Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M507871200 on December 26, 2005

J. Biol. Chem., Vol. 281, Issue 9, 5811-5820, March 3, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/9/5811    most recent
M507871200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, W.
Right arrow Articles by Mende, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, W.
Right arrow Articles by Mende, U.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Selective Loss of Fine Tuning of Gq/11 Signaling by RGS2 Protein Exacerbates Cardiomyocyte Hypertrophy*

Wei Zhang1, Thomas Anger1, Jialin Su1, Jianming Hao, Xiaomei Xu, Ming Zhu, Agnieszka Gach, Lei Cui, Ronglih Liao, and Ulrike Mende2

From the Cardiovascular Division, Brigham and Women's Hospital and Harvard Medical School, Boston, Massachusetts 02115

Received for publication, July 20, 2005 , and in revised form, December 14, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Alterations in cardiac G protein-mediated signaling, most prominently Gq/11 signaling, are centrally involved in hypertrophy and heart failure development. Several RGS proteins that can act as negative regulators of G protein signaling are expressed in the heart, but their functional roles are still poorly understood. RGS expression changes have been described in hypertrophic and failing hearts. In this study, we report a marked decrease in RGS2 (but not other major cardiac RGS proteins (RGS3-RGS5)) that occurs prior to hypertrophy development in different models with enhanced Gq/11 signaling (transgenic expression of activated G{alpha}q* and pressure overload due to aortic constriction). To assess functional consequences of selective down-regulation of endogenous RGS2, we identified targeting sequences for effective RGS2 RNA interference and used lipid-based transfection to achieve uptake of fluorescently labeled RGS2 small interfering RNA in >90% of neonatal and adult ventricular myocytes. Endogenous RGS2 expression was dose-dependently suppressed (up to 90%) with no major change in RGS3-RGS5. RGS2 knockdown increased phenylephrine- and endothelin-1-induced phospholipase Cbeta stimulation in both cell types and exacerbated the hypertrophic effect (increase in cell size and radiolabeled protein) in neonatal myocytes, with no major change in Gq/11-mediated ERK1/2, p38, or JNK activation. Taken together, this study demonstrates that endogenous RGS2 exerts functionally important inhibitory restraint on Gq/11-mediated phospholipase Cbeta activation and hypertrophy in ventricular myocytes. Our findings point toward a potential pathophysiological role of loss of fine tuning due to selective RGS2 down-regulation in Gq/11-mediated remodeling. Furthermore, this study shows the feasibility of effective RNA interference in cardiomyocytes using lipid-based small interfering RNA transfection.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Myocardial hypertrophy accompanies many forms of heart disease and develops in response to hemodynamic stress (such as pressure or volume overload), loss of contractile proteins after cardiac injury, or mutations in sarcomeric proteins. Many different stimuli and signaling pathways have been implicated in hypertrophy development (1). Among them, signaling events that are mediated by heterotrimeric Gq/11 proteins are of central importance (2).

Gq/11 proteins are members of a protein family that transduces signals from many different G protein-coupled receptors (GPCRs)3 to generate diverse effects on myocyte growth, contractility, and heart rate (3). G proteins are subject to direct regulation by RGS (Regulators of G protein Signaling) proteins, which shorten the duration of the cellular response to external signals and generally cause a reduction in hormone sensitivity (4). Whereas their primary mode of action is acceleration of signal termination by decreasing the lifetime of active, GTP-bound G{alpha} subunits, some RGS can also block signal generation by antagonizing G{alpha}-mediated effector activation (5). Thus, RGS proteins are believed to play an important role in fine tuning GPCR-induced signal transduction.

Several RGS proteins are expressed in the heart, but their exact roles in the normal and diseased heart are still poorly defined (6). Most cardiac RGS proteins belong to the B/R4 family of "small" RGS proteins that primarily consist of the G{alpha}-binding RGS homology domain and short extensions (7). They are mostly nondiscriminatory toward members of the Gq/11 and Gi/o subfamilies in vitro but tend to display greater specificity in intact cells (8). Myocardial expression studies to date have been restricted to a few RGS proteins and hearts that were already hypertrophic and/or failing (9-11). At that stage, a multitude of signaling changes occur, many of which are probably secondary to the remodeling process.

The first goal of the present study was to test the hypothesis that changes in the ventricular amount of Gq/11-regulating RGS proteins may precede hypertrophic remodeling and could therefore potentially be of pathophysiological significance. An increase in Gq/11-regulating RGS protein(s) would be expected to attenuate Gq/11 signaling and could thereby blunt or delay Gq/11-mediated hypertrophy, whereas conversely a decrease in RGS could exacerbate Gq/11 signaling and have a deleterious effect. We focused on RGS proteins that have been consistently detected in cardiac tissue (9, 11) and myocytes (12, 13), namely RGS2, RGS3, RGS4, and RGS5. Since RGS16 has been reported to be highly inducible in cardiac myocytes (13), it was also included in this analysis. RGS mRNA expression was examined in two different models with enhanced Gq/11 signaling: (i) transgenic mice expressing constitutively active G{alpha}qQ209L (G{alpha}q*) (14), in which enhanced G{alpha}q signaling is restricted to myocytes until remodeling eventually affects signaling in nonmyocytes as well, and (ii) pressure overload hypertrophy in response to aortic banding, because its dependence on Gq/11 signaling is well recognized (15, 16). Importantly, in contrast to existing studies, we examined RGS expression over time, with a special focus on changes that occur early on, and observed a selective reduction in RGS2 protein and mRNA expression in both models prior to hypertrophy initiation.

In the second part of the study, we tested the hypothesis that endogenous RGS2 inhibits Gq/11-mediated signaling and hypertrophy in cardiac myocytes and determined whether or not selective RGS2 knock-down has functional implications despite the presence of other RGS proteins with potentially overlapping function. In order to achieve that goal, we identified targeting sequences that allowed for effective and selective RNA interference (RNAi) of endogenous RGS2 and established experimental conditions for RNAi in cultured cardiac myocytes. RNAi has evolved in recent years as a powerful approach to decode gene function of endogenous proteins. It describes a phenomenon by which double-stranded RNA induces potent and specific inhibition of eukaryotic gene expression via the degradation of complementary mRNA (17, 18).


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
In Vivo Models of Hypertrophy—The generation and respective phenotypes of two independent transgenic mouse lines with heart-specific expression of constitutively active G{alpha}q* have been described elsewhere (14, 19, 20). Pressure overload was induced by ascending aortic constriction in 2.5-month-old FVB mice for 8 weeks as described (21). All experimental protocols were reviewed and approved by the institutional animal care and use committee. Additional information on RGS expression in response to pressure overload hypertrophy due to ascending aortic constriction was obtained.4

Northern Blot Analysis—Total ventricular RNA (RNAzol B; TelTest) was extracted from mouse ventricular tissue, size-fractionated (10 µg/lane), and transferred to nylon membranes that were incubated with 32P-labeled cRNA probes (Strip-EZTM SP6/T7; Ambion) for RGS2, RGS4, and RGS5, random-primed 32P-labeled (Prime-It®II; Stratagene) ANF and GAPDH cDNA probes, and an 18 S oligonucleotide probe that had been labeled with [{gamma}-32P]ATP by T4 polynucleotide kinase (Gibco). The RGS mRNA transcripts sizes were 1.5/1.8 kb (RGS2), 3.3 kb (RGS4), and 4.4 kb (RGS5) with no other bands detectable. Blots were exposed to x-ray film followed by quantitative densitometry. Data were normalized to GAPDH or 18 S rRNA.

Reverse Transcription (RT) PCR—Total RNA (1 µg) extracted from ventricular tissue or myocytes of G{alpha}q*-expressing and aortic banded mice was reverse transcribed (Thermo-ScriptTM RT; Invitrogen) and amplified (HotStarTaq DNA PolymeraseTM; Qiagen) with primers specific for mouse RGS2-RGS5 and GAPDH (RGS2(F), CTGAGAATGCAAAGTGCCATGTTCCTGGCT; RGS2(R), GGTCTCATGTAGCATGGGGCTCCGTGGTGA; RGS3(F), GCCTCTGACACCACCTTACACTGCTCTGAT; RGS3(R), CTAGGGACCACCAGTATCCAGCTCAGCGTT; RGS4(F), CAGAAGTCAGATTCCTGCGAACACAGTTC; RGS4(R), TGTGTGAGAATTAGGCACACTGGGAGACCA; RGS5(F), ATCAAGATCAAGTTGGGAATTCTCCTCCAG; RGS5(R), GCTCCTTATAAAATTCAGAGCGCACAAAGC; GAPDH (F), ATGGTGAAGGTCGGTGTGAACGGATTTGGC; GAPDH(R), AGGTCCACCACCCTGTTGCTGTAGCCGTAT. Quantitative densitometry was performed on ethidium bromide-stained agarose gels. Respective transcript sizes were 645 bp (RGS2), 752 bp (RGS3), 546 bp (RGS4), 480 bp (RGS5), 973 bp (GAPDH).

RT-PCR in RGS2-silenced rat cardiomyocytes was performed on total RNA (RNeasy Mini Kit; Qiagen), using the Superscript One-step RT-PCR kit (Invitrogen) with the following primers: RGS2(F), ATGCAAAGTGCCATGTTCCTGG; RGS2(R), TCATGTAGCATGGGGCTCCG; RGS3(F), CTGGAAAAGCTGCTGCTTCATA; RGS3(R), GACTCATCTTCTTCTGGTTAATG; RGS4(F), ATGTGCAAAGGACTCGCTGGT; RGS4(R), TCAGGCACACTGAGGGACTAGG; RGS5(F), GGAAAGGGCCAAAGAGATCAAG; RGS5(R), CTCCTTATAAAACTCAGAGCGC; GAPDH(F), AGTGGATATTGTTGCCATCAATG; GAPDH(R), CCATGAGGTCCACCACCCTG. Respective transcript sizes were 636 bp (RGS2), 345 bp (RGS3), 618 bp (RGS4), 496 bp (RGS5), and 830 bp (GAPDH).

Real Time PCR—Reverse transcribed (TaqMan Reverse Transcription Reagents; Applied Biosystems) RNA samples from neonatal and adult rat ventricular myocytes (Trizol; Invitrogen) were subjected to PCR using FAMTM-labeled Taqman® MGB probes for RGS2-RGS5 and 18 S and TaqMan® Universal PCR master mix (Applied Biosystems) according to the manufacturer's instructions. Each sample was assayed in two independent RT reactions and duplicate reactions each and normalized to 18 S expression. Negative controls included the absence of enzyme in the RT reaction and absence of template during PCR. The PCR cycling was performed at 95 °C for 10 min and then 95 °C for 15 s and 60 °C for 1 min for a total of 45 cycles. The cycle threshold (CT) values corresponding to the PCR cycle number at which fluorescence emission in real time reaches a threshold above the base-line emission were determined using ABI Prism® 7700 software. For quality control, serial dilutions of cDNA plasmids for rat RGS2-RGS5 (0.3-3 x 106 copies) were tested, and the linearity of the resulting CT values was confirmed for RGS2 and RGS5 but not RGS3 or RGS4. Relative mRNA expression levels were therefore assessed by real time PCR for RGS2 and RGS5 only.

CardioGenomics Microarray Data Base—The data base4 was mined for information on RGS mRNA expression in response to aortic constriction. Signals from each chip (Affymetrix MG-U74) were subjected to linear normalization and analyzed with the Affymetrix Microarray Suite 5 algorithm. Similar results were obtained upon additional nonlinear normalization at the probe level (data not shown).

Western Blot Analysis—HEK-293 cells and neonatal ventricular myocytes (NVM) were lysed in 1x lysis buffer (Cell Signaling Technology) with protease inhibitor mixture (Roche Applied Science) for 30 min at 4 °C and sonicated for 3 x 5 s (NVM only). Ventricular tissue was homogenized on ice in 50 mM Tris-HCl (pH 7.6), 6 mM MgCl2, 75 mM sucrose, 1 mM dithiothreitol, 1 mM EDTA plus proteinase inhibitor mixture with a hand-held tissue tearer (five bursts of 10 s at 8000-10,000 rpm). Protein was measured using the DC Protein Assay kit (Bio-Rad) with bovine serum albumin as a standard. Equal amounts of protein per lane were separated on 4-12% SDS-polyacrylamide (Tris/glycine) gels and transferred to nitrocellulose membranes (Protran; Schleicher and Schuell). After transfer, the membranes were stained with Ponceau S to confirm equal loading and even transfer efficiency, blocked in phosphate-buffered saline (PBS) containing 5% nonfat dry milk, and probed with monoclonal antibodies against the FLAG epitope (M2, 10 µg/ml; Sigma), GAPDH (0.5 µg/ml, Ambion), and caveolin-3 (1:5000; Transduction Laboratories) as well as polyclonal antibodies against the C terminus of RGS2 (CKKPQITTEPHAT; 1:1000; gift from Drs. B. Blake and D. P. Siderovski, University of North Carolina), G{alpha}q/11 (C-19), PLCbeta1 (G-12), and PLCbeta3 (C-20; 1;500 each; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). After three washes with PBS containing 0.1% Tween 20 and incubation with appropriate peroxidase-coupled secondary antibodies, proteins of interest were visualized by chemiluminescence (SuperSignal® West Pico Substrate; Pierce) using horseradish-conjugated secondary antibodies (ImmunoPure®; Pierce).

Detection of endogenous RGS proteins by Western blot analysis is notoriously difficult due to their low abundance. To increase the protein amount loaded, particulate and soluble proteins from ventricular tissue were extracted by ultracentrifugation (50,000 x g for 30 min at 4 °C), separated on 15% SDS-PAGE (60 µg/lane), and immunoblotted as described above. Only one of five RGS2 antibodies tested recognized endogenous ventricular RGS2 protein by enhanced chemiluminescence (Fig. 1D). It recognized a double band in the appropriate molecular weight range that had a slightly faster mobility than His6-tagged RGS2 (provided by Dr. C. W. Dessauer (University of Texas Health Science Center at Houston); data not shown) and was absent in crude homogenates of brain cortex (provided by Dr. D. P. Siderovski (University of North Carolina)) from RGS2 knock-out (KO) mice. It is conceivable that the two bands reflect the presence of alternative splice forms or posttranslational modifications. Importantly, RGS2 was reduced in the particulate fraction from {alpha}q*52 ventricles compared with wild type (see Fig. 1D). Due to low signal intensity, expression of soluble RGS2 protein could not be reliably assessed (data not shown). Only two of the other four RGS2 antibodies tested also recognized protein in the appropriate molecular weight range. However, the fact that the corresponding bands were still present in samples lacking RGS2, suggested cross-reaction with other proteins.

Generation of RGS2 RNAi Expression Plasmid and siRNA—RNA interference target sequences were selected using a publicly available algorithm (Ambion pSilencer insert design tool). Selection criteria were as follows: (i) sequence starting with AA, (ii) GC content of ≤50%, preferably 30-50%, (iii) avoidance of a ≥4 contiguous run of any nucleotide, and (iv) BLAST against the appropriate genome to avoid excessive homology to other genes, avoiding ≥15-nucleotide contiguous 100% homology or ≥17-nucleotide interrupted homology. The target sequences tested were as follows: sequence 1, AATGAAGCGGACACTCTTAAA; sequence 2, AAATATGGGCTTGCTGCATTC; sequence 3, AACCAAATCACCACAGAAACT; sequence 4, AAGGAAAATATACACCGACTT; sequence 5, AATATCCAAGAGGCTACAAGT; sequence 6, AACAACTCTTATCCTCGTTTC.

A pair of complementary oligonucleotides encoding a short hairpin (shRNA) sequence (sense and antisense target sequence separated by a 9-nucleotide loop sequence) plus BamHI and HindIII restriction sites at the ends were synthesized, annealed, and subcloned into a plasmid (pSilencer 3.0-H1 vector; Ambion) at the BamHI and HindIII restriction sites between a human H1 RNA polymerase III promoter and a RNA polymerase III terminator sequence. pSilencer plasmids containing siRNA hairpin sequences of GAPDH or without significant homology to any known rat gene (Ambion) were used as positive and negative controls, respectively. Inserted sequences were confirmed by restriction enzyme digestion and DNA sequencing. In addition, siRNAs corresponding to the shRNA sequences were synthesized and high pressure liquid chromatography-purified by Ambion.

Cell Culture and Transfection—HEK-293 cells were maintained in DMEM containing 10% fetal bovine serum and antibiotics and transfected using Lipofectamine 2000 following the instructions of the manufacturer (Invitrogen). Lipofectamine 2000 was first diluted in OPTI-MEM I (Invitrogen) and then mixed with plasmid DNA or siRNA at the indicated amounts. The ratio (w/w) between Lipofectamine 2000 and DNA or RNA was 4:1 or 3.7:1, respectively. One and 2 ml of medium/well were used for 12- and 6-well plates, respectively. Following a 20-min incubation at room temperature, the DNA- or RNA-Lipofectamine 2000 mixture was added to antibiotics-free transfection medium (DMEM containing glutamine plus 10% fetal bovine serum) and replaced cell culture medium. The cells were maintained in a 37 °C incubator with 95% O2, 5% CO2 until analysis. The medium was changed to medium with no DNA or siRNA 24 h after transfection.

Cardiomyocyte Isolation—NVM were isolated from 2-day-old Sprague-Dawley rats by enzymatic digestion (23), separated from non-muscle cells on a discontinuous Percoll gradient (24), and plated in serum-containing DMEM (4 x 105 cells/well of a 6-well dish). Adult ventricular myocytes (AVM) were isolated from male Sprague-Dawley rats (200-300 g) by collagenase II digestion using Langendorff perfusion (25) and plated on laminin-coated 6-well dishes (2 x 105 cells/well) in Medium 199 supplemented with 2 mg/ml bovine serum albumin, 2 mM L-carnitine, 5 mM creatine, 5 mM taurine, 0.1 µM insulin (ACCTI "defined culture medium" (26).

Cardiomyocyte siRNA Transfection—AVM and NVM were transfected with siRNA 1 or 2 days after isolation, respectively, in the same way as HEK-293 cells (see above), albeit in different media. For NVM, the transfection medium was composed of DMEM, 2 mM glutamine, and 2% fetal bovine serum. The transfection medium was replaced with serum-free DMEM containing 2 mM glutamine, 1x ITS Liquid Media Supplement (Sigma), and penicillin/streptomycin 24 h after transfection. For AVM, the transfection medium was identical to the ACCTI culture medium and was replaced with fresh ACCTI culture medium 24 h after transfection.

Fluorescent Labeling of RGS2 siRNA—RGS2 siRNA (5 µg) was labeled with fluorescin (FAM)-labeling reagent (SilencerTM labeling kit; Ambion) for 1 h at 37°C in the dark according to the manufacturer's instructions and then precipitated by ethanol. Increasing concentrations (0-50 nM) of FAM-labeled RGS2 siRNA were transfected into NVM as described above, and cellular siRNA uptake was documented by fluorescent microscopy.

Immunofluorescent Staining—Immunofluorescent staining in HEK293 cells and cardiomyocytes was performed as previously described (27). In brief, cells were fixed in a solution containing 4% paraformaldehyde, 0.9% NaCl, and 0.1 M NaH2PO4 (pH 7.4) for 15 min at room temperature. After permeabilization with 0.1% Triton X-100 in PBS for 15 min at room temperature, nonspecific binding sites were blocked with 3% bovine serum albumin in PBS for 2 h at room temperature or overnight at 4 °C. They were then incubated in 1% bovine serum albumin/PBS containing mouse monoclonal antibodies against myosin (MF-20, 1:100 dilution; Developmental Studies Hybridoma Bank) or the FLAG epitope (M2, 1:1000; Sigma), followed by incubation with rhodamine- or fluorescein-conjugated secondary antibodies (goat anti-mouse from Pierce (1:200) and goat anti-rabbit from Amersham Biosciences (1:50), respectively), each for 1.5 h at room temperature.

Phospholipase Cbeta Activity—Total inositol phosphate formation was measured as a surrogate parameter for PLCbeta activity as described (19). Briefly, 24 h after siRNA infection, NVM and AVM were labeled in inositol-free medium supplemented with myo-[3H]inositol (2 µCi/well, 15 Ci/mmol; Amersham Biosciences) overnight. The next day, LiCl (10 mM final) was added before the addition of phenylephrine (PE) plus timolol (Tim) or endothelin-1 (ET-1) at increasing concentrations. After 30 min at 37 °C, inositol phosphates were extracted in 20 mM formic acid, neutralized, separated by anion exchange chromatography (Dowex AG1-X8), and quantitated by liquid scintillation counting. Cell density was monitored for each condition. Normalization to protein amount/well yielded similar results (data not shown).

Assessment of Mitogen-activated Protein Kinase (MAPK) Activation—After siRNA transfection of NVM for 48 h, PE/Tim (1/0.1 µM) or ET-1 (10 nM) was added to the medium for the indicated incubation times (5 or 20 min). Cells were washed with PBS and lysed in 1x lysis buffer (Cell Signaling) with protease inhibitor mixture (Roche Applied Sciences) for 30 min at 4 °C and sonicated for 3 x 5 s. Equal quantities of protein lysates were separated on 12% SDS-PAGE and transferred to nitrocellulose. Nitrocellulose strips were incubated with antibodies against ERK1/2, p38, and JNK (all 1:1000; Cellular Signaling) that either recognized their respective phosphorylated forms only (9101, 9211, and 9255) or both phosphorylated and unphosphorylated MAPKs (9102, 9212, and 9252). After three washes with Tris-buffered saline containing 0.1% Tween 20 and incubation with appropriate peroxidase-coupled secondary antibodies, proteins of interest were visualized by chemiluminescence (SuperSignal® West Pico Substrate; Pierce).

Assessment of Myocyte Hypertrophy—After siRNA transfection of NVM for 48 h, PE/Tim or ET-1 was added to the medium at the indicated concentrations. After 72 h, myocyte size was assessed in MF-20-stained myocytes using ImageProPlus software (MediaCybernetics). Protein synthesis was measured in quadruplicates for each condition by continuous labeling of cell protein with [14C]phenylalanine (0.05 µCi/ml, >450 mCi/mmol; ICN) during treatment with Gq/11-coupled receptor agonists (23). On the day of the assay, cells were washed with PBS, followed by precipitation of cellular protein with 10% trichloroacetic acid for atleast 1 h at 4 °C. Cellular proteins were washed once with 10% trichloroacetic acid, solubilized in 1% SDS for 1 h at 37°C, and then quantified by liquid scintillation counting.

Statistical Analyses—Data are reported as mean ± S.E. for n determinations or mean ± range of duplicate determinations, as indicated. Each assay is representative of at least two additional independent assays. Statistical differences were assessed where appropriate by unpaired, two-tailed Student's t test or 2-way analysis of variance followed by Bonferroni post-tests for comparison of individual means (GraphPad Prism 4). p values smaller than 0.05 were considered statistically significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Expression of Endogenous RGS Proteins in Hearts with Enhanced Gq/11 Signaling—Using Northern blot analysis and RT-PCR, we examined mRNA expression of the major cardiac RGS proteins in two different models of Gq/11-mediated hypertrophy, both prior to and during hypertrophic remodeling.

Transgenic Mice with Heart-restricted G{alpha}q* Expression—We previously reported that G{alpha}q* expression in vivo constitutively elevates cardiac PLCbeta activity (14, 19) and provided a detailed phenotypic characterization (ventricular weights and hypertrophic marker gene expression, echocardiography, and signaling changes) of two independent lines ({alpha}q*52 and {alpha}q*44h (20)). We reported that mice from both lines develop the same end stage phenotype (cardiac dilation with premature death in heart failure) with a similar rate of disease progression (within 2-3 months) but a very different time of disease onset (~9 months later in {alpha}q*44h). For the present study, time points were chosen that span the entire time frame from normal morphology to hypertrophy, dilation, and failure in each line (Fig. 1). Mice from line {alpha}q*52 were examined at 0.5 months of age (when cardiac PLCbeta activity is increased but ventricular weight and ANF (see Fig. 1B) or beta-myosin heavy chain expression are not yet significantly increased and the histology is still indistinguishable from age-matched wild types (indicated by gray bars in Fig. 1A)) and at 2.5 months of age (when {alpha}q*52 mice re-express embryonic marker genes (see Fig. 1B) and have a markedly increased ventricular weight and chamber diameter and significantly impaired fractional shortening (indicated by the black bars in Fig. 1A)). Mice from line {alpha}q*44 were examined between 0.5 and 14 months of age. Because of the late disease onset (at ~10-12 months of age) but rapid disease progression toward the end-stage phenotype within 2-3 months (see Ref. 20 for details), 12-14-month-old {alpha}q*44h mice were grouped into mice that were primarily still in their "predilated" stage (gray bars) and those that had already reached "end stage" (black bars).

The most striking change in the transgenic hearts was a reduction in RGS2 mRNA by over 60% that was already detectable in the respective "predilated" stages (0.5 months in {alpha}q*52 and 6 months in {alpha}q*44; Fig. 1A). RGS2 continued to be reduced (or progressed even further) until the end stage phenotype was reached at 2.5 and 12-14 months, respectively. RGS4 and RGS5 mRNA amounts were also decreased but to a lesser degree and, importantly, only at end stage. Details on the time course of RGS2, RGS4, and RGS5 mRNA expression in wild-type ventricles (between 2 days and 18 months of age) are also shown in Fig. 1A. RGS4 and RGS5 increased between 3- and 4-fold in the first 2 weeks of life and then remained at that elevated level (RGS5) or declined after 2 months (RGS4). In contrast, RGS2 mRNA levels remained largely constant over time, suggesting a relative shift in the overall composition of cardiac RGS isoforms during development and maturation.

RGS3 and RGS16 mRNA were difficult to detect/quantify by Northern blot analysis and were therefore assessed by RT-PCR. Overall, the expression of RGS3 was quite variable among different samples but was not consistently altered in both lines (data not shown). Consistent with previous findings (13), RGS16 mRNA was barely detectable in ventricular tissue from wild-type mice and appeared not to be altered in G{alpha}q* mice (data not shown).

A Northern blot in Fig. 1B illustrates RGS2 mRNA down-regulation in {alpha}q*52 ventricles prior to and after the development of the cardiac phenotype (0.5 and 2.5 months, respectively). Importantly, it occurred in ventricular myocytes (Fig. 1C). Fig. 1D suggests that RGS2 mRNA down-regulation was accompanied by a reduction in RGS2 protein as early as 0.5 months of age (see "Experimental Procedures" concerning the difficulty in detecting endogenous RGS2 protein).

Pressure Overload Due to Aortic Constriction—RGS2 down-regulation was also observed in ventricles from mice 8 weeks after ascending aortic constriction that caused an increase in heart/body weight ratio compared with sham-operated controls (8.6 ± 1.2 versus 4.5 ± 0.1 mg/g (n = 3 each), p < 0.05). Decreased RGS2 mRNA expression levels after banding were observed by Northern blot (Fig. 2A) and RT-PCR (56 ± 5% of sham, n = 6). The other RGS proteins were not significantly altered (RGS4, 116 ± 12% of sham; RGS5, 133 ± 23% of sham (n = 6 each)) or increased by 52 ± 28% (RGS3; n = 6). Additional information on changes in RGS expression in response to pressure overload, particularly a detailed time course of events, was obtained from the CardioGenomics microarray data base.4 In that study, ascending aortic constriction led to a 40% increase in heart body weight ratio compared with control after 1 week (Fig. 2B, top)(i.e. when marked ANF induction became detectable).4 Importantly, a marked decrease in RGS2 mRNA was observed within 48 h that persisted for up to 8 weeks (Fig. 2B, middle). In contrast, RGS5 mRNA was not significantly altered in ventricles from banded mice at any time point (Fig. 2B, bottom). Probes for RGS3 and RGS4 mRNA were represented at the arrays, but their levels were either below or too close to detection limit, respectively.

RGS2 RNAi Target Sequence Identification—To determine the functional significance of selective down-regulation of endogenous RGS2 protein, we scanned the entire RGS2 coding sequence for potential RNAi target sequences (Fig. 3A) and subcloned them between a human H1 RNA polymerase III promoter and a RNA polymerase III terminator sequence for in vivo shRNA synthesis (see "Experimental Procedures" for details).

Because of low expression of endogenous RGS2 in most cell types, potential target sequences were first screened for their effectiveness in RGS2 silencing in HEK-293 cells that were co-transfected with FLAG-tagged rat RGS2 (F-RGS2). Two of them (sequences 3 (Fig. 3B) and 4 (data not shown)) reduced exogenous F-RGS2 below the detection limit by Western blot analysis. F-RGS2 levels were largely comparable in the presence or absence of the other four constructs but significantly reduced when compared with cells that had been co-transfected with plasmids encoding negative control and GAPDH shRNAs. For reasons still unknown, RGS2 expression was increased in the presence of either control plasmids, whereas GAPDH was not affected by the negative control plasmid. Consistent with a ~50% transfection efficiency in HEK-293 cells under the conditions used (Fig. 3C), GAPDH pSilencer reduced endogenous GAPDH expression by approximately half (Fig. 3, B and D). RGS2 silencing was dose-dependent and detectable by immunostaining (Fig. 3C), indicating that RGS2 shRNA was efficiently expressed and correctly processed intracellularly to generate mature and functional siRNA. Effective RGS2 suppression could also be achieved through direct introduction of synthetic siRNAs for sequences 3 and 4 (data not shown), eliminating the need for intracellular shRNA processing. Importantly, the expression of RGS3-RGS5 was largely unchanged (Fig. 3D).


Figure 1
View larger version (52K):
[in this window]
[in a new window]
  		FIGURE 1.
RGS2 mRNA and protein down-regulation in G{alpha} *q-expressing ventricles. A, bar graphs, RGS2, RGS4, and RGS5 mRNA in ventricles from wild-type (wt; open bars) and {alpha}q*52 and {alpha}q*44 mice before (gray bars) and after (black bars) they develop cardiac hypertrophy and dilation. RGS mRNA was assessed by Northern blot analysis (B) and normalized to 18 S RNA. Data represent mean ± S.E. (n = 4-9 mice in each group) and are expressed as a percentage of age-matched wild type at each time point (set at 100%). *, p < 0.05 versus age-matched wild type. Right upper panel, time course of ventricular RGS2, RGS4, and RGS5 mRNA expression in wild type mice. *, p < 0.05 versus 2 day-old (set at 1) for each RGS. B, Northern blot of ventricular RNA from 0.5- and 2.5-month-old {alpha}q*52 and wild type mice, probed with 32P-labeled RGS2 cRNA, ANF cDNA, and 18 S oligonucleotide probes. C, RT-PCR on ventricular myocyte RNA from 2.5-month-old {alpha}q*52 and wild type. D, Western blot of ventricular particulate protein (60 µg/lane) from 0.5-month-old {alpha}q*52 and wild type mice, probed with antibodies against RGS2 and muscle-specific caveolin-3 (Cav-3). Crude brain cortex homogenates from wild type and RGS2 knock-out mice (KO) served as controls.

 
RNAi to Endogenous RGS2 in Myocytes—After optimizing myocyte/siRNA/lipid carrier ratios, RGS2 RNAi was also achieved in cardiomyocytes using traditional cationic lipid-based transfection. Fig. 4A illustrates dose-dependent uptake of fluorescently labeled RGS2 siRNA in NVM 24 h after transfection that was still detectable after 4 days (data not shown). RGS2 siRNA uptake was uniform and detectable in more than 90% of cells at 30 nM. In AVM, cellular uptake of FAM-labeled siRNA was also observed but difficult to ascertain due to greater autofluorescence (data not shown). Neither neonatal (Fig. 4A) nor adult (Fig. 4B) myocytes showed apparent changes in cell viability or morphology upon siRNA transfection.


Figure 2
View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 2.
Ventricular RGS2 mRNA down-regulation after aortic constriction. A, Northern blot of ventricular RNA from mice 8 weeks after aortic constriction, probed with RGS2 and GAPDH cDNA probes. B, time course of changes in heart/body weight ratios and ventricular RGS2 and RGS5 mRNA expression after aortic constriction. Data were obtained from the CardioGenomics microarray data base4 and represent mean ± S.E. (n = 3 in each group).

 
The effectiveness of both RGS2 siRNAs in suppressing endogenous RGS2 was examined by RT-PCR (Fig. 5A) and real time PCR (Fig. 5B). RGS2 sequence 4 caused a concentration-dependent knockdown of RGS2 mRNA (by up to 90% of control at 50 nM) in both NVM and AVM, without affecting GAPDH expression. The effect of RGS2 sequence 3 was comparable (as shown for NVM) (Fig. 5A). RGS2 knock-down was observed for up to 6 days (data not shown).

Importantly, RGS3, RGS4, and RGS5 mRNA expression were largely unchanged compared with control in both NVM and AVM transfected with RGS2 sequence 4 (Fig. 5C) and sequence 3 (data not shown). Real time PCR confirmed continued expression of RGS5 in both NVM (0.9 ± 0.2-fold negative control; n = 3) and AVM (1.4 ± 0.3-fold; n = 3) upon RGS2 RNAi. FAMTM-labeled Taqman® MGB probes (Applied Biosystems) for rat RGS3 and RGS4 have not yet worked in our hands (see "Experimental Procedures"). Taken together, these results suggest that endogenous RGS2 expression could be effectively and specifically suppressed by transient siRNA transfection in cultured cardiomyocytes.


Figure 3
View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 3.
Identification of RGS2 RNAi targeting sequences. A, position of the sequences within RGS2 cDNA that were chosen for RNAi targeting. B, Western blot of HEK-293 cell lysates 48 h after transfection with rat FLAG-tagged RGS2 (F-RGS2) cDNA in the presence or absence of RGS2 pSilencer (pSil; 500 ng/ml each). Plasmids encoding GAPDH (G) or negative control (N) short hairpins were used as controls. Blots were probed with FLAG or GAPDH antibodies. C, immunofluorescent staining (top panels, anti-FLAG and rhodamine-conjugated antibodies) and bright field (bottom panels) of HEK-293 cells transfected with different amounts of pSilencer sequence 3 along with F-RGS2 cDNA (250 ng/ml) for 48 h. D, Western blots of HEK-293 cell lysates 48 h after transfection with different rat F-RGS or GAPDH cDNAs in the absence or presence of RGS2, GAPDH, or negative control pSilencer. Blots were probed with FLAG or GAPDH antibodies.

 
Effect of RNAi to Endogenous RGS2 on Gq/11-mediated Signaling—To minimize the risk for off target effects, the lowest siRNA concentration causing homogenous and widespread RGS siRNA uptake and marked RGS2 suppression (30 nM) was chosen for all subsequent functional experiments. First, we examined the response of PLCbeta, the main direct downstream target for Gq/11, to increasing concentrations of two different Gq/11-coupled receptor agonists in myocytes that had been transfected with RGS2 sequence 4 or negative control siRNA for 48 h. Silencing of endogenous RGS2 increased the maximal effect of agonist-induced PLCbeta activation in both NVM (Fig. 6A) and AVM (Fig. 6B), whereas basal PLCbeta activity was not altered. The PLCbeta activity-enhancing effects of RGS2 siRNA sequences 3 and 4 were comparable (Fig. 6C) and could not be attributed to changes in the expression of endogenous G{alpha}q/11, PLCbeta1, or PLCbeta3 (Fig. 6D).

We then assessed whether or not silencing of endogenous RGS2 also leads to enhanced Gq/11-mediated activation of MAPKs using phosphorylation-specific antibodies. As expected, short term stimulation of NVM (5 min for ERK1/2 and p38 or 20 min for JNK) with PE/Tim or ET-1 resulted in increased phosphorylation of ERK1/2, p38, and JNK(p54), suggesting increased activation of each of the three MAPK branches in response to GPCR-induced Gq/11 activation (Fig. 7). Importantly, the extent of MAPK phosphorylation was largely comparable in cells that had been transfected with RGS2 sequence 4 siRNA compared with negative control siRNA. Only in PE/Tim-treated cells, phosphorylated JNK(p54) appeared to be slightly decreased (similar results were obtained for JNK(p46), although total expression of this isoform was difficult to detect (data not shown)). Total ERK1/2, p38, and JNK(p54) expression levels were comparable at each experimental condition (Fig. 7). Silencing of endogenous RGS2 mRNA to 0.16 ± 0.02-fold negative control (n = 4, p < 0.05) was confirmed by real time PCR in transfection experiments conducted in parallel. Taken together, these findings suggest that, in contrast to PLCbeta, Gq/11-mediated MAPK activation was not enhanced upon RGS2 silencing.


Figure 4
View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 4.
RGS2 siRNA uptake in ventricular myocytes. A, fluorescent (right panels) and phase contrast (left panels) images of NVM 24 h after transfection with increasing concentrations (0-50 nM) of FAM-labeled RGS2 siRNA. The small bright dots that are visible even in the absence of siRNA transfection are due to autofluorescence from cell artifacts. B, bright field images of AVM 48 h after transfection with negative control (neg. Ctr) or RGS2 sequence 4 siRNA (30 nM).

 


Figure 5
View larger version (59K):
[in this window]
[in a new window]
  		FIGURE 5.
Effectiveness and specificity of RGS2 RNAi in ventricular myocytes. A and B, RT-PCR (A) and real time PCR (B) for RGS2 in NVM and AVM 48 h after transfection with RGS2 (sequences 3 and 4) and negative control (neg Ctr; N) siRNAs (10-50 nM). GAPDH and 18 S mRNA levels were assessed for comparison and normalization, respectively. *, p < 0.05 versus the respective negative control. C, RGS2-5 mRNA expression in NVM and AVM 48 h after transfection with RGS2 sequence 4 and negative control (N) siRNA, as assessed by RT-PCR.

 


Figure 6
View larger version (38K):
[in this window]
[in a new window]
  		FIGURE 6.
Effect of RGS2 RNAi on Gq/11-mediated PLCbeta activation in ventricular myocytes. A and B, dose response curve for PE (in the presence of Tim) and ET-1 on total inositol phosphate (IP) formation in RGS2 sequence 4 or negative control (neg. Ctr) siRNA-transfected (30 nM each) NVM (A) and AVM (B). The bars indicating ranges of duplicate determinations were smaller than the respective symbol for several experimental points. C, comparison of the effect of RGS2 siRNA sequences 3 and 4 (30 nM each) on PE/Tim (2/0.2 µM)- and ET-1 (10 nM)-induced PLCbeta activation in NVM. Data represent means and ranges of duplicate determinations. D, Western blots of G{alpha}q/11, PLCbeta1, and PLCbeta3 expression in NVM lysates (10 µg of protein/lane) 72 h after transfection with RGS2 sequence 4 and negative control siRNA. Each experiment shown is representative of at least two independent experiments.

 
Effect of RNAi to Endogenous RGS2 on Gq/11-mediated Hypertrophy—We next assessed the hypertrophic response that NVM typically assume upon Gq/11 activation (28) in cells with targeted knockdown of endogenous RGS2. In these experiments, PE/Tim and ET-1 doses were used that led to a modest increase in cell size (Fig. 8, A and B) and radiolabeled protein content (Fig. 8C) in control cells. Although there was no significant difference under base-line conditions in RGS2 siRNA sequence 4-transfected NVM compared with control cells, both Gq/11-coupled receptor agonists caused a markedly enhanced increase in cell size and protein content upon selective RGS2 down-regulation, indicating an enhanced hypertrophic response.


Figure 7
View larger version (95K):
[in this window]
[in a new window]
  		FIGURE 7.
Effect of RGS2 RNAi on Gq/11-mediated MAPK activation in ventricular myocytes. Representative Western blot analysis of agonist-induced, G{alpha}q/11-mediated phosphorylation of ERK1/2 (panel 1), p38 (panel 3), and JNK (panel 5) compared with their respective total protein expression (panels 2, 4, and 6) in cell lysates (20 µg of protein/lane) from NVM 48 h after transfection with RGS2 sequence 4 and negative control (Neg. Ctr) siRNA (30 nM each). Prior to cell lysis, NVM were incubated with PE/Tim (1/0.1 µM) or ET-1 (10 nM) for 5 min (ERK1/2, p38) or 20 min (JNK).

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
This study revealed that endogenous ventricular RGS2 expression is selectively reduced in two different hypertrophy models with enhanced Gq/11 signaling (transgenic G{alpha}q* expression and pressure overload). Importantly, RGS2 down-regulation was pronounced (by >50%) and detectable prior to the onset of hypertrophy. We identified RNAi targeting sequences that are effective and selective in suppressing RGS2 expression in NVM and AVM and demonstrate that endogenous RGS2 exerts functionally important inhibitory restraint on Gq/11-mediated PLCbeta (but not MAPK) activation and hypertrophy. Together, these data suggest that loss of cardiac fine tuning of PLCbeta signaling by RGS2 down-regulation could potentially play a pathophysiological role in the development of Gq/11-mediated hypertrophy.

Early and Selective Down-regulation of RGS2 in Hearts with Enhanced Gq/11 Signaling—Studies on the role of RGS protein expression changes in the pathophysiology of cardiac hypertrophy and failure are still scarce. Cardiac RGS expression has been investigated in patients with end-stage failing hearts and organ donors with acute failure (9, 10) and animal models of pressure overload and heart failure (11, 29). The reported findings were not uniform, presumably due to species- and/or model-specific differences, and were limited to a few RGS proteins (mainly RGS3 and RGS4) and already hypertrophied and failing hearts.

The present study identified changes in RGS2 expression that preceded the development of hypertrophy and may therefore be of pathophysiological importance for the initial events triggering hypertrophy development. Of the major endogenous cardiac RGS proteins, only RGS2 was markedly altered in its expression prior to the development of hypertrophy. RGS2 down-regulation was observed at both mRNA and protein levels and in cardiac myocytes. It was found in two independent models (G{alpha}q* expression and pressure overload), suggesting that it is a common feature in hearts with enhanced Gq/11 signaling. In contrast, changes in RGS3, RGS4, and RGS5 expression (at end stage) were found to be not uniform in the two models.


Figure 8
View larger version (47K):
[in this window]
[in a new window]
  		FIGURE 8.
Effect of RGS2 RNAi on Gq/11-mediated cardiomyocyte hypertrophy. Immunofluorescent myosin (MF-20) staining (A), cell area of MF-20-stained cells (B; n = 73-115 in each group), and [14C]phenylalanine incorporation (C; representative assay in quadruplicates) in NMV transfected with RGS2 sequence 4 or negative control siRNA (30 nM each) and treated for 72 h with PE/Tim (1/0.1 µM) or ET-1 (1 nM). Data represent mean ± S.E. *, p < 0.05 agonist versus basal; #, p < 0.05 RGS2 sequence 4 versus negative control (Neg Ctr) siRNA.

 
Delineating Endogenous RGS Protein Function Using RNAi—To date, the function of RGS proteins has mainly been assessed with recombinant proteins and by heterologous overexpression, and very little is known about their role in cardiomyocyte biology. Negative regulation of cardiac G protein signaling by RGS proteins has been described (9, 30), but these studies focused primarily on RGS4, the Gq/11 signaling pathway, and neonatal stages of cardiac development. Using a similar type of overexpression studies, we recently demonstrated that RGS2 is a potent and selective inhibitor of Gq/11-mediated PLCbeta activation and hypertrophy in cardiac myocytes, whereas the other major cardiac RGS proteins (RGS3-RGS5) can regulate both Gq/11 and Gi/o signaling (31). Whereas gain-of-function studies provide valuable information about the capacity of RGS proteins to regulate cardiac G protein signaling, they do not necessarily reflect the functions of endogenous RGS. This is of particular importance in light of generally low expression levels of RGS proteins and the simultaneous presence of multiple RGS proteins with often redundant G{alpha} specificity. In this study, we used a novel approach to delineate the function of endogenous RGS proteins in living cells, which represents a significant extension to previously used antibodies (32) or inhibitory RGS peptides (33) targeting the RGS-G{alpha} interface, antisense oligonucleotides (34), or ribozymes (35).

Feasibility and Significance of RNAi in Cardiac Myocytes Using siRNA Transfection—Functional gene characterization via RNAi requires efficient siRNA introduction into cells in the absence of nonspecific or cytotoxic effects. Generally, only low transfection efficiencies can be achieved in cardiomyocytes using cationic lipids. However, we and others have observed much higher transfection efficiencies for siRNAs compared with plasmid DNAs in some cell types, which prompted us to explore this approach in myocytes. In this study, we demonstrate homogenous cellular siRNA uptake in more than 90% of NVM and effective and selective RGS2 RNAi in both NVM and AVM without any apparent compromise in cell viability or morphology. The gene silencing effect was transient but sufficiently long to conduct experiments requiring several days of culture.

Our findings suggest that transfection of siRNA into neonatal and adult cardiomyocytes could become a useful complement to gene targeting in whole animals. It offers a less labor- and cost-intensive alternative for effective gene silencing than previously reported adenoviral approaches (such as adenoviral infection of U6 promoter-driven shRNA (36, 37) and siRNA introduction via hemagglutinating virus of Japan envelope vector (38)). The transfection efficiency that can be achieved with this novel approach is superior to pSilencer electroporation (39). Recently, another group reported gene silencing via siRNA transfection (40), although this study (like the others cited above) was limited to neonatal myocytes and provided few experimental details.

Endogenous RGS2 Negatively Regulates Cardiomyocyte Gq/11-mediated PLCbeta Activation and Hypertrophy—Total inositol phosphate formation and hypertrophy in response to Gq/11-coupled receptor stimulation were markedly increased upon gene silencing of endogenous RGS2 in NVM and AVM, suggesting that RGS2 exerts functionally important inhibitory restraint on Gq/11-mediated PLCbeta activation in cardiac myocytes of different differentiation states.

In contrast to PLCbeta, the immediate downstream target of Gq/11, none of the MAPK signaling branches (ERK1/2, p38, and JNK) appeared to be enhanced in response to Gq/11 activation upon RGS2 silencing. ERK1/2, p38, and JNK have all been implicated to have prohypertrophic effects in cell culture-based systems (such as NVM), although more recent evidence suggests that p38 and JNK may not positively regulate hypertrophy in vivo (reviewed in Refs. 41-43). Activation of MAPK signaling by Gq/11-coupled GPCRs involves a number of intermediaries (44), which could in part contribute to the apparent lack of regulation of Gq/11-mediated MAPK activation by endogenous RGS2. Furthermore, it is conceivable that one or more of the other cardiac RGS proteins play a significant role. These possibilities will be explored in future studies.

Two siRNAs targeting different sequences in RGS2 (sequences 3 and 4) caused a similar degree of RGS2 suppression in cardiomyocytes. They caused comparable functional effects, making nonspecific off-target effects (45) unlikely. Importantly, enhancement of Gq/11-mediated PLCbeta activation was observed despite the continued presence of RGS3-RGS5 with a similar capacity to regulate Gq/11 signaling (31). Our findings do not exclude potential contributions by other proteins (such as RGS3, RGS4, or RGS5) in regulating Gq/11-mediated PLCbeta activation, but they indicate for the first time a functionally important negative regulatory effect of endogenous RGS2.

Endogenous RGS2 negatively regulated PLCbeta activation in response to two different Gq/11-coupled receptors ({alpha}1-adrenergic and endothelin-1). Recent evidence suggests that RGS proteins may not be able to freely interact with available G{alpha} proteins but may be selectively sorted by GPCRs at the plasma membrane (46). Binding of RGS2 to Gq/11-coupled GPCR sequences has been described via direct interaction (47) or a scaffolding protein (48), but neither we (Figs. 6 and 8) nor others (49, 50) have observed receptor-specific regulation of Gq/11 signaling by RGS2 to date. It is important to note that cellular interactions between a full-length GPCR and RGS protein have yet to be described. Screening of a larger number of receptor agonists will be required to determine if endogenous RGS2 displays receptor selectivity in cardiomyocytes and to delineate its profile.

Taken together, this study shows that endogenous RGS2 proteins play a central role in fine tuning cardiomyocyte Gq/11 signaling and suggests that RGS2 down-regulation in hearts with enhanced Gq/11 signaling might further exacerbate Gq/11-mediated PLCbeta activation. We previously demonstrated that RGS2 can effectively diminish Gq/11-mediated PLCbeta activation in the absence of GTPase activity (5). In G{alpha}q* transgenic hearts, RGS2 down-regulation therefore probably acts in concert with a previously reported up-regulation in endogenous G{alpha}q/11 and PLCbeta (19, 20) to further enhance Gq/11 signaling. In pressure overload, the crucial role of Gq/11 signaling was demonstrated by a marked reduction or absence of the hypertrophic response upon heart-specific disruption of the receptor-Gq/11 interface (15) or deletion of Gq/11 {alpha} subunits (16). It is likely that RGS2 down-regulation contributes to further exacerbation of Gq/11 signaling in this setting as well.

Further work is required to address the functional significance of RGS2 down-regulation in vivo. Targeted deletion of RGS2 in mice leads to a hypertensive phenotype, presumably due to prolonged Gq/11 signaling and vasoconstriction in the vasculature (51, 52). Central nervous mechanisms (an enhanced sympathetic tone that could lead to a resetting of the baroreceptor reflex) appear to also contribute to blood pressure elevation in this model (53). To date, very little is known about the cardiac phenotype of RGS2KO. Only echocardiographic results at 6 months of age have been reported, which showed no signs of hypertrophy and normal systolic function (51). It is possible that the increase in blood pressure in RGS2KO is not sufficient to induce hypertrophic changes or that hypertrophic changes might develop at a later point in time. Furthermore, whether or not long term deletion of RGS2 may lead to compensatory changes in the expression of other RGS proteins has not yet been addressed in any of the studies published to date. The present study suggests that endogenous RGS2 fine tunes cardiomyocyte Gq/11 signaling and function in response to receptor activation but not under base-line conditions. Therefore, the response to hypertrophic stimuli in mice lacking RGS2 warrants further investigation.

Implications—G protein-mediated signaling pathways are of fundamental importance for the regulation of cell size, differentiation, and function. As regulators of G protein signaling, RGS proteins provide an alternative approach to modulate the GPCR-G protein system. A better understanding of this important protein family and the biological function of endogenous RGS proteins under normal and pathophysiological conditions will probably provide new opportunities in therapeutic design.

Our findings implicate endogenous RGS2 as an important negative regulator of Gq/11-mediated PLCbeta activation and hypertrophy in cardiomyocytes. We propose that early and selective down-regulation of RGS2 might play a critical role in Gq/11-mediated hypertrophy via positive feedback. The question of whether changes in RGS2 expression also play a role in other forms of cardiac hypertrophy (e.g. as a result of ischemic injury or sarcomeric mutations) will be the subject of future investigation.

Enhancing the expression and/or function of RGS2 could potentially be a useful approach to modulate one of the central pathways in hypertrophy development. It is increasingly recognized that modulating negative regulators of hypertrophy could become an important strategy for heart failure treatment, because it attempts to mimic negative feedback mechanisms that are often central for maintaining cellular homeostasis (54). Cardiac hypertrophy is generally believed to be initially an adaptive response that helps normalize ventricular wall stress and maintain cardiac output but then often progresses to overt heart failure. However, increasing evidence suggests that hypertrophy may not necessarily be a compensatory event and that its inhibition may be a promising therapeutic approach (22).


   FOOTNOTES
 
* This work was supported by NHLBI, National Institutes of Health, Grants HL-52320 and HL-72174 (to U. M.) and by Scientist Development Grant 9930032N (to U. M.), Grantin-aid 0555817T (U. M.), and a postdoctoral fellowship (to J. H.) from the American Heart Association. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 These authors contributed equally to this work. Back

2 To whom correspondence should be addressed: Rhode Island Hospital and Brown Medical School, Cardiovascular Division, Cardiovascular Research Center, Southwest Pavilion 2nd floor, 593 Eddy St., Providence, RI 02903. Tel.: 401-444-9854; Fax: 401-444-9203; E-mail: UMende{at}Lifespan.org.

3 The abbreviations used are: GPCR, G protein-coupled receptor; RNAi, RNA interference; ANF, atrial natriuretic factor; KO, knock-out; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT, reverse transcription; shRNA, short hairpin RNA; DMEM, Dulbecco's modified Eagle's medium; NVM, neonatal ventricular myocyte(s); AVM, adult ventricular myocyte(s); PBS, phosphate-buffered saline; PE, phenylephrine; Tim, timolol; ET-1, endothelin-1; MAPK, mitogen-activated protein kinase; JNK, c-Jun N-terminal kinase; PLC, phospholipase C. Back

4 Genomics of Cardiovascular Development, Adaptation, and Remodeling: NHLBI Program for Genomic Applications, Harvard Medical School, available on the World Wide Web at www.cardiogenomics.org. Back


   ACKNOWLEDGMENTS
 
We thank Drs. B. Blake and D. P. Siderovski (University of North Carolina) for RGS2 antibody and RGS2 knock-out mouse cortex samples and L. Riggi and Dr. S. W. Kong (Beth Israel Deaconess Medical Center) for helpful advice with the CardioGenomics data base.4 We are grateful to Janine Chalk for excellent administrative support.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Frey, N., and Olson, E. N. (2003) Annu. Rev. Physiol. 65, 45-79[CrossRef][Medline] [Order article via Infotrieve]
  2. Dorn, G. W., II, and Hahn, H. S. (2004) Ann. N. Y. Acad. Sci. 1015, 225-237[CrossRef][Medline] [Order article via Infotrieve]
  3. Offermanns, S. (2003) Prog. Biophys. Mol. Biol. 83, 101-130[CrossRef][Medline] [Order article via Infotrieve]
  4. Hollinger, S., and Hepler, J. R. (2002) Pharmacol. Rev. 54, 527-559[Abstract/Free Full Text]
  5. Anger, T., Zhang, W., and Mende, U. (2004) J. Biol. Chem. 276, 3906-3915
  6. Riddle, E. L., Schwartzman, R. A., Bond, M., and Insel, P. A. (2005) Circ. Res. 96, 401-411[Abstract/Free Full Text]
  7. Ross, E. M., and Wilkie, T. M. (2000) Annu. Rev. Biochem. 69, 795-827[CrossRef][Medline] [Order article via Infotrieve]
  8. De Vries, L., Zheng, B., Fischer, T., Elenko, E., and Farquhar, M. G. (2000) Annu. Rev. Pharmacol. Toxicol. 40, 235-271[CrossRef][Medline] [Order article via Infotrieve]
  9. Mittmann, C., Chung, C. H., Hoppner, G., Michalek, C., Nose, M., Schuler, C., Schuh, A., Eschenhagen, T., Weil, J., Pieske, B., Hirt, S., and Wieland, T. (2002) Cardiovasc. Res. 55, 778-786[Abstract/Free Full Text]
  10. Owen, V. J., Burton, P. B., Mullen, A. J., Birks, E. J., Barton, P., and Yacoub, M. H. (2001) Eur. Heart J. 22, 1015-1020[Abstract/Free Full Text]
  11. Zhang, S., Watson, N., Zahner, J., Rottman, J. N., Blumer, K. J., and Muslin, A. J. (1998) J. Mol. Cell. Cardiol. 30, 269-276[CrossRef][Medline] [Order article via Infotrieve]
  12. Doupnik, C. A., Xu, T., and Shinaman, J. M. (2001) Biochim. Biophys. Acta. 1522, 97-107[Medline] [Order article via Infotrieve]
  13. Kardestuncer, T., Wu, H., Lim, A. L., and Neer, E. J. (1998) FEBS Lett. 438, 285-288[CrossRef][Medline] [Order article via Infotrieve]
  14. Mende, U., Kagen, A., Cohen, A., Aramburu, J., Schoen, F. J., and Neer, E. J. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 13893-13898[Abstract/Free Full Text]
  15. Akhter, S. A., Luttrell, L. M., Rockman, H. A., Iaccarino, G., Lefkowitz, R. J., and Koch, W. J. (1998) Science 280, 574-577[Abstract/Free Full Text]
  16. Wettschureck, N., Rutten, H., Zywietz, A., Gehring, D., Wilkie, T. M., Chen, J., Chien, K. R., and Offermanns, S. (2001) Nat. Med. 7, 1236-1240[CrossRef][Medline] [Order article via Infotrieve]
  17. Hannon, G. J., and Rossi, J. J. (2004) Nature 431, 371-378[CrossRef][Medline] [Order article via Infotrieve]
  18. Dykxhoorn, D. M., Novina, C. D., and Sharp, P. A. (2003) Nat. Rev. Mol. Cell Biol. 4, 457-467[CrossRef][Medline] [Order article via Infotrieve]
  19. Mende, U., Kagen, A., Meister, M., and Neer, E. J. (1999) Circ. Res. 85, 1085-1091[Abstract/Free Full Text]
  20. Mende, U., Semsarian, C., Martins, D. C., Kagen, A., Duffy, C., Schoen, F. J., and Neer, E. J. (2000) Mol. Cell Cardiol. 33, 1477-1491[CrossRef]
  21. Liao, R., Jain, M., Cui, L., D'Agostino, J., Aiello, F., Luptak, I., Ngoy, S., Mortensen, R. M., and Tian, R. (2002) Circulation 106, 2125-2131[Abstract/Free Full Text]
  22. Frey, N., Katus, H. A., Olson, E. N., and Hill, J. A. (2004) Circulation 109, 1580-1589[Abstract/Free Full Text]
  23. Deng, X. F., Rokosh, D. G., and Simpson, P. C. (2000) Circ. Res. 87, 781-788[Abstract/Free Full Text]
  24. Pasumarthi, K. B., Kardami, E., and Cattini, P. A. (1996) Circ. Res. 78, 126-136[Abstract/Free Full Text]
  25. Ellingsen, O., Davidoff, A. J., Prasad, S. K., Berger, H. J., Springhorn, J. P., Marsh, J. D., Kelly, R. A., and Smith, T. W. (1993) Am. J. Physiol. 265, H747-H754[Medline] [Order article via Infotrieve]
  26. Volz, A., Piper, H. M., Siegmund, B., and Schwartz, P. (1991) J. Mol. Cell Cardiol. 23, 161-173[CrossRef][Medline] [Order article via Infotrieve]
  27. Peterson, D. J., Ju, H., Hao, J., Panagia, M., Chapman, D. C., and Dixon, I. M. (1999) Cardiovasc. Res. 41, 575-585[Abstract/Free Full Text]
  28. Simpson, P., McGrath, A., and Savion, S. (1982) Circ. Res. 51, 787-801[Abstract/Free Full Text]
  29. Jalili, T., Takeishi, Y., Song, G., Ball, N. A., Howles, G., and Walsh, R. A. (1999) Am. J. Physiol. 277, H2298-H2304[Medline] [Order article via Infotrieve]
  30. Tamirisa, P., Blumer, K. J., and Muslin, A. J. (1999) Circulation 99, 441-447[Abstract/Free Full Text]
  31. Hao, J., Zhang, W., Michalek, C., Xu, X., and Mende, U. (2005) Circulation 111, 1724 (Abstr. 5025)
  32. Sinnarajah, S., Dessauer, C. W., Srikumar, D., Chen, J., Yuen, J., Yilma, S., Dennis, J. C., Morrison, E. E., Vodyanoy, V., and Kehrl, J. H. (2001) Nature 409, 1051-1055[CrossRef][Medline] [Order article via Infotrieve]
  33. Jin, Y., Zhong, H., Omnaas, J. R., Neubig, R. R., and Mosberg, H. I. (2004) J. Pept. Res. 63, 141-146[CrossRef][Medline] [Order article via Infotrieve]
  34. Dulin, N. O., Sorokin, A., Reed, E., Elliott, S., Kehrl, J. H., and Dunn, M. J. (1999) Mol. Cell Biol. 19, 714-723[Abstract/Free Full Text]
  35. Wang, Q., Liu, M., Kozasa, T., Rothestein, J. D., Sternweis, P. C., and Neubig, R. R. (2004) Methods Enzymol. 389, 244-265[Medline] [Order article via Infotrieve]
  36. Seth, M., Sumbilla, C., Mullen, S. P., Lewis, D., Klein, M. G., Hussain, A., Soboloff, J., Gill, D. L., and Inesi, G. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 16683-16688[Abstract/Free Full Text]
  37. Yue, Y., Lypowy, J., Hedhli, N., and Abdellatif, M. (2004) J. Biol. Chem. 279, 12883-12889[Abstract/Free Full Text]
  38. Watanabe, A., Arai, M., Yamazaki, M., Koitabashi, N., Wuytack, F., and Kurabayashi, M. (2004) J. Mol. Cell Cardiol. 37, 691-698[CrossRef][Medline] [Order article via Infotrieve]
  39. Lorenz, K., Lohse, M. J., and Quitterer, U. (2003) Nature 426, 574-579[CrossRef][Medline] [Order article via Infotrieve]
  40. Pedram, A., Razandi, M., Aitkenhead, M., and Levin, E. R. (2005) J. Biol. Chem. 280, 26339-26348[Abstract/Free Full Text]
  41. Bueno, O. F., and Molkentin, J. D. (2002) Circ. Res. 91, 776-781[Abstract/Free Full Text]
  42. Liang, Q., and Molkentin, J. D. (2003) J. Mol. Cell Cardiol. 35, 1385-1394[CrossRef][Medline] [Order article via Infotrieve]
  43. Petrich, B. G., and Wang, Y. (2004) Trends Cardiovasc. Med. 14, 50-55[CrossRef][Medline] [Order article via Infotrieve]
  44. Gutkind, J. S. (2000) Sci. STKE 2000, RE1
  45. Jackson, A. L., Bartz, S. R., Schelter, J., Kobayashi, S. V., Burchard, J., Mao, M., Li, B., Cavet, G., and Linsley, P. S. (2003) Nat. Biotechnol. 21, 635-637[CrossRef][Medline] [Order article via Infotrieve]
  46. Hepler, J. R. (2003) Mol. Pharmacol. 64, 547-549[Free Full Text]
  47. Bernstein, L. S., Ramineni, S., Hague, C., Cladman, W., Chidiac, P., Levey, A. I., and Hepler, J. R. (2004) J. Biol. Chem. 279, 21248-21256[Abstract/Free Full Text]
  48. Wang, X., Zeng, W., Soyombo, A. A., Tang, W., Ross, E. M., Barnes, A. P., Milgram, S. L., Penninger, J. M., Allen, P. B., Greengard, P., and Muallem, S. (2005) Nat. Cell Biol. 7, 405-411[CrossRef][Medline] [Order article via Infotrieve]
  49. Wang, X., Huang, G., Luo, X., Penninger, J. M., and Muallem, S. (2004) J. Biol. Chem. 279, 41642-41649[Abstract/Free Full Text]
  50. Sun, X., Kaltenbronn, K. M., Steinberg, T. H., and Blumer, K. J. (2005) Mol. Pharmacol. 67, 631-639[Abstract/Free Full Text]
  51. Heximer, S. P., Knutsen, R. H., Sun, X., Kaltenbronn, K. M., Rhee, M. H., Peng, N., Oliveira-dos-Santos, A., Penninger, J. M., Muslin, A. J., Steinberg, T. H., Wyss, J. M., Mecham, R. P., and Blumer, K. J. (2003) J. Clin. Invest. 111, 445-452[CrossRef][Medline] [Order article via Infotrieve]
  52. Tang, K. M., Wang, G. R., Lu, P., Karas, R. H., Aronovitz, M., Heximer, S. P., Kaltenbronn, K. M., Blumer, K. J., Siderovski, D. P., Zhu, Y., and Mendelsohn, M. E. (2003) Nat. Med. 9, 1506-1512[CrossRef][Medline] [Order article via Infotrieve]
  53. Gross, V., Tank, J., Obst, M., Plehm, R., Blumer, K. J., Diedrich, A., Jordan, J., and Luft, F. C. (2005) Am. J. Physiol. Regul. Integr. Comp. Physiol. 288, R1134-R1142[Abstract/Free Full Text]
  54. Hardt, S. E., and Sadoshima, J. (2004) Cardiovasc. Res. 63, 500-509[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 CirculationHome page
K. Chakir, S. K. Daya, T. Aiba, R. S. Tunin, V. L. Dimaano, T. P. Abraham, K. Jaques, E. W. Lai, K. Pacak, W.-Z. Zhu, et al.
Mechanisms of Enhanced {beta}-Adrenergic Reserve From Cardiac Resynchronization Therapy
Circulation, March 10, 2009; 119(9): 1231 - 1240.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
P. Zhang, X. Hu, X. Xu, J. Fassett, G. Zhu, B. Viollet, W. Xu, B. Wiczer, D. A. Bernlohr, R. J. Bache, et al.
AMP Activated Protein Kinase-{alpha}2 Deficiency Exacerbates Pressure-Overload-Induced Left Ventricular Hypertrophy and Dysfunction in Mice
Hypertension, November 1, 2008; 52(5): 918 - 924.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
Z. Lu, J. Fassett, X. Xu, X. Hu, G. Zhu, J. French, P. Zhang, J. Schnermann, R. J. Bache, and Y. Chen
Adenosine A3 Receptor Deficiency Exerts Unanticipated Protective Effects on the Pressure-Overloaded Left Ventricle
Circulation, October 21, 2008; 118(17): 1713 - 1721.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
D. R. Grubb, O. Vasilevski, H. Huynh, and E. A. Woodcock
The extreme C-terminal region of phospholipase C{beta}1 determines subcellular localization and function; the "b" splice variant mediates {alpha}1-adrenergic receptor responses in cardiomyocytes
FASEB J, August 1, 2008; 22(8): 2768 - 2774.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
X. Xu, J. Fassett, X. Hu, G. Zhu, Z. Lu, Y. Li, J. Schnermann, R. J. Bache, and Y. Chen
Ecto-5'-Nucleotidase Deficiency Exacerbates Pressure-Overload-Induced Left Ventricular Hypertrophy and Dysfunction
Hypertension, June 1, 2008; 51(6): 1557 - 1564.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
T. Tokudome, I. Kishimoto, T. Horio, Y. Arai, D. O. Schwenke, J. Hino, I. Okano, Y. Kawano, M. Kohno, M. Miyazato, et al.
Regulator of G-Protein Signaling Subtype 4 Mediates Antihypertrophic Effect of Locally Secreted Natriuretic Peptides in the Heart
Circulation, May 6, 2008; 117(18): 2329 - 2339.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
D. A. Kass, H. C. Champion, and J. A. Beavo
Phosphodiesterase Type 5: Expanding Roles in Cardiovascular Regulation
Circ. Res., November 26, 2007; 101(11): 1084 - 1095.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
G. Fejes-Toth and A. Naray-Fejes-Toth
Early Aldosterone-Regulated Genes in Cardiomyocytes: Clues to Cardiac Remodeling?
Endocrinology, April 1, 2007; 148(4): 1502 - 1510.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
J. Bodenstein, R. K. Sunahara, and R. R. Neubig
N-Terminal Residues Control Proteasomal Degradation of RGS2, RGS4, and RGS5 in Human Embryonic Kidney 293 Cells
Mol. Pharmacol., April 1, 2007; 71(4): 1040 - 1050.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/9/5811    most recent
M507871200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, W.
Right arrow Articles by Mende, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, W.
Right arrow Articles by Mende, U.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement