JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M611170200 on January 23, 2007

J. Biol. Chem., Vol. 282, Issue 12, 8905-8914, March 23, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An addition or correction has been published
Right arrow All Versions of this Article:
282/12/8905    most recent
M611170200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, C.-H.
Right arrow Articles by Sun, C.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, C.-H.
Right arrow Articles by Sun, C.-H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Novel ARID/Bright-like Protein Involved in Transcriptional Activation of Cyst Wall Protein 1 Gene in Giardia lamblia*

Chih-Hung Wang, Li-Hsin Su, and Chin-Hung Sun1

From the Department of Parasitology, College of Medicine, National Taiwan University, Taipei 100, Taiwan

Received for publication, December 5, 2006 , and in revised form, January 19, 2007.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The capability of protozoan parasite Giardia lamblia to encyst is critical for survival outside the host and its transmission. AT-rich interaction domain (ARID) or Bright homologs constitute a large family of transcription factors in higher eukaryotes that regulate cell proliferation, development, and differentiation. We asked whether Giardia has ARID-like genes and whether they influence gene expression during Giardia encystation. Blast searches of the Giardia genome data base identified two genes with putative ARID/Bright domains (gARID1 and 2). Epitope-tagged gARID1 was found to localize to nuclei. Recombinant gARID1 specifically bound to the encystation-induced cyst wall protein (cwp) gene promoters. Mutation analysis revealed that AT-rich initiators were required for binding of gARID1 to the cwp promoters. gARID1 contains several key residues for DNA binding, and its binding sequences are similar to those of the known ARID family proteins. The gARID1 binding sequences were positive cis-acting elements of the cwp1 promoter during both vegetative growth and encystation. We also found that gARID1 transactivated the cwp1 promoter through its binding sequences in vivo. Our results suggest that the ARID family has been conserved during evolution and that gARID1 is an important transactivator in regulation of the Giardia cwp1 gene, which is key to Giardia differentiation into cysts.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Giardia lamblia is an important human intestinal parasite that causes outbreaks of waterborne diarrheal disease (1, 2). It has two life cycle stages that are well adapted to survival in different inhospitable environments (36). The motile flagellated trophozoites attach to and colonize the human small intestine to cause the symptoms of giardiasis. The dormant infective cysts, which are protectively walled and resistant to external hostile conditions, are responsible for transmission of giardiasis.

The ability of trophozoites to encyst in the intestine is key to Giardia pathophysiology. However, little is known of the regulation of encystation. Synthesis and secretion of specific proteins and polysaccharide required for the formation of a protective cyst wall is a major process of encystation (3, 57). Expression of genes encodes three cyst wall structural proteins (Cwp1, Cwp2, Cwp3) (810), and glucosamine-6-phosphate isomerase-B, the first enzyme in the cyst wall polysaccharide biosynthetic pathway (11, 12), increases with similar kinetics during encystation (6, 9, 11, 12), suggesting the importance of regulation at the transcriptional level.

G. lamblia is of significant evolutionary interest because it has been proposed as one of the most early diverging eukaryotes (13, 14). The giardial transcription mechanism may be unusual because relatively short 5'-flanking regions (<65 bp) are sufficient for the expression of many constitutive and encystation-induced giardial genes (11, 1517). No classical TATA or CCAAT boxes or other cis-acting elements have been found in the promoters of many giardial protein-coding genes (16, 18). AT-rich sequences have been found spanning the transcription start sites of many genes, indicating that they are functionally similar to the initiator (Inr)2 element in higher eukaryotes (8, 9, 11, 1517, 19). These sequences are essential for promoter activity and play a key role in determining the transcription start sites (16, 17, 20). Specific regulatory regions have been identified in the encystation-induced cwp2 promoter, including a positive cis-acting element (-23 to -10 relative to the translation start site) required for encystation-specific promoter activity and a negative cis-acting element (-64 to -23 region) required for promoter activity in vegetative cells (20). The latter region also contains a region (-61 to -52) that controls sterol-mediated decrease in the cwp2 transcription (21).

Relatively little is known about the transcription machinery in G. lamblia. Only four of the twelve general transcription initiation factors have giardial homologs, and they appear to have diverged at a higher rate than those of crown group eukaryotes (22). Giardial TATA-binding protein is highly divergent with respect to archaeal and higher eukaryotic TATA-binding proteins (22). Giardia does not have a true TFIIB homolog but has a homolog to TFIIB-related factor, which is involved in RNA polymerase III transcription in higher eukaryotes (22). Moreover, giardial RNA polymerase II transcription is highly resistant to {alpha}-amanitin (23). Few transcription factors have been characterized to date (24, 25). Giardia has several Myb proteins, one of which is encystation-induced and is involved in coordinating up-regulation of four key encystation-induced genes, cwp1, cwp2, cwp3, and g6pi-b and gmyb2 itself (24). The GARP family transcription factors may be involved in transcriptional regulation of many different genes, including the encystation-induced cwp1 gene and constitutive ran gene (25).

AT-rich interaction domain (ARID) proteins are known to be involved in chromatin remodeling and regulation of development, cellular differentiation, and cell cycle control (16, 26). The ARID protein family has been found in yeast, Caenorhabditis elegans, plants, Drosophila, and mammals (26, 27). They have been shown to have AT-rich sequence-specific DNA binding activity and have been reported to function as transcriptional activators or repressors (26, 27). Mouse Bright (B cell regulator of IgH transcription) is a B cell-specific transactivator (28). Drosophila dead ringer (dri) is expressed in a developmentally regulated set of tissues, and its product may be a transcriptional activator or repressor depending on the cis-regulatory context (29). Human or mouse ARID family proteins have been grouped into seven subfamilies based on their sequence homology (Fig. 1) (30). The binding sites of the ARID3 subfamily Bright and DRI are (A/G)AT(T/A)AA, and (A/G)ATTAA or TATTGAT, respectively, all of which contain the sequence ATT embedded within a larger AT-rich sequence (27, 28, 31). The Bright core binding sites also flanked with AT or ATC run containing AT dimers, which are characteristic of matrix attachment region recognition sites (28). The binding site of the ARID5 subfamily MRF2 is AATA(C/T) (32). Some ARID family proteins are not sequence-specific DNA-binding proteins or they do not bind AT-rich sequences (26, 27). For example, the ARID1 subfamily p270 and Osa, which are members of SWI/SNF complexes, have DNA binding activity but no preference for specific DNA sequences (3335). The JARID2 subfamily JUMONJI seems to bind both AT-rich and non-AT-rich sequences (36).

Because most giardial promoters contain AT-rich sequences spanning the transcription start sites, we asked whether Giardia has ARID family proteins and whether they influence gene expression. We searched the Giardia genome data base for genes encoding ARID-like domains. We identified two giardial ARID homologs and determined the function of gARID1 in Giardia. We found that gARID1 bound to specific AT-rich Inr sequences and functioned as a transcriptional activator in G. lamblia.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Giardia Culture—Trophozoites of G. lamblia WB (ATCC 30957), clone C6, were cultured in modified TYI-S33 medium (37) and encysted as described previously (10).

Isolation and Analysis of the Arid Genes—The G. lamblia genome data base (www.mbl.edu/Giardia) (38) was searched with the amino acid sequence of the mouse MRF2 (GenBankTM accession number AF280065 [GenBank] ) using the BLAST program (39). The gARID1 coding region with 255 nt of 5'- and 190 nt of 3'-flanking regions was cloned and the nucleotide sequence was determined. The garid1 gene sequence in the data base was essentially correct. The sequence of the garid2 gene was also confirmed. To isolate the cDNA of the garid1 gene, we performed RT-PCR with garid1-specific primers using total RNA from Giardia. For RT-PCR, 5 µg of DNase-treated total RNA from vegetative and 24-h encysting cells was mixed with oligo(dT)12–18 and Superscript II RNase H reverse transcriptase (Invitrogen). Synthesized cDNA was used as a template in subsequent PCR with primers A1F (ATGAATTACTCTCAATACACT) and A1R (ATACCCAAAGTCGTTAATATG). Genomic and RT-PCR products were cloned into pGEM-T easy vector (Promega) and sequenced (ABI; Applied Biosystems). RT-PCR analysis of cwp1 (U09330 [GenBank] ) and ran (U02589 [GenBank] ) gene expression was performed using primers cwp1F (ATGATGCTCGCTCTCCTT) and cwp1R (TCAAGGCGGGGTGAGGCA) and ranF (ATGTCTGACCCAATCAGC) and ranR (TCAATCATCGTCGGGAAG), respectively.

RNA and DNA Extraction, Northern Blot, and 5'-RACE Analysis—Total RNA was extracted from Giardia at the indicated differentiation stages using TRIzol reagent (Invitrogen). For Northern blot analysis, 10 µg of total RNA was fractionated and transferred to charged nylon membranes (Biodyne B membrane; Pall Corp.). Full-length coding region probes of luciferase, cwp1 (U09330 [GenBank] ), and ran (U02589 [GenBank] ) genes were prepared by PCR amplification of genomic DNA using primers lucF (ATGGAAGACGCCAAAAAC) and lucR (TTACACGGCGATCTTTCC), cwp1F and cwp1R, and ranF and ranR, respectively. Radiolabeled probes were prepared using the Rediprime II kit (Amersham Biosciences). The membranes were hybridized and washed as described previously (11). Hybridization signals were imaged and quantified using a Storm system (Molecular Dynamics). 5'-RACE analysis was performed using the 5'-RACE system (Invitrogen). Oligonucleotides lucRA1 (CAACACTTAAAATCGCAGTAT) and lucRA2 (CCGGAATGATTTGATTGCCAA) were used as first-strand primer and nested primer, respectively.

Plasmid Construction—All garid1 fragments were amplified from genomic DNA by PCR. All constructs were verified by DNA sequencing with an BigDye Terminator 3.1 DNA sequencing kit and an ABI 3100 DNA Analyser (Applied Biosystems). Plasmid pPW1 has been described previously (40). The garid1 gene and its 255-bp 5'-flanking region was amplified with oligonucleotides A5XF (GGCGTCTAGATCTGCAGCGAAGCCTTATTGTATG) and A5AUER (GGCGGAATTCCTAGATGTATCGATACGTATCATACCCAAAGTCGTTAATATGAT), digested with XbaI/EcoRI, and cloned into NheI/EcoRI-digested pNT5 (24). The resulting plasmid, pNA1, contained the garid1 gene under the control of its own promoter.

Transfection and Luciferase Assay—Cells transfected with the pNA1 plasmid were selected with G418 as described previously (41). Stable transfectants were maintained at 150 µg/ml G418. Cells transfected with pPW1, pPW1m3, or pPW1m4 plasmid containing the pac gene were selected and maintained with 54 µg/ml puromycin. For co-transfection assays (See Fig. 9), Giardia cells were first transfected with plasmid PW1, pW1m3, or pPW1m4 and selected in 54 µg/ml puromycin. The stable transfectants were transfected with plasmid pRANneo (41) or pNA1, and then the cells were doubly selected in both 150 µg/ml G418 and 54 µg/ml puromycin. The luciferase activity was determined as described previously (11). Luciferase activity was measured with an Optocomp I luminometer (MGM Instruments). Western blots were probed with anti-AU1 monoclonal antibody (1/5000 in blocking buffer; BAbCO) and detected with peroxidase-conjugated goat anti-mouse IgG (1/5000; Pierce) and enhanced chemiluminescence (Amersham Biosciences).

Immunofluorescence Assay—The pNA1 stable transfectants were cultured in growth medium under G418 selection. Cells were harvested after 0 or 24 h of encystation, washed in phosphate-buffered saline, attached to glass coverslips (2 x 106 cells/coverslip), and then fixed and stained (11). Cells were reacted with anti-AU1 monoclonal antibody (1/300 in blocking buffer; BAbCO), and anti-mouse ALEXA 568 (1/500 in blocking buffer; Molecular Probes) was used as the detector. gARID1 was visualized using a Leica TCS SP2 Spectral Confocal System.

Expression and Purification of Recombinant gARID1 Protein—The genomic garid1 gene was amplified using oligonucleotides A1F and A1R. The product was cloned into the expression vector pCRT7/CT-TOPO (Invitrogen) in-frame with the C-terminal His and V5 tags to generate plasmid pA1. To make the gARID1m expression vector, the garid1 gene was amplified using two primer pairs A1F and A1mR (CTTGGTACGAAGAGTGGCCCCAGCATTGGTGAC) and A1mF (GTCACCAATGCTGGGGCCACTCTTCGTACCAAG) (the underlined GCC encode Ala) and A1R. The two PCR products were purified and used as templates for a second PCR. The second PCR reaction also included primers A1F and A1R, and the product was cloned into the expression vector to generate plasmid pA1m. The pA1 or pA1m plasmid was freshly transformed into Escherichia coli BL21(DE3)pLysS (QIAexpressionist; Qiagen). An overnight pre-culture was used to start a 250-ml culture. E. coli cells were grown to an A600 of 0.5 and then induced with 1 mM isopropyl-D-thiogalactopyranoside (Promega) for 2 h. Bacteria were harvested by centrifugation and sonicated in 10 ml of buffer A (50 mM sodium phosphate, pH 8.0, 300 mM NaCl) containing 10 mM imidazole and complete protease inhibitor mixture (Roche Applied Science). The samples were centrifuged, and the supernatant was mixed with 1 ml of a 50% slurry of nickel-nitrilotriacetic acid superflow (Qiagen). The resin was washed with buffer A containing 20 mM imidazole and eluted with buffer A containing 250 mM imidazole. Fractions containing gARID1 were pooled, dialyzed in 25 mM HEPES, pH 7.9, 20 mM KCl, and 15% glycerol and stored at -70 °C. Protein purity and concentration were estimated by Coomassie Blue and silver staining compared with bovine serum albumin. gARID1 was purified to apparent homogeneity (>95%).

Electrophoretic Mobility Shift Assay—Double-stranded oligonucleotides specified in the text were 5'-end-labeled as described previously (16). Binding reaction mixtures contained the components described (16). Labeled probe (0.02 pmol) was incubated for 15 min at 25 °C with 5 ng of purified gARID1 protein in a 20-µl volume supplemented with 0.5 µg of poly(dI-dC) (Sigma). Competition reactions contained 200-fold molar excess of cold oligonucleotides. In an antibody supershift assay, 0.8 µg of an anti-V5-horseradish peroxidase antibody (Bethyl Laboratories) was added to the binding reaction mixture. The mixture was separated on a 4% acrylamide gel by electrophoresis.


Figure 1
View larger version (75K):
[in this window]
[in a new window]

 
FIGURE 1.
Alignment of loop2 and helix 5 in ARID domains. The loop2 and helix 5 of ARID domains from members of the human ARID family (for GenBankTM accession number, see Ref. 30), two Drosophila ARID proteins, DRI (accession number AAB05771) and Osa (accession number NP_732263), and two giardial ARIDs are analyzed by ClustalW 1.83 (47). Black boxes, identical amino acids; gray boxes, conserved amino acids; hyphens, gap in the respective proteins. A gray box indicates the helix 5 region in Drosophila DRI (27).

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Identification and Expression of garid1 Gene—To identify genes encoding novel ARID proteins from Giardia, we searched the G. lamblia genome data base (www.mbl.edu/Giardia) (38) using the amino acid sequence of a mouse ARID transcription factor, MRF2, that regulates smooth muscle cell differentiation, as a query sequence (GenBankTM accession number AF280065 [GenBank] ) (42). Amino acid sequences with similarity to the ARID domain were found in two proteins that we named gARID1 and 2 (GenBankTM accession number DQ88039 and DQ88040, respectively) (Fig. 1). We first focused on understanding the role of gARID1 in Giardia. Comparison of genomic and cDNA sequences showed that the garid1 gene contained no introns.

The deduced gARID1 protein contains 469 amino acids with a predicted molecular mass of ~52.5 kDa and a pI of ~6.4. The minimal structure of the ARID domain includes six {alpha}-helices (H1–H6) separated by beta-strands or loops, and it may extend to an additional helix at the N terminus or additional helices at both ends (H0 and H7) (26, 27). The H4-loop2-H5 region is similar to a helix-turn-helix structure (26, 27). Structural studies of Drosophila DRI show that loop2 and H5 contact the major groove and a beta-sheet or loop between H1 and H2 and sequences downstream of H6 contact the minor groove (Fig. 2) (27). Sequence alignment of the loop2 and helix 5 of the ARID domain shows that the ARID domain of gARID1 is highly similar to those of the human ARID3 subfamily (Fig. 1) (30). A neighbor-joining (43) phylogenetic tree obtained from the alignment of the loop2 and helix 5 also revealed similarity between gARID1 and the human ARID3 subfamily and between gARID2 and the human JARID2 or AIRD4 subfamily (data not shown). We further aligned the ARID domain of gARID1 with that of the human ARID3 subfamily and Drosophila DRI (Fig. 2). The ARID domain of gARID1 has 35% sequence identity and 51% sequence similarity to Drosophila DRI. Some of the key contact residues identified by structural studies of Drosophila DRI are conserved in gARID1 (Fig. 2) (27). Four residues in mouse Bright are important for DNA binding, Pro-268, Trp-299, Phe-317, and Tyr-330 (Fig. 2) (44). With the exception of Phe-317, all are conserved in Giardia gARID1 (Fig. 2). In contrast to the human ARID3 subfamily and Drosophila DRI, the ARID domains of which are central, the giardial ARID domains are near the N terminus (residues 1–98) (Fig. 2). Unlike the human ARID3 subfamily and Drosophila DRI, which contain H0 and H7 motifs at both ends (27), gARID1 may have an incomplete H0 or H7 (Fig. 2). The similarity between gARID1 and the human ARID3 subfamily or Drosophila DRI is limited to their ARID domains (data not shown). The C-terminal half of gARID1 was not highly conserved and had no apparent functional motif.


Figure 2
View larger version (44K):
[in this window]
[in a new window]

 
FIGURE 2.
Alignment of the ARID domains. The ARID domains from members of the human ARID3 subfamily, Drosophila DRI, and gARID1 are analyzed by ClustalW 1.83 (47). Black boxes, identical amino acids; gray boxes, conserved amino acids; hyphens, gap in the respective proteins. Gray box indicates the H0 to H7 region in Drosophila DRI (27). Residues in Drosophila DRI that contact the major groove and minor groove/phosphodiester backbone (27) are framed and underlined, respectively. Four residues important for DNA binding in mouse Bright, Pro-268, Trp-299, Phe-317, and Tyr-330, are indicated by asterisks (44). The Tyr-82 of gARID1 corresponds to Phe-317 of mouse Bright and is indicated by an arrow.

 


Figure 3
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 3.
Analysis of garid1 gene expression. A, RT-PCR analysis of garid1 gene expression. RNA samples were prepared from G. lamblia wild-type non-transfected WB cells cultured in growth (0) or encystation medium and harvested at 24 h (25). RT-PCR was performed using primers specific for garid1, cwp1, and ran genes. Ribosomal RNA loading controls are shown in the bottom panel. B, the pNA1 plasmid. A neo gene is under the control of the 5'- and 3'-flanking regions of the ran gene (dotted boxes). The garid1 gene is under the control of its own 5'-flanking region (open box) and the 3'-flanking region of the ran gene (dotted box). The filled box indicates the coding sequence of the AU1 epitope tag. The arrows show the directions of gene transcription. C, gARID1 protein levels in pNA1 stable transfectants. The pNA1 stable transfectants were cultured in growth medium (0) or encystation medium and harvested at 24 h (25). AU1-tagged gARID1 protein was detected using an anti-AU1 antibody by Western blot analysis. Coomassie-stained total protein loading control is shown below.

 
Expression of the garid1 Gene— RT-PCR analysis of total RNA showed a single ~1.4-kb transcript, in agreement with the size of the full-length garid1 gene (Fig. 3A). The garid1 transcript was present in vegetative cells and decreased significantly in 24-h encysting cells (Fig. 3A). The transcript levels of the garid1 gene also decreased slightly during early encystation (data not shown).

To determine the expression of gARID1 protein, we prepared construct pNA1 in which the garid1 gene is controlled by its own promoter and contains an AU1 epitope tag at its C terminus (Fig. 3B) and stably transfected it into Giardia.A ~56-kDa protein was detected (Fig. 3C), which is slightly larger than the predicted ~52.5-kDa molecular mass of gARID1 with the AU1 tag (~0.8 kDa). The levels of the gARID1 protein increased significantly in encysting cells (Fig. 3C). However, the levels of the garid1 message decreased significantly in encysting pNA1 cells, similar to the result in wild-type cells (data not shown, see Fig. 3A for wild-type cells). The lack of correlation between the steady state mRNA and protein levels could be due to an increase in translation rate or protein half-life.

Localization of the gARID1 Protein—The AU1-tagged gARID1 was detected exclusively in the nuclei during vegetative growth and encystation (Fig. 4, A and B), indicating that gARID1 is a nuclear protein in Giardia. Expression was ~25 and ~50% positive in vegetative and encysting cells, respectively. Some cytosolic staining was also observed in ~5 and ~10% of stained vegetative and encysting trophozoites, respectively (Fig. 4B; data not shown). The AU1-tagged gARID1 was also detected in four nuclei and the cytoplasm of some cysts (Fig. 4C).

Identification of the gARID1 DNA Binding Sites—The nuclear localization of gARID1 suggested that it might function as a transcription factor. Because its protein level increases during encystation, we tested the hypothesis that it may bind DNA and regulate the transcription of genes required for encystation. To test its DNA binding activity, we expressed gARID1 with a C-terminal V5 tag in E. coli and purified it to >95% homogeneity as assessed by silver-stained gels (data not shown). An anti-V5-horseradish peroxidase antibody specifically recognized the recombinant gARID1 (Fig. 5A).

To determine whether purified gARID1 binds DNA, we performed electrophoretic mobility shift assays with double-stranded DNA sequences from the 5'-flanking region of an encystation-induced gene, cwp1, and a constitutive gene, ran. Incubation of a labeled double-stranded DNA probe cwp1 -45/-1 (Table 1) with gARID1 resulted in the formation of shifted bands (Fig. 5B, lane 2). cwp1 -45/-1 is the region from -45 to -1 bp relative to the translation start site of the cwp1 gene. The sequence of this promoter is shown in Table 1. gARID1 did not bind to either single strand of the cwp1 -45/-1 probe (data not shown). gARID1 was shown to bind to cwp1 -90/-46, and within this region it bound to the 3'-region (cwp1 -68/-46), but not to the region cwp1 -90/-69 (Fig. 5B, lanes 6 and 7; Table 1). gARID1 also bound to a well characterized core promoter, ran -51/-20 (16), but not to ran -30/-1 or ran -81/-52 (Fig. 5B, lane 8; Table 1). The mobility of the gARID1-DNA complex did not change too much with the size of the probe, possibly because the mobility depends much on the size and charge of gARID1 and on the conformation of the gARID1-DNA complex (45).


View this table:
[in this window]
[in a new window]

 
TABLE 1
Oligonucleotides and electrophoretic mobility shifts

a The ability of oligonucleotides to bind to the gARID1 protein. The numbers show the binding activity of mutants relative to that of the wild-type cwp1 –45/–1 probe (mean ± S.E. of three independent experiments). "+", "+/–", and "–" represent DNA binding, weak binding, and no binding, respectively. The translation start sites are underlined. Base changes in the mutants tested are framed.

 


Figure 4
View larger version (112K):
[in this window]
[in a new window]

 
FIGURE 4.
Nuclear localization of gARID1. The pNA1 stable transfectants were cultured in growth medium (A) or encystation medium, harvested at 24 h (B), and then subjected to immunofluorescence analysis using anti-AU1 antibody for detection. Panels A–C show that the product of pNA1 localizes to the nuclei in vegetative trophozoites, encysting trophozoites, and cysts, respectively. There was some cytosolic staining in the stained cells.

 


Figure 5
View larger version (43K):
[in this window]
[in a new window]

 
FIGURE 5.
DNA binding ability of gARID1 as shown by electrophoretic mobility shift assays. A, Western blot analysis of recombinant gARID1 protein with a V5 tag at its C terminus purified by affinity chromatography. The gARID1 protein is detected by anti-V5 antibody. B, detection of gARID1 binding sites. Electrophoretic mobility shift assays were performed using purified gARID1 and various 32P end-labeled oligonucleotide probes (see Table 1). Components of the binding reaction mixtures are indicated above the lanes. Arrowhead indicates the shifted complex. Some reaction mixtures contained 200-fold molar excess of cold oligonucleotides cwp1 -45/-1 or ran -30/-1(NS)or0.8 µg of anti-V5 antibody as indicated above the lanes.

 
The binding specificity was confirmed by competition and supershift assays (Fig. 5B, lanes 3–5; additional data not shown). gARID1 bound to cwp1 -45/-1 or -68/-46 could be supershifted by an anti-V5-horseradish peroxidase antibody (lane 3; data not shown). The formation of the shifted cwp1 -45/-1 bands was almost totally competed by a 200-fold molar excess of unlabeled cwp1 -45/-1, but not by the same excess of a nonspecific competitor, ran -30/-1(lanes 4 and 5).

Scanning mutagenesis of the cwp1 -45/-1 probe showed that substitutions within the AGATC or AATAAAATA sequence significantly decreased the DNA-protein interaction (Fig. 6, lanes 4, 8, and 9) but mutations of the other regions caused a minor decrease in binding (lanes 2, 3, 5–7, and 10). Mutation of both regions almost abolished binding (lane 11). Substitutions of the three Ts within the AAATAAAATAT region decreased binding by ~50% (lane 12, Table 1). The gARID1 binding sequences or their antisense sequences in the cwp1 -45/-1 probe are similar to those of the known ARID family proteins that contain ATT, AT, or ATC sequences (27, 28, 31, 36). Likewise, two gARID1 binding regions, cwp1 -68/-46 and ran -51/-20, also contain the sequence ATC (Fig. 5B, lanes 7 and 8; Table 1). Mutation analysis of the cwp1 -68/-46 or ran -51/-20 probe revealed that the short AATCT or AATCG sequence was required for binding, respectively (Fig. 5B, lane 9; Table 1 and data not shown).

We also tested whether gARID1 binds to the 5'-flanking region of two other encystation-induced genes, cwp2 and cwp3. We found that gARID1 bound to the cwp3 -30/-1 probe (weakly) and the extended probes cwp2 -30/+8 and cwp3 -30/+10 (Fig. 5B, lanes 10 and 11; Table 1) but it did not bind to the cwp2 -30/-1 probe (Table 1 and data not shown), indicating that the extended probes cwp2 -30/+8 and cwp3 -30/+10 may include the whole gARID1 binding sites. The results suggest that gARID1 can bind to the cwp2 and cwp3 promoter regions. We also tested whether gARID1 binds to specific AT-rich sequences. Interestingly, gARID1 did not bind to a poly(A) sequence (Table 1 and data not shown) but bound to a poly(A) sequence with a T insertion or a TC insertion (Fig. 5B, lanes 12 and 13), indicating that the gARID1 binding sequence contains AT or ATC sequences.

gARID1 Binds to the Minor Groove and Contains Key Residues for DNA Binding—Studies suggest that Drosophila DRI and mouse Bright can bind to DNA minor grooves (27, 28). To investigate whether gARID1 can also bind to the minor groove, we used distamycin A, which binds to the minor groove of AT-rich DNA sequences, as a competitive inhibitor of gARID1 binding (28, 46). As shown in Fig. 6B, the binding of gARID1 to DNA decreased with increasing concentrations of distamycin A. The binding was completely inhibited at concentrations >0.56 mM.

Four residues of mouse Bright are known to be important for DNA binding, Pro-268, Trp-299, Phe-317, and Tyr-330 (Fig. 2) (44). These residues, with the exception of Phe-317, are conserved in Giardia gARID1 (Fig. 2). We tried to understand whether Tyr-82 of gARID1, which corresponds to Phe-317 of the mouse Bright, is also important for DNA binding (Fig. 2). The Tyr-82 was mutated to Ala, and the resulting gARID1 mutant (gARID1m) was expressed in E. coli and purified. We found that the purified gARID1m did not bind to cwp1 -45/-1, cwp1 -90/-46, ran -51/-20, or the other probes listed in Table 1 (data not shown), indicating that the Tyr-82 is important for DNA binding.

The gARID1 Binding Sequences Are Sufficient for Transcriptional Activation—We further investigated the ability of the gARID1 binding sites to regulate the cwp1 promoter by mutation analysis. The 5'-flanking region -409/-1 of the cwp1 gene was sufficient for up-regulation of the luciferase reporter gene during encystation (construct pPW1, induction ratio ~47.6, Fig. 7). Mutation of the -34 to -30 and -17 to -12 region, which spans the first gARID1 binding site and the AT-rich Inr element, resulted in significant decreases of luciferase activity to ~1.8 and ~3.7% of the pPW1 activity in vegetative and encysting cells, respectively (Fig. 7, pPW1m3). Mutation of the -18 to -8 region, which spans the whole AT-rich Inr element, also resulted in significant decreases in luciferase activity to ~0.5 and ~1.5% of the pPW1 activity in vegetative and encysting cells, respectively (Fig. 7, pPW1m4).

We further asked whether the decrease in luciferase activity was due to decreased mRNA levels. Two different transcripts, a full-length (1.7-kb) transcript and a 1.2-kb transcript, were detected in the pPW1 transfectants during both vegetative growth and encystation (Fig. 8). Two major transcription start sites, 13 bp upstream (-13) and 462 bp downstream (+462) of the luciferase translation start codon, were identified by 5'-RACE analysis of total RNA isolated from the pPW1 transfectants during encystation (Fig. 7, and data not shown). The 1.7- and 1.2-kb transcripts could be the result of transcription initiation upstream and downstream of the luciferase translation start codon, respectively. During vegetative growth, the levels of the 1.7-kb transcript decreased more than the levels of the 1.2-kb transcript in the pPW1m3 and pPW1m4 transfectants compared with the pPW1 transfectants (Fig. 8), indicating that mutation of the gARID1 binding sites spanning the AT-rich Inr resulted in a downstream shift in transcription start site selection. Therefore, the gARID1 binding sites are important for transcription start site selection during vegetative growth. During encystation, an upstream shift in transcription start site selection was found in all cell lines, irrespective of the presence of the mutated gARID1 binding sites (Fig. 8). The upstream transcription start sites in the pPW1m3 or pPW1m4 transfectants during encystation were shifted to -11, -19, and -21 upon mutating the gARID1 binding sites/Inr to GC-rich sequences (Fig. 7). The levels of both 1.7- and 1.2-kb transcripts decreased significantly in the pPW1m3 and pPW1m4 transfectants compared with the pPW1 transfectants during encystation (Fig. 8). These results indicate that the gARID1 binding sequences in the cwp1 gene promoter function as positive cis-acting elements during both vegetative growth and encystation.


Figure 6
View larger version (38K):
[in this window]
[in a new window]

 
FIGURE 6.
A, scanning mutagenesis of the cwp1 -45/-1 sequence containing the putative gARID1 binding site. Electrophoretic mobility shift assays were performed using purified gARID1 and various 32P end-labeled cwp1 -45/-1 mutant probes (see Table 1). B, effect of distamycin A on the binding of gARID1 to DNA. 32P end-labeled cwp1 -45/-1 probe was incubated with gARID1 in the absence (lane 1) or presence of distamycin A (lanes 3–6). Distamycin A was dissolved in Me2SO. Adding Me2SO to the reaction mix did not decrease the gARID1 binding activity (lane 2).

 


Figure 7
View larger version (13K):
[in this window]
[in a new window]

 
FIGURE 7.
Mutation analysis of the gARID1 binding sites in the cwp1 promoter region. In the pPW1 construct, a firefly luciferase gene (luc+, open box)is flanked by the 5'-(-409/-1) and 3'-flanking region of the cwp1 gene (gray boxes). The puromycin acetyltransferase (pac) gene is under the control of the 5'- and 3'-flanking region of the gdh gene (slashed boxes). Numbers of the 5'-flanking region of the cwp1 gene are relative to the translation start site (+1). Two CC nucleotides inserted upstream of the ATG start codon for plasmid construction are shown in lowercase italics. The gARID1 binding sequences are in bold. The mutated sequences in the constructs pPW1m3 and pPW1m4 are shown in bold. The transcription start sites determined by 5'-RACE from RNA extracted from 24-h encysting cells are indicated by arrowheads. After stable transfection with these constructs, luciferase activity was measured in vegetative cells. At least three independent experiments were performed with at least two samples for each construct. The results are shown as mean ± S.E. in the right panel.

 


Figure 8
View larger version (43K):
[in this window]
[in a new window]

 
FIGURE 8.
Mutation of gARID1 binding sites can decrease reporter transcript levels. Total RNA blots made from vegetative or 24-h encysting pPW1, pPW1m3, or pPW1m4 stable transfectants were hybridized with a luciferase gene probe. Ribosomal RNA loading controls are shown in the lower panels.

 
Transactivation of cwp1 Promoter Activity by gARID1—Identification of the gARID1 binding sequences in the cwp1 promoter allowed us to examine whether the gARID1 protein actually activates transcription of these promoters. Transactivation was examined by stably transfecting a reporter plasmid containing a luciferase gene into Giardia together with an effector plasmid pNA1 (Fig. 3B) in which expression of the full-length gARID1 was driven by its own promoter. Co-transfection of the pPW1 reporter construct that expressed the luciferase gene under the control of the cwp1 promoter (Fig. 7) (25) with pNA1 resulted in a ~2-fold increase in luciferase activity during normal growth compared with the activity in the pPW1 + pRANneo co-transfectants (data not shown) (pRANneo is the construct expressing only the neomycin selection marker; Fig. 3B, right part of pNA1) (41). In addition, when the luciferase gene was under the control of the ran 32-bp promoter in the ran32 construct (24), co-transfection with pNA1 did not increase luciferase activity compared with the activity in the ran32 + pRANneo co-transfectants (data not shown). The results indicate that the gARID1 can transactivate the cwp1 promoter but not the ran promoter.


Figure 9
View larger version (42K):
[in this window]
[in a new window]

 
FIGURE 9.
Transactivation of the cwp1 promoter by gARID1 in the co-transfection system. Total RNA blots made from vegetative pPW1/m3/m4+pRANneo and pPW1/m3/m4+pNA1 stable transfectants were hybridized with luciferase and cwp1 gene probes (upper panels). Ribosomal RNA loading controls are shown in the bottom panels. A representative experiment result from two independent experiments is shown. Similar results were obtained in two independent transfection experiments. The numbers show the relative activity, which reflects expression relative to that in controls.

 
To understand whether the increase in luciferase activity was due to increased mRNA levels, we measured the luciferase mRNA levels from different transfectants. Co-transfection of pNA1 into the pPW1 transfectants resulted in a ~1.6 to 1.8-fold increase in the levels of full-length 1.7-kb luciferase mRNA and endogenous cwp1 mRNA compared with the levels in the pPW1+pRANneo co-transfectants (Fig. 9), indicating that gARID1 can transactivate the cwp1 promoter.

We further asked whether gARID1 transactivates the cwp1 promoter through its binding sites. We found that the levels of the full-length 1.7-kb luciferase transcript decreased significantly in the pPW1m3 + pNA1 and pPW1m4 + pNA1 co-transfectants compared with their control cell lines (Fig. 9). However, the levels of the 1.2-kb transcript increased by ~1.8-fold in the pPW1m3 + pNA1 and pPW1m4 + pNA1 co-transfectants. Therefore, mutation of the gARID1 target sequences in the cwp1 promoter canceled the transactivation through the upstream transcription start sites by gARID1 but increased the transactivation through the downstream transcription start sites. The results suggest that gARID1 can transactivate the cwp1 promoter in vivo through its DNA binding sequences.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
ARID domains have been found in a wide variety of species, including yeast, nematodes, plants, insects, and, mammals (26, 27). Although divergent in sequence, giardial ARID1 and ARID2 are clearly recognizable as members of the ARID family. This suggests that the ARID family may have evolved before divergence of Giardia from the main eukaryotic line of descent. To date, gARID1 is the first ARID transcription factor identified in early diverging protozoan parasites. Further genomic analyses will reveal whether ARID family proteins are shared with other eukaryotic lineages such as Trichomonas vaginalis, Entamoeba histolytica, Plasmodium falciparum, and Trypanosoma brucei.

Although the ARID domain of gARID1 is similar to that of the human ARID3 subfamily, it may have incomplete H0 and H7 motifs. Our results indicate that, like members of the human ARID3 subfamily, gARID1 can bind to similar AT-rich specific sequences. gARID1 has three of the four residues in mouse Bright that are known to be important for DNA binding (Fig. 2) (44). We found that Tyr-82 of gARID1, which corresponds to Phe-317 of mouse Bright, was also required for gARID1 binding, indicating the importance of this residue. The ARID domain of the gARID2 is similar to that of the human ARID4 or JARID2 subfamily. However, these two subfamilies have no sequence-specific DNA binding activity or they do not bind AT-rich sequences. Further studies are needed to characterize the DNA binding activity of gARID2.

gARID1 has some but not all of the conserved residues in Drosophila DRI that contact the phosphodiester backbone, minor groove, or major groove (Fig. 2) (27). The binding sites of the ARID3 subfamily Bright and DRI and ARID5 subfamily MRF2 are (A/G)AT(T/A)AA, (A/G)ATTAA or TATTGAT, and AATA(C/T), respectively (28, 29, 31, 32). These sequences contain ATT or AT/ATC runs. Our results indicate that the AGATC or AATAAAATA sequence may be important for gARID1 binding. Further studies also indicate that gARID1 can bind to the poly(A) sequence with a T or TC insertion. These gARID1 binding sequences contain ATT or AT/ATC sequences on the coding or noncoding strand, indicating that the ARID family binding sites may have been conserved in evolution.

The giardial promoters, including the encystation-specific cwp promoters, defined to date are notably short and contain AT-rich Inr elements (810, 1517, 20, 24). Their proximal upstream regions also contain gMyb2 or GARP-like protein binding sites and these sequences are positive cis-acting elements (24, 25). Our current mutation analysis provides further evidence of the function of the AT-rich Inr elements. Mutation of the gARID1 target sequences/Inr in the cwp1 promoter might impair the binding of gARID1 or other Inr-binding proteins to the Inr, leading to a downstream shift in transcription start site selection during vegetative growth. During encystation, transcription start site selection of the cwp1 promoter was shifted upstream, irrespective of mutations in the gARID1 binding sites/Inr. Therefore, the binding of some encystation-specific transcription factors to proximal upstream regions might be important for the selection of the upstream transcription start sites. Interestingly, in the cwp2 promoter, an encystation-specific regulatory element (-23 to -10 region) is just next to the gARID1 binding sequences/Inr (-8 to -1 region) (20), making it more likely that there is an interaction between regulatory and general transcription factors. It should be noted that, during both vegetative growth and encystation, the levels of both transcripts resulting from upstream or downstream transcription start sites decreased significantly when the gARID1 binding sequences/Inr were mutated, suggesting that the gARID1 binding sequences/Inr could be important for basal promoter activity. Deletion and mutation analysis of the ran, {alpha}2-tubulin, and cwp2 promoters has provided evidence for involvement of AT-rich Inr elements in basal promoter activity (15, 16, 20). In addition, there may be a synergistic effect between the upstream or downstream transcription start sites. The synergistic effect may come from the interaction of gARID1 and other transcription factors with both transcription start sites.

ARID proteins in higher eukaryotes are involved in differentiation and function as transcriptional activators or repressors (26, 27). Our results show that gARID1 localizes mainly to the nuclei in both vegetative and encysting Giardia trophozoites. The increased levels of the gARID1 protein during encystation indicate that it may also play a role in differentiation. The findings that gARID1 binding sites/Inr in the cwp1 promoter are positive cis-acting elements and that overexpressed gARID1 can induce the cwp1 promoter activity indicate that gARID1 is involved, at least in part, in promoting cwp1 gene expression during encystation. The ability of gARID1 to transactivate the encystation-induced cwp1 gene may require the binding of other transcription factors to promoter elements or interaction with gARID1.

gARID1 can bind AT-rich Inr elements of both the constitutive ran gene and the encystation-induced cwp1, cwp2, and cwp3 genes, suggesting that gARID1 may be involved in transcriptional regulation of many different genes. It has been shown that the AT-rich Inr in the ran promoter is an important positive cis-acting element (16). However, in this study, overexpressed gARID1 did not transactivate the ran promoter. Although not proven, it is still possible that gARID1 is involved in transcriptional regulation of many different genes.

As gARID1 may bind to more than one AT-rich sequence in the cwp1 promoter region, it is likely that additional transcription factors binding to the AT-rich Inr element or interacting with gARID1 increase the specificity for transcriptional regulation in vivo. When the gARID1 target sequences/Inr element were mutated, the overexpressed gARID1 could not transactivate the cwp1 promoter through the upstream transcription start sites within the AT-rich Inr element, but its transactivation through the downstream transcription start sites increased. This indicates that gARID1 may transactivate the cwp1 promoter in vivo through its DNA binding sequences/Inr element and that binding of gARID1 or other Inr-binding proteins to the Inr are required for accurate transcription start site selection.

In summary, we have characterized gARID1 as a transcriptional activator of the Giardia cwp1 gene. Our studies provide new insights into the evolution of eukaryotic pathways of DNA binding in the early diverging protozoan G. lamblia.


    FOOTNOTES
 
The nucleotide sequence(s) reported in this paper has been submitted to the DDBJ/GenBankTM/EBI Data Bank with accession number(s) DQ88039 and DQ88040.

* This work was supported by grants from the National Science Council (NSC 94-2320-B-002-093) and the National Health Research Institutes (NHRI-EX95-9510NC) in Taiwan and in part by the Dept. of Medical Research in National Taiwan University Hospital. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed. Tel.: 886-2-23123456 (ext. 8262); Fax: 886-2-23915294; E-mail: chsun{at}ha.mc.ntu.edu.tw.

2 The abbreviations used are: Inr, initiator; ARID, AT-rich interaction domain; RT, reverse transcription; RACE, rapid amplification of cDNA ends. Back


    ACKNOWLEDGMENTS
 
We thank the researchers and administrators of the G. lamblia Genome data base. We also thank Dr. Frances D. Gillin for valuable discussions and Dr. Janet Yee for helpful comments on the electrophoretic mobility shift assay experiments.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Adam, R. D. (2001) Clin. Microbiol. Rev. 14, 447-475[Abstract/Free Full Text]
  2. Wolfe, M. S. (1992) Clin. Microbiol. Rev. 5, 93-100[Abstract/Free Full Text]
  3. Eichinger, D. (2001) Curr. Opin. Microbiol. 4, 421-426[CrossRef][Medline] [Order article via Infotrieve]
  4. Gillin, F. D., Reiner, D. S., Gault, M. J., Douglas, H., Das, S., Wunderlich, A., and Sauch, J. F. (1987) Science 235, 1040-1043[Abstract/Free Full Text]
  5. Gillin, F. D., and Reiner, D. S. (1996) Annu. Rev. Microbiol. 50, 679-705[CrossRef][Medline] [Order article via Infotrieve]
  6. Lujan, H. D., Mowatt, M. R., and Nash, T. E. (1997) Microbiol. Mol. Biol. Rev. 61, 294-304[Abstract]
  7. Erlandsen, S. L., Macechko, P. T., van Keulen, H., and Jarroll, E. L. (1996) J. Eukaryot. Microbiol. 43, 416-429[Medline] [Order article via Infotrieve]
  8. Lujan, H. D., Mowatt, M. R., Conrad, J. T., Bowers, B., and Nash, T. E. (1995) J. Biol. Chem. 270, 29307-29313[Abstract/Free Full Text]
  9. Mowatt, M. R., Lujan, H. D., Cotton, D. B., Bower, B., Yee, J., Nash, T. E., and Stibbs, H. H. (1995) Mol. Microb. 15, 955-963[CrossRef][Medline] [Order article via Infotrieve]
  10. Sun, C. H., McCaffery, J. M., Reiner, D. S., and Gillin, F. D. (2003) J. Biol. Chem. 278, 21701-21708[Abstract/Free Full Text]
  11. Knodler, L. A., Svard, S. G., Silberman, J. D., Davids, B. J., and Gillin, F. D. (1999) Mol. Microbiol. 34, 327-340[CrossRef][Medline] [Order article via Infotrieve]
  12. Van Keulen, H., Steimle, P. A., Bulik, D. A., Borowiak, R. K., and Jarroll, E. L. (1998) J. Eukaryot. Microbiol. 45, 637-642[Medline] [Order article via Infotrieve]
  13. Sogin, M. L., Gunderson, J. H., Elwood, H. J., Alonso, R. A., and Peattie, D. A. (1989) Science 243, 75-77[Abstract/Free Full Text]
  14. Inagaki, Y., Blouin, C., Susko, E., and Roger, A. J. (2003) Nucleic Acids Res. 31, 4227-4237[Abstract/Free Full Text]
  15. Elmendorf, H. G., Singer, S. M., Pierce, J., Cowan, J., and Nash, T. E. (2001) Mol. Biochem. Parasitol. 113, 157-169[CrossRef][Medline] [Order article via Infotrieve]
  16. Sun, C. H., and Tai, J. H. (1999) J. Biol. Chem. 274, 19699-19706[Abstract/Free Full Text]
  17. Yee, J., Mowatt, M. R., Dennis, P. P., and Nash, T. E. (2000) J. Biol. Chem. 275, 11432-11439[Abstract/Free Full Text]
  18. Bruderer, T., Wehrli, C., and Kohler, P. (1996) Mol. Biochem. Parasitol. 77, 225-233[CrossRef][Medline] [Order article via Infotrieve]
  19. Holberton, D. V., and Marshall, J. (1995) Nucleic Acids Res. 23, 2945-2953[Abstract/Free Full Text]
  20. Davis-Hayman, S. R., Hayman, J. R., and Nash, T. E. (2003) Int. J. Parasitol. 33, 1005-1012[CrossRef][Medline] [Order article via Infotrieve]
  21. Worgall, T. S., Davis-Hayman, S. R., Magana, M. M., Oelkers, P. M., Zapata, F., Juliano, R. A., Osborne, T. F., Nash, T. E., and Deckelbaum, R. J. (2004) J. Lipid Res. 45, 981-988[Abstract/Free Full Text]
  22. Best, A. A., Morrison, H. G., McArthur, A. G., Sogin, M. L., and Olsen, G. J. (2004) Genome Res. 14, 1537-1547[Abstract/Free Full Text]
  23. Seshadri, V., McArthur, A. G., Sogin, M. L., and Adam, R. D. (2003) J. Biol. Chem. 278, 27804-27810[Abstract/Free Full Text]
  24. Sun, C. H., Palm, D., McArthur, A. G., Svard, S. G., and Gillin, F. D. (2002) Mol. Microbiol. 46, 971-984[CrossRef][Medline] [Order article via Infotrieve]
  25. Sun, C. H., Su, L. H., and Gillin, F. D. (2006) Mol. Biochem. Parasitol. 146, 45-57[CrossRef][Medline] [Order article via Infotrieve]
  26. Wilsker, D., Patsialou, A., Dallas, P. B., and Moran, E. (2002) Cell Growth Differ. 13, 95-106[Abstract/Free Full Text]
  27. Iwahara, J., Iwahara, M., Daughdrill, G. W., Ford, J., and Clubb, R. T. (2002) EMBO J. 21, 1197-1209[CrossRef][Medline] [Order article via Infotrieve]
  28. Herrscher, R. F., Kaplan, M. H., Lelsz, D. L., Das, C., Scheuermann, R., and Tucker, P. W. (1995) Genes Dev. 9, 3067-3082[Abstract/Free Full Text]
  29. Shandala, T., Kortschak R. D., Gregory, S., and Saint, R. (1999) Development 126, 4341-4349[Abstract]
  30. Wilsker, D., Probst, L., Wain, H. M., Maltais, L., Tucker, P. W., and Moran, E. (2005) Genomics 86, 242-251[CrossRef][Medline] [Order article via Infotrieve]
  31. Gregory, S. L., Kortschak, R. D., Kalionis, B., and Saint, R. (1996) Mol. Cell. Biol. 16, 792-799[Abstract]
  32. Whitson, R. H., Huang, T., and Itakura, K. (1999) Biochem. Biophys. Res. Commun. 258, 326-331[CrossRef][Medline] [Order article via Infotrieve]
  33. Dallas, P. B., Pacchione, S., Wilsker, D., Bowrin, V., Kobayashi, R., and Moran, E. (2000) Mol. Cell. Biol. 20, 3137-3146[Abstract/Free Full Text]
  34. Collins, R. T., Furukawa, T., Tanese, N., and Treisman, J. E. (1999) EMBO J. 18, 7029-7040[CrossRef][Medline] [Order article via Infotrieve]
  35. Wilsker, D., Patsialou, A., Zumbrun, S. D., Kim, S., Chen, Y., Dallas, P. B., and Moran, E. (2004) Nucleic Acids Res. 32, 1345-1353[Abstract/Free Full Text]
  36. Kim, T. G., Kraus, J. C., Chen, J., and Lee, Y. (2003) J. Biol. Chem. 278, 42247-42255[Abstract/Free Full Text]
  37. Keister, D. B. (1983) Trans. R. Soc. Trop. Med. Hyg. 77, 487-488[CrossRef][Medline] [Order article via Infotrieve]
  38. McArthur, A. G., Morrison, H. G., Nixon, J. E., Passamaneck, N. Q., Kim, U., Hinkle, G., Crocker, M. K., Holder, M. E., Farr, R., Reich, C. I., Olsen, G. E., Aley, S. B., Adam, R. D., Gillin, F. D., and Sogin, M. L. (2000) FEMS Microbiol. Lett. 189, 271-273[CrossRef][Medline] [Order article via Infotrieve]
  39. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Nucleic Acids Res. 25, 3389-3402[Abstract/Free Full Text]
  40. Sun, C. H., Su, L. H., and Gillin, F. D. (2005) Mol. Biochem. Parasitol. 142, 1-11[CrossRef][Medline] [Order article via Infotrieve]
  41. Sun, C. H., Chou, C. F., and Tai, J. H. (1998) Mol. Biochem. Parasitol. 92, 123-132[CrossRef][Medline] [Order article via Infotrieve]
  42. Watanabe, M., Layne, M. D., Hsieh, C. M., Maemura, K., Gray, S., Lee, M. E., and Jain, M. K. (2002) Circ. Res. 91, 382-389[Abstract/Free Full Text]
  43. Saitou, N., and Nei, M. (1987) Mol. Biol. Evol. 4, 406-425[Abstract]
  44. Nixon, J. C., Rajaiya, J., and Webb, C. F. (2004) J. Biol. Chem. 279, 52465-52472[Abstract/Free Full Text]
  45. Buratowski, S., and Chodosh, L. A. (2006) in Current Protocols in Molecular Biology (Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K., eds) p. 12.1.9, John Wiley and Sons, Inc., Hoboken, NJ
  46. Dickinson, L. A., Joh, T., Kohwi, Y., and Kohwi-Shigematsu, T. (1992) Cell 70, 631-645[CrossRef][Medline] [Order article via Infotrieve]
  47. Chenna, R., Sugawara, H., Koike, T., Lopez, R., Gibson, T. J., Higgins, D. G., and Thompson, J. D. (2003) Nucleic Acids Res. 31, 3497-3500[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An addition or correction has been published
Right arrow All Versions of this Article:
282/12/8905    most recent
M611170200v1
Right arrow Alert me when this article is cited
Right arrow