (G262E mutation), BH2 (W305A and W312A double mutations), or BH3 (G217E and D218A double mutations) domain, respectively. As shown in Fig. 3B, apart from wild type Mcl-1, all three Mcl-1 proteins with their respective BH domain mutated failed to interact with GST-tBid. Mutations in BH1 and BH3 domains resulted in a complete loss of interaction, whereas mutations in BH2 domains severely impaired the binding ability of Mcl-1 to GST-tBid. These results demonstrated that all three BH domains of Mcl-1 contribute to its ability to interact with tBid.

Mcl-1 Prevents tBid-mediated Cytochrome c Release—We then studied the functional significance of the interaction between tBid and Mcl-1. As tBid has been shown to possess potent cytochrome c release activity (10, 11), an in vitro assay was set up to examine this activity. Mitochondria isolated from HeLa cells were treated with increasing amount of recombinant tBid, and as shown in Fig. 4A (upper panel), tBid induced cytochrome c release into the supernatant in a dose-dependent manner. As a positive control, 30 µg of untreated mitochondria was used for the detection of cytochrome c (Fig. 4A, lane 1, upper panel). The same blot was reprobed for cytochrome oxidase (subunit II), a mitochondrial membrane protein, and it confirmed that the supernatant samples were free from mitochondrial contamination (Fig. 4A, lanes 2-5, lower panel).


Figure 4
View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 4.
Mcl-1 prevents tBid-mediated cytochrome c release from isolated mitochondria. A, mitochondria isolated from HeLa cells were incubated with recombinant tBid at the indicated concentrations. At the end of incubation, supernatant of the mitochondrial suspension was collected and subjected to SDS-PAGE and immunoblotting for cytochrome c (Cyt. c, upper panel). Untreated mitochondria (Mito.) were used as positive control for the detection of cytochrome c (lane 1). The same membrane was reprobed for cytochrome oxidase (subunit II) to check whether the supernatant contains mitochondrial contamination (Cyt. Oxid., lower panel). B, mitochondria were pre-incubated with recombinant Mcl-1 at the indicated concentrations before the addition of tBid. Both supernatant and pellet of the mitochondrial suspension were collected at the end of incubation and subject to SDS-PAGE and immunoblotting for cytochrome c (Cyt. c, supernatant, and upper panel, pellet). Membrane from the pellet samples was also probed for tBid for its presence (middle panel, pellet) and for cytochrome oxidase (subunit II) as sample loading control (Cyt. Oxid., lower panel, pellet). C, mitochondria were pre-incubated with recombinant Mcl-1 (5 ng/µl) or mutant Mcl-1mtBH3 (G217E and D218A double mutations) (5 ng/µl) before the addition of tBid. At the end of incubation, both supernatant and pellet of the mitochondrial suspension were collected and subject to SDS-PAGE and immunoblotting as described in B.

 
As Mcl-1 is an anti-apoptotic protein, we reasoned that its ability to interact with tBid would possibly interfere with the function of the tBid protein. To test this, isolated mitochondria from HeLa cells were preincubated with increasing amounts of recombinant Mcl-1 protein before the addition of tBid. Recombinant Mcl-1 alone (5 ng/µl) had no effect on the release of cytochrome c (Fig. 4B, lane 2, supernatant). The treatment of mitochondria with tBid (1 ng/µl) resulted in the release of cytochrome c from mitochondria (Fig. 4B, lane 3, supernatant), which is further confirmed by the disappearance of cytochrome c in the mitochondrial fraction (Fig. 4B, lane 3, upper panel, pellet). At a concentration of 1 ng/µl, recombinant Mcl-1 failed to block tBid-mediated release of cytochrome c (Fig. 4B, lane 4, supernatant). At 2 ng/µl concentration, Mcl-1 significantly inhibited the release (Fig. 4B, lane 5, supernatant), whereas at 5 ng/µl Mcl-1 completely prevented tBid-induced cytochrome c release (Fig. 4B, lane 6, supernatant). The complete protection by Mcl-1 (5 ng/µl) was also confirmed by the full retention of cytochrome c in the mitochondrial fraction (Fig. 4B, lane 6, upper panel, pellet). The same membrane from the mitochondrial fraction was also reprobed for tBid to confirm its presence (Fig. 4B, middle panel, pellet) and for cytochrome oxidase as sample loading control (Fig. 4B, lower panel, pellet). Thus, recombinant Mcl-1 inhibited tBid-induced cytochrome c release from the mitochondria in a dose-dependent manner. To further confirm that Mcl-1 inhibits tBid function through its interaction with tBid, we generated a recombinant Mcl-1 protein containing G217E and D218A double mutations in its BH3 domain (Mcl-1mtBH3), which, we have shown previously, failed to interact with tBid (Fig. 3B, lower panel). Pre-incubating mitochondria with the recombinant Mcl-1mtBH3 protein itself (5 ng/µl) had no effect on the release of cytochrome c (Fig. 4C, lane 5, supernatant). However, it did not protect mitochondria from tBid (1 ng/µl)-mediated cytochrome c release (Fig. 4C, lane 4, supernatant), whereas recombinant wild type Mcl-1 (5 ng/µl) effectively blocked this release (Fig. 4C, lane 3, supernatant). This is also confirmed by the observation that the loss of cytochrome c in the mitochondria occurred when both recombinant Mcl-1mtBH3 protein and tBid were present (Fig. 4C, lane 4, upper panel, pellet) but was prevented by recombinant wild type Mcl-1 (Fig. 4C, lane 3, upper panel, pellet). Thus, our data provided compelling evidence for a functional effect of the interaction between Mcl-1 and tBid.

Truncated Bid Displaces Bak from Mcl-1-Bak Complex—Recently it has been shown that Mcl-1 forms a complex with Bak in healthy, unstressed cells (23, 24), we therefore wanted to examine what happens to this complex when tBid was present. We used a HA-tagged tBid construct to overexpress tBid in HeLa cells in the presence of the pan caspase inhibitor Z-VAD-fmk as described previously. Immunoprecipitation using an anti-HA antibody showed that tBid interacted with both endogenous Bak and Bax (Fig. 5A, upper and lower panels, respectively), which was consistent with the published reports (3, 4). Immunoprecipitation using anti-Mcl-1 antibody showed that Bak indeed interacted with Mcl-1 in cells transfected with empty vector, as detected by immunoblotting (Fig. 5B, lane 1, upper panel). However, when cells were transfected with the HA-tBid construct the level of Bak in complex with Mcl-1 was greatly reduced (Fig. 5B, lane 2, upper panel), whereas the total amount of Mcl-1 in both immunoprecipitated samples was similar (Fig. 5B, middle panel). Interaction of Mcl-1 with tBid was again confirmed by reprobing Bid on the same membrane (Fig. 5B, lane 2, lower panel). We also probed for Bax and could not detect Bax in the samples immunoprecipitated by anti-Mcl-1 antibody under the experimental conditions used (data not shown). To test the possibility that overexpression of HA-tBid may alter the expression levels of endogenous Bak and/or Mcl-1, resulting in the reduction of Bak in complex with Mcl-1, we also checked the levels of Bak, Mcl-1, and tBid in the total cell lysates prior to the immunoprecipitation. Immunoblotting analysis showed that the expression levels of both Bak and Mcl-1 remained unchanged (Fig. 5B, lanes 3 and 4, upper and middle panels), regardless of the presence of HA-tBid (Fig. 5B, lane 4, lower panel). Densitometric analysis of bands representing respective Bak and Mcl-1 on membranes from three independent immunoprecipitation experiments indicated that the relative level of Bak to Mcl-1 was about 4-fold less in an immunoprecipitated sample from cells overexpressing tBid than that from control cells (Fig. 5C). Statistical analysis by Student's t test showed that the difference was significant (p < 0.05). Therefore, in addition to its ability to interact directly with Bak and Bax, tBid can also bind Mcl-1 and displace Bak from the Mcl-1-Bak complex.


Figure 5
View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 5.
tBid binds Mcl-1 and displaces Bak from Mcl-1-Bak complex. A, HeLa cells were transfected with either pcDNA3.1 vector alone or a HA-tBid construct in the presence of 75 µM Z-VAD-fmk. Cells were lysed 24 h after transfection and subjected to immunoprecipitation (IP) using anti-HA antibody. Precipitated immunocomplexes were analyzed by SDS-PAGE and immunoblotting (IB) using anti-Bak antibody (upper panel) or anti-Bax antibody (lower panel). Asterisks denote nonspecific bands. B, the above cell lysates were immunoprecipitated by anti-Mcl-1 antibody. The precipitates were subject to SDS-PAGE and immunoblotting using anti-Bak antibody (left upper panel), anti-Mcl-1 antibody (left middle panel), or anti-Bid antibody (left lower panel). Prior to immunoprecipitation, 5% of total cell lysates (TCL) from cells transfected with either pcDNA3.1 vector alone or a HA-tBid construct were also analyzed by SDS-PAGE and immunoblotting for the expression levels of Bak (right upper panel), Mcl-1 (right middle panel), or Bid (right lower panel). C, relative level of Bak to Mcl-1 in immunoprecipitated samples by antiMcl-1 antibody was analyzed by densitometry after scanning the bands representing respective Bak and Mcl-1 on membranes from three independent immunoprecipitation experiments.

 
Mcl-1 Inhibits Apoptosis Induced by TRAIL and TNF-{alpha} in HeLa Cells—Because Bid has been shown to be cleaved early during the induction of apoptosis by TRAIL in HeLa cells (25, 26), we wished to investigate whether cells overexpressing Mcl-1 would be resistant to apoptosis induced by TRAIL. HeLa cells were transfected with either pcDNA3.1 vector alone or human Mcl-1 cDNA expression construct and selected in G418. Single cell clones were picked and expanded to establish the stable Mcl-1 overexpressing cells. The level of Mcl-1 expression was evaluated by immunoblotting, which showed that its level is higher in cells transfected with the Mcl-1 construct than those with vector-only or wild type HeLa cells (Fig. 6A). Induction of apoptosis was assessed by flow cytometry for subdiploid DNA content (sub-G1) following propidium iodide staining and PARP cleavage, a biochemical marker of apoptosis. As shown in Fig. 6B, treatment of wild type HeLa cells with increasing doses of TRAIL resulted in a dose-dependent induction of apoptosis. This treatment also caused a similar dose-dependent induction of apoptosis in cells transfected with vector alone (Fig. 6B). Cells stably overexpressing Mcl-1 were, however, consistently protected from cell death following treatment with TRAIL at all concentrations (Fig. 6B). Student's t test analysis showed that the reduction in TRAIL (250 ng/ml)-induced apoptosis of cells overexpressing Mcl-1, when compared with cell death in wild type HeLa cells and in cells transfected with vector alone, was statistically significant (both p < 0.01). Also, treatment with increasing amount of TRAIL resulted in a dose-dependent cleavage of PARP in wild type and vector-only transfected HeLa cells (Fig. 6B). PARP cleavage was less complete in Mcl-1 overexpressing cells than that seen in wild type and vector-only transfected HeLa cells following treatment of TRAIL at 250 ng/ml concentration (Fig. 6B, compare lane 15 with lanes 13 and 14, respectively, PARP).

As TNF-{alpha} has been shown to induce apoptosis in HeLa cells through a Bid-dependent pathway (15), we also treated the above cells with TNF-{alpha} to see whether cells overexpressing Mcl-1 would be resistant to apoptosis induced by TNF-{alpha}. Treatment with Me2SO or cycloheximide (30 µg/ml) alone did not cause significant increase in cell death in all three types of cells (data not shown). Treatment with TNF-{alpha} (15 ng/ml) in the presence of cycloheximide for 22 h resulted in similar levels of apoptosis in wild type HeLa cells and cells stably transfected with vector alone (Fig. 6C, lanes 2 and 4, respectively). Cells stably overexpressing Mcl-1 were indeed partially resistant to TNF-{alpha}-induced cell death (Fig. 6C, lane 6). The reduction in TNF-{alpha}-induced apoptosis in cells overexpressing Mcl-1, when compared with cell death in wild type HeLa cells and cells transfected with vector alone, was statistically significant (both p < 0.05). Again, PARP cleavage was not as complete in Mcl-1 overexpressing cells as that seen in wild type HeLa cells and cells transfected with vector alone (Fig. 6C, compare lane 6 with lanes 2 and 4, respectively, PARP). Inhibition of death receptor-mediated apoptosis was also observed in another stable HeLa cell line overexpressing Mcl-1 (see Fig. 1 in supplemental data). Therefore, overexpressing Mcl-1 conferred resistance to apoptosis induced by both TRAIL and TNF-{alpha} in HeLa cells.

Mcl-1 Silencing by RNA Interference Sensitizes HeLa Cells to TRAIL-induced Apoptosis—To determine the effect of Mcl-1 down-regulation on death receptor-mediated cell death, we used a lentiviral vector for expression of shRNA to induce Mcl-1 silencing. HeLa cells were infected with lentivirus containing vectors expressing either control shRNA or Mcl-1 shRNA. The level of Mcl-1 expression was then evaluated by immunoblotting. As shown in Fig. 7A, the expression level of Mcl-1 is clearly reduced in cells infected with lentivirus expressing Mcl-1 shRNA. We then treated these cells with TRAIL (100 ng/ml) for 14 h to induce apoptosis. Treatment with TRAIL resulted in similar levels of apoptosis in wild type HeLa cells and cells infected with virus expressing control shRNA (Fig. 7B, lanes 2 and 4, respectively). However, cells infected with virus expressing Mcl-1 shRNA became more sensitive to TRAIL-induced cell death (Fig. 7B, lane 6). The increase in TRAIL-induced apoptosis in cells infected with virus expressing Mcl-1 shRNA, when compared with cell death in wild type HeLa cells and cells infected with virus expressing control shRNA, was statistically significant (both p < 0.05). In addition, there is a greater loss of intact PARP observed in cells infected with virus expressing Mcl-1 shRNA than that seen in wild type HeLa cells and cells infected with virus expressing the control shRNA following the treatment with TRAIL (Fig. 7B, compare lane 6 with lanes 2 and 4, respectively, PARP).


Figure 6
View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 6.
Mcl-1 inhibits apoptosis induced by TRAIL and TNF-{alpha} in HeLa cells. A, HeLa cells were stably transfected with either pcDNA3.1 vector alone or plasmid containing the cDNA encoding human Mcl-1. The expression of Mcl-1 in wild type (w/t), pcDNA3.1 vector and Mcl-1 overexpressing HeLa cells was assessed by immunoblotting for Mcl-1 (upper panel). The same membrane was also probed for {alpha}-tubulin as sample loading control (lower panel). B, apoptosis was induced by the treatment of the three HeLa cell lines with soluble human recombinant TRAIL at the indicated concentrations for 14 h and assessed by both flow cytometry for cells with sub-G1 DNA content and PARP cleavage by immunoblotting. {alpha}-Tubulin was also probed as sample loading control. C, apoptosis was also induced by the treatment of the three HeLa cell lines with TNF-{alpha} (15 ng/ml) in the presence of cycloheximide (CHX, 30 µg/ml) for 22 h and assessed as described in B.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Most of the studies on protein-protein interaction of Bid in apoptosis have, to date, focused on its interaction with the pro-apoptotic Bax and Bak proteins. It has been shown that tBid can directly interact with both Bax and Bak and induce their oligomerization, resulting in cytochrome c release (3, 4). This function of tBid is vital for the transmission of apoptotic signals from death receptors to mitochondria in certain tissues, and, indeed, apoptosis in hepatocytes is dependent on tBid-mediated amplification of the apoptotic signal via the mitochondria after engagement of the death receptor Fas (27). However, there has been little information about the role of anti-apoptotic Bcl-2 proteins in regulating the function of tBid. Here we show that Mcl-1 can regulate tBid-mediated apoptosis through its ability to interact with tBid. Our yeast two-hybrid screen identified Mcl-1 as a potent interaction partner for tBid, and this interaction was confirmed by both GST fusion protein pull-down experiments in vitro and co-immunoprecipitation in vivo. In addition, we have compared Mcl-1 with Bcl-2 for the ability to bind tBid in both the yeast two-hybrid and GST pull-down experiments, and tBid appears to have a much higher affinity for Mcl-1 than Bcl-2. The coimmunoprecipitation assay showed that tBid interacts with Mcl-1 as well as Bcl-2 in cells. Recently, it has been shown that C-terminal fragments of Mcl-1 can also interact with tBid (28). However, in that study the interaction was observed on the basis of exogenously expressed Mcl-1 proteins, whereas in our study tBid was shown to interact with endogenous Mcl-1.


Figure 7
View larger version (42K):
[in this window]
[in a new window]
  		FIGURE 7.
Mcl-1 silencing by RNA interference sensitizes HeLa cells to TRAIL-induced apoptosis. A, HeLa cells were infected with lentivirus-containing vectors expressing either control shRNA or Mcl-1 shRNA. The expression of Mcl-1 in wild type (w/t) HeLa cells and cells infected with virus expressing either control shRNA or Mcl-1 shRNA was assessed by immunoblotting for Mcl-1 (upper panel). The same membrane was also probed for {alpha}-tubulin as sample loading control (lower panel). B, apoptosis was induced by the treatment of the three HeLa cell lines with soluble human recombinant TRAIL (100 ng/ml) for 14 h and assessed by both flow cytometry for cells with sub-G1 DNA content and PARP cleavage by immunoblotting. {alpha}-Tubulin was also probed as sample loading control.

 
It has been proposed that the BH3 domain-only proteins can be further divided into two subgroups, activating or sensitizing (29, 30). Those proteins with activating BH3 domains (e.g. Bid and Bim) appear to have a higher affinity for Bak or Bax than Bcl-2, perhaps directly activating Bak and Bax. The BH3-only proteins with sensitizing BH3 domains (e.g. Bad) appear to preferentially bind Bcl-2 allowing Bak and Bax to be derepressed. In this study, we confirm that tBid can directly interact with Bak and Bax. More importantly, we have also shown that tBid can bind to Mcl-1 and disrupt the Mcl-1-Bak complex. As a result, Bak is displaced from the complex. Recently, it has been reported that another BH3-only protein Noxa can also displace Bak from Mcl-1/Bak complex (31), suggesting that this displacement is indeed a common feature for BH3-only proteins to activate Bak and/or Bax. Therefore, our study demonstrates dual modes of action by tBid, which is capable of both activating and sensitizing other pro-apoptotic Bcl-2 family proteins. On the other hand, Mcl-1 can act through direct binding to neutralize tBid, thus preventing it from activating Bak or Bax. In this respect Mcl-1 may be playing an active role in counter balancing activating BH3 domain only proteins. This notion is supported by the recent studies that Bim, another activating BH3 domain-only protein, has a higher affinity for Mcl-1 than Bcl-2 (32), and Mcl-1 effectively inhibits Bim-mediated release of mitochondrial cytochrome c (33). Our study shows that Mcl-1 interacts with tBid and impairs the ability of tBid to induce cytochrome c release and apoptosis. Recently, two independent studies revealed differential targeting of anti-apoptotic Bcl-2 proteins by BH3-only proteins using individual BH3 peptides (34, 35). A Bim BH3 peptide appears capable of interacting with most anti-apoptotic proteins including Mcl-1 with high affinity, whereas the Bid BH3 peptide does not bind Mcl-1. This is not unexpected, as we have shown that full-length Bid is not able to interact with Mcl-1. Only the truncated Bid, which may undergo further modification by postproteolytic N-myristoylation, is able to bind Mcl-1, suggesting that there is a complex structural basis underlying the interaction of Bid with other proteins, which is not discernable in binding studies using Bid BH3 peptide alone.

Our in vivo experiments in HeLa cells were prompted by the involvement of Bid in apoptosis mediated by TRAIL and TNF-{alpha} in HeLa cells (15, 25, 26). We have shown that Mcl-1 can indeed protect HeLa cells from apoptosis induced by TRAIL and TNF-{alpha}. Mcl-1 silencing by a shRNA approach sensitizes HeLa cells to TRAIL-induced apoptosis. Recently, it has been reported that Mcl-1 mediates resistance to TRAIL-induced apoptosis in human cholangiocarcinoma cells (36). In their study, resistance was specifically associated with overexpression of Mcl-1 and depletion of Mcl-1 by the small interfering RNA method also sensitizes cells to TRAIL-mediated apoptosis despite Bcl-2 expression. Furthermore, another study has also shown that hepatocyte growth factor-mediated Mcl-1 induction inhibits apoptosis induced by Fas in human primary hepatocytes (37). As TRAIL and Fas induce apoptosis via a similar mechanism (38), it is conceivable that Mcl-1 could bind to tBid and interfere with its function in activating Bax and/or Bak, resulting in protection of these cells from death receptor-mediated apoptosis. Our observations of interaction between Mcl-1 and tBid and subsequent prevention of cytochrome c release therefore provide a potential biochemical mechanism to explain the anti-apoptotic effect of Mcl-1 in death receptor-mediated apoptosis through specific targeting of tBid.

It is worth noting that under the experimental conditions used, overexpression of Mcl-1 does not fully protect cells from both TRAIL- and TNF-{alpha}-induced apoptosis although it significantly reduces the level of cell death in HeLa cells. It is possible that the level of Mcl-1 expression in stably transfected cells is not high enough to prevent cell death completely. In addition, in the case of TNF-{alpha}-induced apoptosis, the presence of protein synthesis inhibitor cycloheximide inevitably blocks production of Mcl-1 protein and thus reduces the anti-apoptotic function of Mcl-1. However, there is emerging evidence to suggest that complete protection of apoptosis requires multiple lines of resistance conferred by anti-apoptotic proteins and Mcl-1 may provide the first line of resistance to the induction of apoptosis by TRAIL and TNF-{alpha}. This is consistent with the observation that in adenoviral protein E1A-induced apoptosis in HeLa cells, loss of Mcl-1 is required to initiate the apoptotic pathway (23). The idea is further supported by a recent study demonstrating that Mcl-1 functions upstream of and together with Bcl-xL in preventing UV irradiation-induced cytochrome c release from mitochondria and apoptosis in HeLa cells (17). Mcl-1 alone may not be able to offer complete protection of cells from apoptosis. Conversely, depletion of Mcl-1 alone may be insufficient to render all the cells sensitive to death receptor-mediated apoptosis.

Mcl-1 was initially discovered as an early induction gene during differentiation of the myeloid cell line, ML-1 (39), and is widely expressed in a variety of human tissues and cells as well as many tumors (40, 41). Deletion of Mcl-1 in mice led to embryonic lethality during the periimplantation stage, suggesting it is essential for embryonic development (42). Genetic studies with conditional knock-out approach also reveal that Mcl-1 is required both in early lymphoid development and in the maintenance of mature B and T lymphocytes, which are rapidly lost when Mcl-1 is deleted (32). Mcl-1 also plays physiologically important roles in regulating myeloid cell survival (43, 44). Given that Mcl-1 can interact strongly with tBid and other BH3-only proteins such as Bim and inhibits their induction of cytochrome c release and activation of the mitochondrial apoptotic pathway, loss of Mcl-1 may render the cells sensitive to apoptosis induced by a variety of apoptotic stimuli including the activation of death receptors of TNF family. Here we demonstrate a biochemical link between Mcl-1, an essential regulator of lymphoid homeostasis, and receptor-mediated apoptosis, the pre-eminent pathway controlling survival of the cells of the immune system (45, 46).


   FOOTNOTES
 
* This research was supported in part by the Medical Research Council (United Kingdom) Grant G9900172 (to H. J. M. B.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental data. Back

1 Funded by a Child Health Research Appeal Trust (CHRAT) studentship from the Institute of Child Health and Great Ormond Street Hospital Special Trustees. Back

2 Both authors contributed equally to this work. Back

3 Funded by the Great Ormond Street Hospital for Children REACH Fund. Back

4 To whom correspondence should be addressed: Molecular Haematology and Cancer Biology Unit, Institute of Child Health and Great Ormond Street Hospital for Children, University College London, 30 Guilford St., London WC1N 1EH, UK. Tel.: 44-20-79052731; Fax: 44-20-78138100; E-mail: h.brady{at}ich.ucl.ac.uk.

5 The abbreviations used are: BH, Bcl-2 homology; TNF, tumor necrosis factor; tBid, truncated Bid; TRAIL, tumor necrosis factor-related apoptosis-inducing ligand; HA, hemagglutinin; GST, glutathione S-transferase; Z-VAD-fmk, benzyloxycarbonyl-VAD-fluoromethyl ketone; CHAPS, 3-[(3-cholamidopropyl)-dimethyl-ammonio]-1-propanesulfonate; PARP, poly(ADP-ribose)polymerase; shRNA, short hairpin RNA; mtBH3, mutant BH3. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gross, A., McDonnell, J. M., and Korsmeyer, S. J. (1999) Genes Dev. 13, 1899-1911[Free Full Text]
  2. Cory, S., and Adams, J. M. (2002) Nat. Rev. Cancer 2, 647-656[CrossRef][Medline] [Order article via Infotrieve]
  3. Desagher, S., Osen-Sand, A., Nichols, A., Eskes, R., Montessuit, S., Lauper, S., Maundrell, K., Antonsson, B., and Martinou, J.-C. (1999) J. Cell Biol. 144, 891-901[Abstract/Free Full Text]
  4. Wei, M. C., Lindsten, T., Mootha, V. K., Weiler, S., Gross, A., Ashiya, M., Thompson, C. B., and Korsmeyer, S. J. (2000) Genes Dev. 14, 2060-2070[Abstract/Free Full Text]
  5. Wei, M. C., Zong, W.-X., Cheng, E. H.-Y., Lindsten, T., Panoutsakopoulou, V., Ross, A. J., Roth, K. A., MacGregor, G. R., Thompson, C. B., and Korsmeyer, S. J. (2001) Science 292, 727-730[Abstract/Free Full Text]
  6. Cheng, E.H.-Y.A., Wei, M. C., Weiler, S., Flavell, R. A., Mak, T. W., Lindsten, T., and Korsmeyer, S. J. (2001) Mol. Cell 8, 705-711[CrossRef][Medline] [Order article via Infotrieve]
  7. Zong, W.-X., Lindsten, T., Ross, A. J, MacGregor, G. R., and Thompson, C. B. (2001) Genes Dev. 15, 1481-1486[Abstract/Free Full Text]
  8. Green, D. R. (2000) Cell 102, 1-4[CrossRef][Medline] [Order article via Infotrieve]
  9. Strasser, A., O'Connor, L., and Dixit, V. M. (2000) Annu. Rev. Biochem. 69, 217-245[CrossRef][Medline] [Order article via Infotrieve]
  10. Li, H., Zhu, H., Xu, C.-J., and Yuan, J. (1998) Cell 94, 491-501[CrossRef][Medline] [Order article via Infotrieve]
  11. Luo, X., Budihardjo, I., Zou, H., Slaughter, C., and Wang, X. (1998) Cell 94, 481-490[CrossRef][Medline] [Order article via Infotrieve]
  12. Eskes, R., Desagher, S., Antonsson, B., and Martinou, J. C. (2000) Mol. Cell. Biol. 20, 929-935[Abstract/Free Full Text]
  13. Brady, H. J., Salomons, G. S., Bobeldijk, R. C., and Berns, A. J. (1996) EMBO J. 15, 1221-1230[Medline] [Order article via Infotrieve]
  14. Clohessy, J. G., Zhuang, J., and Brady, H. J. M. (2004) Br. J. Haematol. 125, 655-665[CrossRef][Medline] [Order article via Infotrieve]
  15. Perez, D., and White, E. (2000) Mol. Cell 6, 53-63[CrossRef][Medline] [Order article via Infotrieve]
  16. Zhuang, J., Ren, Y., Snowden, R. T., Zhu, H., Gogvadze, V., Savill, J. S., and Cohen, G. M. (1998) J. Biol. Chem. 273, 15628-15632[Abstract/Free Full Text]
  17. Nijhawan, D., Fang, M., Traer, E., Zhong, Q., Gao, W., Du, F., and Wang, X. (2003) Genes Dev. 17, 1475-1486[Abstract/Free Full Text]
  18. Wang, K., Yin, X. M., Chao, D. T., Milliman, C. L., and Korsmeyer, S. J. (1996) Genes Dev. 10, 2859-2869[Abstract/Free Full Text]
  19. Okita, H., Umezawa, A., Suzuki, A., and Hata, J.-i. (1998) Biochim. Biophys. Acta. 1398, 335-341[Medline] [Order article via Infotrieve]
  20. Cheng, E. H.-Y., Levine, B., Boise, L. H., Thompson, C. B., and Hardwick, J. M. (1996) Nature 379, 554-556[CrossRef][Medline] [Order article via Infotrieve]
  21. Yin, X.-M., Oltvai, Z. N., and Korsmeyer, S. J. (1996) Nature 369, 321-323
  22. Zha, H., Aime-Sempe, C., Sato, T., and Reed, J. C. (1996) J. Biol. Chem. 271, 7440-7444[Abstract/Free Full Text]
  23. Cuconati, A., Mukherjee, C., Perez, D., and White, E. (2003) Genes Dev. 17, 2922-2932[Abstract/Free Full Text]
  24. Leu, J. I.-J., Dumont, P., Hafey, M., Murphy, M. E., and George, D. L. (2004) Nat. Cell Biol. 6, 443-450[CrossRef][Medline] [Order article via Infotrieve]
  25. Harper, N., Farrow, S. N., Kaptein, A., Cohen, G. M., and MacFarlane, M. (2001) J. Biol. Chem. 276, 34743-34752[Abstract/Free Full Text]
  26. Seol, D.-W., Li, J., Seol, M.-H., Park, S.-Y., Talanian, R. V., and Billiar, T. R. (2001) Cancer Res. 61, 1138-1143[Abstract/Free Full Text]
  27. Yin, X.-M., Wang, K., Gross, A., Zhao, Y., Zinkel, S., Klocke, B., Roth, K. A., and Korsmeyer, S. J. (1999) Nature 400, 886-891[CrossRef][Medline] [Order article via Infotrieve]
  28. Weng, C., Li, Y., Yu, D., Shi, Y., and Tang, H. (2005). J. Biol. Chem. 280, 10491-10500[Abstract/Free Full Text]
  29. Letai, A., Bassik, M. C., Walensky, L. D., Sorcinelli, M. D., Weiler, S., and Korsmeyer, S. J. (2002) Cancer Cell 2, 183-192[CrossRef][Medline] [Order article via Infotrieve]
  30. Scorrano, L., and Korsmeyer, S. J. (2003) Biochem. Biophys. Res. Commun. 304, 437-444[CrossRef][Medline] [Order article via Infotrieve]
  31. Willis, S. N., Chen, L., Dewson, G., Wei, A., Naik, E., Fletcher, J. I., Adams, J. M., and Huang, D. C. S. (2005) Genes Dev. 19, 1294-1305[Abstract/Free Full Text]
  32. Opferman, J. T., Letai, A., Beard, C., Sorcinelli, M. D., Ong, C. C., and Korsmyer, S. J. (2003) Nature 426, 671-676[CrossRef][Medline] [Order article via Infotrieve]
  33. Han, J., Goldstein, L. A., Gastman, B. R., Froelich, C. J., Yin, X.-M., and Rabinnowich, H. (2004) J. Biol. Chem. 279, 22020-22029[Abstract/Free Full Text]
  34. Chen, L., Wills, S. N., Wei, A., Smith, B. J., Fletcher, J. I., Hinds, M. G., Coleman, P. M., Day, C. L., Adams, J. M., and Huang, D. C. S. (2005) Mol. Cell 17, 393-403[CrossRef][Medline] [Order article via Infotrieve]
  35. Kuwana, T., Bouchier-Hayes, L., Chipuk, J. C., Bonzon, C., Sullivan, B. A., Green, D. R., and Newmeyer, D. D. (2005) Mol. Cell 17, 525-535[CrossRef][Medline] [Order article via Infotrieve]
  36. Taniai, M., Grambihler, A., Higuchi, H., Werneburg, N., Bronk, S. F., Farrugia, D. J., Kaufmann, S. H., and Gores, G. J. (2004) Cancer Res. 64, 3517-3524[Abstract/Free Full Text]
  37. Schulze-Bergkamen, H., Brenner, D., Krueger, A., Suess, D., Fas, S. C., Freym C. R., Dax, A., Zink, D., Buchler, P., Muller, M., and Krammer, P. H. (2004) Hepatology 39, 645-654[CrossRef][Medline] [Order article via Infotrieve]
  38. Wang, S., and El-Deiry, W. S. (2003) Oncogene. 22, 8628-8633[CrossRef][Medline] [Order article via Infotrieve]
  39. Kozopas, K. M., Yang, T., Buchan, H. L., Zhou, P., and Craig, R. W. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3516-3520[Abstract/Free Full Text]
  40. Krajewski, S., Bodrug, S., Gascoyne, R., Berean, K., Krajewska, M., and Reed, J. C. (1994) Am. J. Pathol. 145, 515-525[Abstract]
  41. Krajewski, S., Bodrug, S., Krajewska, M., Shabaik, A., Gascoyne, R., Berean, K., and Reed, J. C. (1995) Am. J. Pathol. 146, 1309-1319[Abstract]
  42. Rinkenberger, J. L., Horning, S., Klocke, B., Roth, K., and Korsmeyer, S. J. (2000) Genes Dev. 14, 23-27[Abstract/Free Full Text]
  43. Epling-Burnette, P. K., Zhong, B., Bai, F., Jiang, K., Bailey, R. D., Garcia, R., Jove, R., Djeu, J. Y., Loughran, T. P. Jr., and Wei, S. (2001) J. Immunol. 166, 7486-7495[Abstract/Free Full Text]
  44. Edwards, S. W., Derouet, M., Howse, M., and Moots, R. J. (2004) Biochem. Soc. Trans. 32, 489-492[CrossRef][Medline] [Order article via Infotrieve]
  45. Nagata, S. (1999) Annu. Rev. Genet. 33, 29-55[CrossRef][Medline] [Order article via Infotrieve]
  46. Marsden, V. S., and Strasser, A. (2003) Annu. Rev. Immunol. 21, 71-105[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J Mol EndocrinolHome page
M. Pietrzak and M. Puzianowska-Kuznicka
Triiodothyronine utilizes phosphatidylinositol 3-kinase pathway to activate anti-apoptotic myeloid cell leukemia-1
J. Mol. Endocrinol., September 1, 2008; 41(3): 177 - 186.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
S. Jamil, S. Mojtabavi, P. Hojabrpour, S. Cheah, and V. Duronio
An Essential Role for MCL-1 in ATR-mediated CHK1 Phosphorylation
Mol. Biol. Cell, August 1, 2008; 19(8): 3212 - 3220.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
M. Lu, A. Strohecker, F. Chen, T. Kwan, J. Bosman, V. C. Jordan, and V. L. Cryns
Aspirin Sensitizes Cancer Cells to TRAIL-Induced Apoptosis by Reducing Survivin Levels
Clin. Cancer Res., May 15, 2008; 14(10): 3168 - 3176.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
X. Wang, W. Chen, W. Zeng, L. Bai, Y. Tesfaigzi, S. A. Belinsky, and Y. Lin
Akt-mediated eminent expression of c-FLIP and Mcl-1 confers acquired resistance to TRAIL-induced cytotoxicity to lung cancer cells
Mol. Cancer Ther., May 1, 2008; 7(5): 1156 - 1163.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
J. Zhou, M. Liu, Y. Zhai, and W. Xie
The Antiapoptotic Role of Pregnane X Receptor in Human Colon Cancer Cells
Mol. Endocrinol., April 1, 2008; 22(4): 868 - 880.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
E. W. Bradley, M. M. Ruan, and M. J. Oursler
Novel Pro-survival Functions of the Kruppel-like Transcription Factor Egr2 in Promotion of Macrophage Colony-stimulating Factor-mediated Osteoclast Survival Downstream of the MEK/ERK Pathway
J. Biol. Chem., March 21, 2008; 283(12): 8055 - 8064.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
F.-T. Liu, S. G. Agrawal, J. G. Gribben, H. Ye, M.-Q. Du, A. C. Newland, and L. Jia
Bortezomib blocks Bax degradation in malignant B cells during treatment with TRAIL
Blood, March 1, 2008; 111(5): 2797 - 2805.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
B. S. Prabhakar, N. Mulherkar, and K. V. Prasad
Role of IG20 Splice Variants in TRAIL Resistance
Clin. Cancer Res., January 15, 2008; 14(2): 347 - 351.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
N. Chetoui, K. Sylla, J.-V. Gagnon-Houde, C. Alcaide-Loridan, D. Charron, R. Al-Daccak, and F. Aoudjit
Down-Regulation of Mcl-1 by Small Interfering RNA Sensitizes Resistant Melanoma Cells to Fas-Mediated Apoptosis
Mol. Cancer Res., January 1, 2008; 6(1): 42 - 52.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
F. Meslin, A. Hamai, P. Gao, A. Jalil, N. Cahuzac, S. Chouaib, and M. Mehrpour
Silencing of Prion Protein Sensitizes Breast Adriamycin-Resistant Carcinoma Cells to TRAIL-Mediated Cell Death
Cancer Res., November 15, 2007; 67(22): 10910 - 10919.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X. W. Meng, S.-H. Lee, H. Dai, D. Loegering, C. Yu, K. Flatten, P. Schneider, N. T. Dai, S. K. Kumar, B. D. Smith, et al.
MCL-1 as a Buffer for Proapoptotic BCL-2 Family Members during TRAIL-induced Apoptosis: A MECHANISTIC BASIS FOR SORAFENIB (BAY 43-9006)-INDUCED TRAIL SENSITIZATION
J. Biol. Chem., October 12, 2007; 282(41): 29831 - 29846.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
R. R. Rosato, J. A. Almenara, S. Coe, and S. Grant
The Multikinase Inhibitor Sorafenib Potentiates TRAIL Lethality in Human Leukemia Cells in Association with Mcl-1 and cFLIPL Down-regulation
Cancer Res., October 1, 2007; 67(19): 9490 - 9500.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
N. W. Werneburg, M. E. Guicciardi, S. F. Bronk, S. H. Kaufmann, and G. J. Gores
Tumor Necrosis Factor-related Apoptosis-inducing Ligand Activates a Lysosomal Pathway of Apoptosis That Is Regulated by Bcl-2 Proteins
J. Biol. Chem., September 28, 2007; 282(39): 28960 - 28970.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
J. Cheng, R. Cui, C.-H. Chen, and J. Du
Oxidized Low-Density Lipoprotein Stimulates p53-Dependent Activation of Proapoptotic Bax Leading to Apoptosis of Differentiated Endothelial Progenitor Cells
Endocrinology, May 1, 2007; 148(5): 2085 - 2094.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
R. M. Mohammad, A. S. Goustin, A. Aboukameel, B. Chen, S. Banerjee, G. Wang, Z. Nikolovska-Coleska, S. Wang, and A. Al-Katib
Preclinical Studies of TW-37, a New Nonpeptidic Small-Molecule Inhibitor of Bcl-2, in Diffuse Large Cell Lymphoma Xenograft Model Reveal Drug Action on Both Bcl-2 and Mcl-1
Clin. Cancer Res., April 1, 2007; 13(7): 2226 - 2235.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Chen, Y. Dai, H. Harada, P. Dent, and S. Grant
Mcl-1 Down-regulation Potentiates ABT-737 Lethality by Cooperatively Inducing Bak Activation and Bax Translocation
Cancer Res., January 15, 2007; 67(2): 782 - 791.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
A. B. Gustafsson and R. A. Gottlieb
Bcl-2 family members and apoptosis, taken to heart
Am J Physiol Cell Physiol, January 1, 2007; 292(1): C45 - C51.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
281/9/5750    most recent
M505688200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Clohessy, J. G.
Right arrow Articles by Brady, H. J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Clohessy, J. G.
Right arrow Articles by Brady, H. J. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement