HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 282, Issue 13, 9358-9363, March 30, 2007

This Article Abstract Full Text (PDF) All Versions of this Article: 282/13/9358    most recent C600321200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yang, X. O. Articles by Dong, C. Search for Related Content PubMed PubMed Citation Articles by Yang, X. O. Articles by Dong, C. Social Bookmarking                      What's this?

STAT3 Regulates Cytokine-mediated Generation of Inflammatory Helper T Cells^*

Xuexian O. Yang, Athanasia D. Panopoulos¹, Roza Nurieva²³, Seon Hee Chang³, Demin Wang, Stephanie S. Watowich, and Chen Dong⁴

From the Department of Immunology, M.D. Anderson Cancer Center, Houston, Texas 77030 and the Blood Research Institute, Blood Center of Wisconsin, Milwaukee, Wisconsin 53226

Received for publication, December 28, 2006 , and in revised form, January 16, 2007.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Interleukin-17 (IL-17)-producing helper T (TH) cells, named as TH_IL-17, TH17, or inflammatory TH (THi), have been recently identified as a novel effector lineage. However, how cytokine signals mediate THi differentiation is unclear. We found that IL-6 functioned to up-regulate IL-23R and that IL-23 synergized with IL-6 in promoting THi generation. STAT3, activated by both IL-6 and IL-23, plays a critical role in THi development. A hyperactive form of STAT3 promoted THi development, whereas this differentiation process was greatly impaired in STAT3-deficient T cells. Moreover, STAT3 regulated the expression of retinoic acid receptor-related orphan receptor -T (RORt), a THi-specific transcriptional regulator; STAT3 deficiency impaired RORt expression and led to elevated expression of T-box expressed in T cells (T-bet) and Forkhead box P3 (Foxp3). Our data thus demonstrate a pathway whereby cytokines regulate THi differentiation through a selective STAT transcription factor that functions to regulate lineage-specific gene expression.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
CD4+ helper T (TH)⁵ cells are essential organizers in immune responses. Upon activation, naive TH cells differentiate into effector cells that have been historically classified into two lineages, TH1 and TH2, based on their cytokine secretion and immune regulatory function (1, 2). TH1 cells secret IFN- and regulate cellular immunity, whereas TH2 cells produce IL-4, IL-5, and IL-13 and mediate the humoral response. The cytokine microenvironment during TH activation determines TH effector differentiation through selective signal transducer and activator of transcription (STAT) proteins (3, 4). TH1 differentiation and IFN- production is promoted by IL-12, a heterodimeric cytokine produced by activated antigen-presenting cells that signal through STAT4. The IFN--STAT1 pathway in turn sustains TH1 development, leading to the induction of transcription factor T-bet. On the other hand, IL-4, secreted by activated T cells, drives TH2 polarization in a STAT6-dependent manner, resulting in activation of the transcription factor GATA3.

Recently, a third subset of TH cells, named as TH_IL-17, TH17, or inflammatory TH (THi), which produce IL-17, was identified by us as well as other investigators to mediate a pathogenic inflammatory response (5–7). THi cells were also found to produce IL-17F and IL-22 (5, 7–9). IL-23, sharing a p40 unit with IL-12, has been first found to regulate IL-17 expression and the development or expansion of THi cells in vitro (5–7). More recently, several groups showed that TGF- in the context of IL-6 and other inflammatory cytokines supports THi differentiation in vitro, independent of IL-23 (10–12), possibly at least in part by regulating the chromatin remodeling of the IL-17-IL-17F locus (13). IL-1 and TNF- may also be involved in promoting THi development or in regulating expression of IL-17 at the effector phase (11, 14).

The downstream signaling pathways, such as STAT, that selectively mediate THi generation are unclear. STAT1 appears to negatively regulate THi differentiation (7), whereas STAT4 or STAT6 were not involved (6). Recently, Socs3-deficient T cells were found to exhibit enhanced IL-17 expression; this effect was associated with enhanced activity of STAT3 in response to IL-23 that could bind to IL-17 and IL-17F promoters (15). STAT3 has critical functions in the immune system, including control of dendritic cell production, inhibition of macrophage inflammatory signaling, and regulation of steady state and emergency granulopoiesis (16–18). However, the precise physiological function of STAT3 in THi lineage differentiation has not been directly addressed. Whether STAT5, another STAT protein that has been shown activated by IL-23R (19), has any function in THi differentiation is also unclear.

In this study, we show that IL-6 up-regulates expression of IL-23R and that IL-23 synergizes with IL-6 in promoting THi differentiation. Retroviral expression of a hyperactive STAT3 enhances THi cell development. STAT3 deficiency in CD4 T cells results in impaired THi development and a deficiency in RORt, a THi-specific transcription factor recently identified (20). These data indicate that STAT3 is a cytokine-activated essential regulator in THi development.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Mice and Immunization—Il-6- and Ifng-deficient mice were purchased from Jackson Laboratories. Stat3 fl and Tie2-Cre mice were generously provided by Drs. Takeda and Koni (21, 22) and were bred to yield fl/ Cre+ and Cre–littermates as described (18). Mice were housed in the specific pathogen-free animal facility at M.D. Anderson Cancer Center, and the animal experiments were performed using protocols approved by the Institutional Animal Care and Use Committee at M.D. Anderson Cancer Center. For immunization, Il-6 knock-out and C57BL/6 mice were inoculated with MOG_35–55 peptide in CFA. 5–7 days later, splenocytes were collected from the immunized mice and restimulated with MOG peptide for 3 days. In the final 5 h, Golgi-stop (BD Biosciences) was added, and IL-17- and IFN--producing cells were analyzed using a BD CytoFix/CytoPerm intracellular staining kit (BD Biosciences) following the manufacturer's instructions.

TH Differentiation—Naive CD4+ T cells were isolated from spleen and lymph nodes of various strains of mice by AutoMACS (Miltenyi Biotec) selection of CD62L+ or FACS sorting of CD4+CD62L+CD44loCD25–T cells after enriching CD4+ T cells by negative selection using rat anti-mouse antibodies for CD8, B220, and I-A/I-E and Qiagen BioMag® goat anti-rat IgG beads. T cells were activated with plate-bound anti-CD3 (2 µg/ml) and anti-CD28 (2 µg/ml) and 50 units/ml IL-2 in the presence or absence of 20 ng/ml IL-6 (Peprotech), 50 ng/ml IL-23 (R&D systems), 2 ng/ml TGF- (Sigma-Aldrich), 10 µg/ml anti-IL-4 (11B11), or 10 µg/ml anti-IFN- (XMG1.2), 10 ng/ml TNF-, 10 ng/ml IL-1, or cocktails of these stimuli, as indicated. 4 days after activation, cells were restimulated with 500 ng/ml ionomycin and 50 ng/ml phorbol 12-myristate 13-acetate (Sigma-Aldrich) in the presence of Golgi-stop for 5 h, after which IL-17- and IFN--producing cells were analyzed using intracellular staining as described above. Intracellular staining for FoxP3 was performed by using a FoxP3 staining kit (eBioscience).

Retroviral Transduction—STAT3C (a gift from J. Darnell's laboratory) (24) was cloned into the bicistronic retroviral vector pGFP-RV (25). Stat5A and Stat5A 1*6 sequences were cloned into a bicistronic retrovirus MSCV-IRES-GFP vector (26). The expression of the cloned gene and green fluorescent protein (GFP) is under murine stem cell virus (MSCV) promoter control. The ecotropic virus-producing cells GP+E86 (27) were generated as described previously (28). Naive CD4+ T cells were activated under the indicated conditions for 2 days and infected with viral supernatants produced by the stable lines as described previously (25). 2–4 days after infection, the cells were tested for IL-17 and IFN- expression using intracellular staining. In some experiments, GFP+ cells were sorted by FACS and subjected to analysis for gene expression.

Quantitative Real-time PCR—Total RNA was prepared from T cells using TRIzol reagent (Invitrogen). cDNA was synthesized using SuperScript reverse transcriptase under priming of oligo(dT) (Invitrogen), and gene expression was examined in a Bio-Rad iCycler optical system using the iQ^TM SYBR green real-time PCR kit (Bio-Rad Laboratories, Inc.). The data were normalized to -actin reference. The primers used were (5' to 3'): IFN-, forward, GATGCATTCATGAGTATTGCCAAGT, and reverse, GTGGACCACTCGGATGAGCTC; T-bet, forward, CAACAACCCCTTTGCCAAAG, and reverse, TCCCCCAAGCAGTTGACAGT; GATA3, forward, AGAACCGGCCCCTTATGAA, and reverse, AGTTCGCGCAGGATGTCC; and -actin, forward, GACGGCCAGGTCATCACTATTG, and reverse, AGGAAGGCTGGAAAAGAGCC. The primers for IL-12R2, IL-23R, IL-17, IL-17F, RORt, Foxp3, and IL-22 were synthesized as described previously (7, 8, 20, 29, 30).

	RESULTS AND DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
IL-6 Induces IL-23 Responsiveness during THi Differentiation—IL-6 and IL-23 are both induced in innate immune responses to infectious agents. IL-23 was previously shown to be important in the development or expansion of THi cells in vivo (5), whereas IL-6 is potent in THi development in vitro and has recently been shown to be necessary in RORt-dependent IL-17 expression in the lamina propria (20). To further examine whether IL-6 is required for THi differentiation in vivo, C57BL/6 and Il-6 knock-out mice were immunized with MOG peptide and CFA. 5–7 days later, splenocytes collected from the immunized mice were restimulated with MOG peptide and stained for CD4, IL-17, and IFN-. In Il-6 knock-out mice, THi cells were greatly reduced relative to WT mice, whereas IFN--producing TH1 cells were only moderately affected (Fig. 1A).

IL-6 and IL-23 are thus both important in regulation of THi cells in vivo. We attempted to analyze their functional relationship during THi differentiation. Because IFN- has been shown as a potent inhibitor of THi differentiation (6, 7), we next isolated naive TH cells from IFN--deficient mice and activated them with plate-bound anti-CD3 and anti-CD28 in the presence of different cytokines and/or cytokine-neutralizing antibodies. 4–5 days after activation, the differentiated cells were analyzed by intracellular staining. IL-6 increased the number of IL-17-expressing THi cells, which was more pronounced in the presence of anti-IL-4 or, even more dramatically, TGF- (Fig. 1B). Although IL-23 was a poor inducer of THi differentiation by itself, the combination of IL-6 and IL-23 led to greatly enhanced development of THi cells (Fig. 1B). To substantiate the synergy between IL-6 and IL-23, we purified CD4+CD25-CD62LhiCD44lo naive TH cells from C57BL/6 mice and activated them with anti-CD3 and anti-CD28 in the presence of IL-6 and/or IL-23 for 5 days and analyzed THi differentiation by intracellular staining. IL-6 weakly induced THi differentiation (Fig. 1C). Although IL-23 had no effect on its own, it synergized with IL-6 in promoting generation of IL-17-expressing TH cells (Fig. 1C). We also observed synergy of IL-6 and IL-23 in THi differentiation of naive OT-II cells activated with antigen-presenting cells in the presence or absence of TGF- (data not shown). Our data thus not only support a unique function of IL-6 in initiating THi differentiation but also, more importantly, demonstrate a synergistic action of IL-6 and IL-23.

To further understand why IL-23 only functions in IL-6-treated cells, we stimulated naive TH cells with anti-CD3 and anti-CD28 for 48 h in the presence of IL-6 and/or IL-23 and examined expression of IL-23R by real-time RT-PCR analysis. Interestingly, whereas T cells after activation moderately up-regulated IL-23R mRNA in the presence or absence of IL-23, IL-6 increased the expression of IL-23R in activated T cells by >120-fold (Fig. 1D). Our above results altogether indicate that THi differentiation is initially mediated by IL-6, which induces IL-23 responsiveness to enhance this differentiation

View larger version (32K): [in this window] [in a new window]   FIGURE 1. IL-6 and IL-23 synergize in regulating THi cell development. A, Il-6 knock-out (IL-6 KO) or B6 mice were immunized with MOG/CFA. 5–7 days after immunization, splenocytes were harvested from the immunized mice and restimulated with MOG peptide for 3 days. Cells expressing IL-17 and IFN- were accessed using intracellular staining. Unimmunized B6 control is shown as B6 noim. The experiments were repeated twice with similar results. B, CD4+CD62Lhi T cells isolated from Ifng knock-out mice using AutoMACS were activated with plate-bound anti-CD3 and anti-CD28 in the presence or absence of indicated cytokines and/or cytokine-neutralizing antibodies. IL-17-producing cells were tested using intracellular staining. The experiments were repeated twice with similar results. NO, medium. C, FACS-sorted CD4+CD25-CD62LhiCD44lo naive T cells from C57BL/6 mice were activated with plate-bound anti-CD3 and anti-CD28 in the presence of indicated cytokines, and IL-17-producing cells were assessed using intracellular staining. D, naive T cells isolated as in C were activated with plate-bound anti-CD3 and anti-CD28 in the absence or presence of IL-23 or IL-6 for 24 h, and IL-23R mRNA expression was examined by real-time PCR. The data shown were normalized to expression of a reference gene -actin, and the expression level in naive T cells was referred as 1.

We next went on to determine the role of STAT3, which could be activated by both IL-6 and IL-23 (18, 22), by overexpressing a hyperactive STAT3 form (STAT3C) (24). Naive CD4+ T cells isolated from Ifng knock-out mice were activated as above and infected with STAT3C and control viruses. Under neutral conditions or in the presence of TGF- or anti-IL-4, STAT3C increased IL-17-expressing cells when compared with those infected with a control vector. Since the activation of STAT3C still requires cytokine-mediated phosphorylation, in the presence of IL-6 and IL-23 or under THi differentiation conditions, STAT3C greatly increased the numbers of IL-17-producing cells (Fig. 2A). Similarly, when we infected wild-type CD4+ T cells, STAT3C also enhanced THi differentiation under THi but not neutral condition (Fig. 2B). THi cells were also reported to produce IL-17F (5, 7). In wild-type cells transduced with STAT3C, when compared with those infected by a control virus, IL-17F expression was also greatly enhanced (Fig. 2C) when we used an antibody specific for IL-17F.⁶

To further assess the effect of STAT3C during TH cell differentiation, expression of TH lineage-specific genes was examined in wild-type TH cells that were transduced with vector or STAT3C virus and differentiated under THi conditions. Using quantitative real-time PCR, when compared with vector control, STAT3C transduction resulted in up-regulation of IL-23R and THi cytokines IL-17 and IL-17F and suppression of TH1-specific IL-12R2 and IFN- (Fig. 2D). Remarkably, IL-22, a cytokine expressed in THi cells that may synergize with IL-17 in inflammation (8, 9), was highly up-regulated in STAT3C-transduced TH cells. Moreover, STAT3 overactivation also reduced GATA3 and T-bet expression but increased the expression of RORt, a transcription regulator of THi differentiation (20). Thus, STAT3 promotes the THi program and inhibits TH1 and TH2 programs.

View larger version (30K): [in this window] [in a new window]   FIGURE 2. STAT3 hyperactivation promotes THi differentiation in vitro. CD4+CD62Lhi naive T cells from Ifng-deficient (A) or WT(B) mice were purified by AutoMACS and activated under indicated conditions for 2 days and infected with STAT3C or control viruses. 2 days after infection and culture under the indicated differentiation conditions, the cells expressing IL-17 were examined by intracellular staining. The analysis was gated on CD4+GFP+ cells. The experiment was repeated at least three times with consistent results. C, naive CD4 T cells were activated under THi conditions and infected with STAT3C or control viruses, and the cells expressing IL-17F were analyzed using intracellular staining on gated CD4+GFP+ cells. D, naive CD4+ T cells were activated under THi conditions and infected with STAT3C or control viruses under THi conditions. After infection, CD4+GFP+ cells were sorted by FACS, and gene expression was measured by quantitative real-time RT-PCR. The data shown are -fold changes of STAT3C versus vector control normalized to expression of a reference gene -actin.

In addition to the above cytokine measurement, we also performed real-time RT-PCR analysis on Stat3-sufficient and -deficient TH cells that were activated under conditions favoring THi differentiation. Consistent with the previous data, we observed greatly reduced IL-17 as well as IL-17F and IL-22 expression and moderately elevated IFN- expression in Stat3-deficient TH cells (Fig. 3C). IL-23 receptor mRNA expression was down-regulated, whereas IL-12R1 was up-regulated in the absence of STAT3 (Fig. 3C). Most importantly, expression of RORt was greatly reduced in Stat3-deficient TH cells, indicating that STAT3 is necessary for RORt expression during THi differentiation. Moreover, expression of T-bet and Foxp3 was increased (Fig. 3C), suggesting that STAT3 may repress TH1 and inducible regulatory T cell differentiation. Indeed, there was a greater number of Foxp3-expressing TH cells in the absence of STAT3 after T cell activation (Fig. 3B), suggesting that the ability of IL-6 to suppress inducible regulatory T cells generation is dependent on STAT3.

View larger version (34K): [in this window] [in a new window]   FIGURE 3. THi differentiation is dependent on STAT3. A–C, FACS-sorted CD4+CD25-CD62LhiCD44lo T cells from Stat3 fl/ Tie2-Cre+ mice (STAT3 KO) or littermate Cre–mice (WT) were differentiated under THi conditions. 4 days after polarization, the differentiated cells were assessed for IL-17 or IFN- production (A) or FoxP3 expression (B) using intracellular staining. Some cells were restimulated with plate-bound anti-CD3, and messenger RNA expression was analyzed by quantitative real-time RT-PCR (C). The data shown are -fold changes of STAT3 KO versus WT control normalized to expression of the -actin reference. D, memory CD4 T cells were isolated from Stat3 KO mice or WT littermate controls were activated with plate-bound anti-CD3 for 24 h, and the cells producing IL-17 or IFN- were assessed by intracellular staining. The data represent at least two independent experiments with consistent results.

THi cells have been recently identified as a novel lineage of TH cells that mediate inflammatory responses. The molecular programs underlying THi differentiation are largely unclear. In our current study, we find a synergistic function of IL-6 and IL-23 in THi differentiation. STAT3, activated by IL-6 and IL-23, is both necessary and sufficient for THi differentiation. Therefore, STAT3 may serve as a selective STAT protein in cytokine-mediated THi cell differentiation. It is important to determine how STAT3 specifically regulates this process. An earlier report found STAT3 binding to the promoters of Il-17 and Il-17F genes, which was enhanced in Socs3-deficient T cells (15). This observation suggests that STAT3 may function downstream of IL-23 by directly activating Il-17 and Il-17F gene transcription. Although this may be the case for effector/memory cells, our current study reveals another, perhaps more critical, function of STAT3 during early T cell differentiation in regulating the expression of RORt, a THi-specific transcription regulator. Since RORt overexpression promoted THi differentiation and its deficiency greatly impaired this process (20), it may serve as a lineage-specifying master regulator in THi development. STAT3 may function, analogous to STAT4 for TH1 and STAT6 in TH2, to regulate lineage-specific expression of RORt, which then in turn results in terminal differentiation of THi cells. Taken together, our observations suggest that STAT3 is an upstream regulator of RORt. In addition, Foxp3 expression was elevated in the absence of STAT3, correlating with a crucial role of IL-6 in suppressing TGF--induced regulatory T cell differentiation (12). The inhibitory function of STAT3 or its downstream target-RORt in Treg cells remains to be further examined in the future.

In conclusion, we show that STAT3 is an essential regulator activated by cytokine signals to control lineage commitment of THi cells. This adds another function of STAT3 in inflammation by inducing a subset of adaptive pro-inflammatory cells. STAT3 inhibitors may have additional potential in therapeutic intervention of inflammatory diseases.

	FOOTNOTES

 
^* This work was supported by research grants from the National Institutes of Health (to C. D. and D. W.), American Cancer Society (to D. W.), and M. D. Anderson Cancer Center (to S. S. W.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ Supported by an National Institutes of Health training grant and an American Legion Auxiliary Award.

² Recipient of a scientist development grant from the American Heart Association.

³ Recipients of postdoctoral fellowships from the Arthritis Foundation.

⁴ A Cancer Research Institute Investigator and an M. D. Anderson Cancer Center Trust Fellow. To whom correspondence should be addressed. Fax: 713-563-0604; E-mail: cdong{at}mdanderson.org.

⁵ The abbreviations used are: TH, CD4 helper T cells; THi, inflammatory TH; STAT, signal transducer and activator of transcription; IL, interleukin; TGF-, transforming growth factor; TNF-, tumor necrosis factor; IFN-, interferon ; RORt, RAR-related orphan receptor -T; RAR, retinoic acid receptor; T-bet, T-box expressed in T cells; GATA3, GATA-binding protein 3; FoxP3, Forkhead box P3; FACS, fluorescence-activated cell sorter; GFP, green fluorescent protein; MSCV, murine stem cell virus; IRES, internal ribosome entry site; CFA, complete Freund's adjuvant; WT, wild type.

⁶ S. H. Chang and C. Dong, unpublished data.

	ACKNOWLEDGMENTS

 
We thank the Dong laboratory members for their help.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 

1. Mosmann, T. R., and Coffman, R. L. (1989) Annu. Rev. Immunol. 7, 145–173[CrossRef][Medline] [Order article via Infotrieve]
2. Dong, C., and Flavell, R. A. (2000) Arthritis Res. 2, 179–188[CrossRef][Medline] [Order article via Infotrieve]
3. Glimcher, L. H., and Murphy, K. M. (2000) Genes Dev. 14, 1693–1711[Free Full Text]
4. Dong, C. (2006) Nat. Rev. Immunol. 6, 329–333[CrossRef][Medline] [Order article via Infotrieve]
5. Langrish, C. L., Chen, Y., Blumenschein, W. M., Mattson, J., Basham, B., Sedgwick, J. D., McClanahan, T., Kastelein, R. A., and Cua, D. J. (2005) J. Exp. Med. 201, 233–240[Abstract/Free Full Text]
6. Park, H., Li, Z., Yang, X. O., Chang, S. H., Nurieva, R., Wang, Y. H., Wang, Y., Hood, L., Zhu, Z., Tian, Q., and Dong, C. (2005) Nat. Immunol. 6, 1133–1141[CrossRef][Medline] [Order article via Infotrieve]
7. Harrington, L. E., Hatton, R. D., Mangan, P. R., Turner, H., Murphy, T. L., Murphy, K. M., and Weaver, C. T. (2005) Nat. Immunol. 6, 1123–1132[CrossRef][Medline] [Order article via Infotrieve]
8. Chung, Y., Yang, X., Chang, S. H., Ma, L., Tian, Q., and Dong, C. (2006) Cell Res. 16, 902–907
9. Liang, S. C., Tan, X.-Y., Luxenberg, D. P., Karim, R., Dunussi-Joannopoulos, K., Collins, M., and Fouser, L. A. (2006) J. Exp. Med. 203, 2271–2279[Abstract/Free Full Text]
10. Mangan, P. R., Harrington, L. E., O'Quinn, D. B., Helms, W. S., Bullard, D. C., Elson, C. O., Hatton, R. D., Wahl, S. M., Schoeb, T. R., and Weaver, C. T. (2006) Nature 441, 231–234[CrossRef][Medline] [Order article via Infotrieve]
11. Veldhoen, M., Hocking, R. J., Atkins, C. J., Locksley, R. M., and Stockinger, B. (2006) Immunity 24, 179–189[CrossRef][Medline] [Order article via Infotrieve]
12. Bettelli, E., Carrier, Y., Gao, W., Korn, T., Strom, T. B., Oukka, M., Weiner, H. L., and Kuchroo, V. K. (2006) Nature 441, 235–238[CrossRef][Medline] [Order article via Infotrieve]
13. Akimzhanov, A. M., Yang, X. O., and Dong, C. (2007) J. Biol. Chem. 282, 5969–5972[Abstract/Free Full Text]
14. Sutton, C., Brereton, C., Keogh, B., Mills, K. H. G., and Lavelle, E. C. (2006) J. Exp. Med. 203, 1685–1691[Abstract/Free Full Text]
15. Chen, Z., Laurence, A., Kanno, Y., Pacher-Zavisin, M., Zhu, B. M., Tato, C., Yoshimura, A., Hennighausen, L., and O'Shea, J. J. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 8137–8142[Abstract/Free Full Text]
16. Laouar, Y., Welte, T., Fu, X.-Y., and Flavell, R. A. (2003) Immunity 19, 903–912[CrossRef][Medline] [Order article via Infotrieve]
17. Takeda, K., Clausen, B. E., Kaisho, T., Tsujimura, T., Terada, N., Forster, I., and Akira, S. (1999) Immunity 10, 39–49[CrossRef][Medline] [Order article via Infotrieve]
18. Panopoulos, A. D., Zhang, L., Snow, J. W., Jones, D. M., Smith, A. M., El Kasmi, K. C., Liu, F., Goldsmith, M. A., Link, D. C., Murray, P. J., and Watowich, S. S. (2006) Blood 108, 3682–3690[Abstract/Free Full Text]
19. Parham, C., Chirica, M., Timans, J., Vaisberg, E., Travis, M., Cheung, J., Pflanz, S., Zhang, R., Singh, K. P., Vega, F., To, W., Wagner, J., O'Farrell, A.-M., McClanahan, T., Zurawski, S., Hannum, C., Gorman, D., Rennick, D. M., Kastelein, R. A., de Waal Malefyt, R., and Moore, K. W. (2002) J. Immunol. 168, 5699–5708[Abstract/Free Full Text]
20. Ivanov, I. I., McKenzie, B. S., Zhou, L., Tadokoro, C. E., Lepelley, A., Lafaille, J. J., Cua, D. J., and Littman, D. R. (2006) Cell 126, 1121–1133[CrossRef][Medline] [Order article via Infotrieve]
21. Koni, P. A., Joshi, S. K., Temann, U. A., Olson, D., Burkly, L., and Flavell, R. A. (2001) J. Exp. Med. 193, 741–754[Abstract/Free Full Text]
22. Takeda, K., Kaisho, T., Yoshida, N., Takeda, J., Kishimoto, T., and Akira, S. (1998) J. Immunol. 161, 4652–4660[Abstract/Free Full Text]
23. Cho, M. L., Kang, J. W., Moon, Y. M., Nam, H. J., Jhun, J. Y., Heo, S. B., Jin, H. T., Min, S. Y., Ju, J. H., Park, K. S., Cho, Y. G., Yoon, C. H., Park, S. H., Sung, Y. C., and Kim, H. Y. (2006) J. Immunol. 176, 5652–5661[Abstract/Free Full Text]
24. Bromberg, J. F., Wrzeszczynska, M. H., Devgan, G., Zhao, Y., Pestell, R. G., Albanese, C., and Darnell, J. E., Jr. (1999) Cell 98, 295–303[CrossRef][Medline] [Order article via Infotrieve]
25. Ouyang, W., Ranganath, S. H., Weindel, K., Bhattacharya, D., Murphy, T. L., Sha, W. C., and Murphy, K. M. (1998) Immunity 9, 745–755[CrossRef][Medline] [Order article via Infotrieve]
26. Pear, W. S., Miller, J. P., Xu, L., Pui, J. C., Soffer, B., Quackenbush, R. C., Pendergast, A. M., Bronson, R., Aster, J. C., Scott, M. L., and Baltimore, D. (1998) Blood 92, 3780–3792[Abstract/Free Full Text]
27. Markowitz, D., Goff, S., and Bank, A. (1988) J. Virol. 62, 1120–1124[Abstract/Free Full Text]
28. Wen, R., Chen, Y., Xue, L., Schuman, J., Yang, S., Morris, S. W., and Wang, D. (2003) J. Biol. Chem. 278, 43654–43662[Abstract/Free Full Text]
29. Kang, H. S., Beak, J. Y., Kim, Y. S., Petrovich, R. M., Collins, J. B., Grissom, S. F., and Jetten, A. M. (2006) Biochem. J. 397, 89–99[CrossRef][Medline] [Order article via Infotrieve]
30. Fontenot, J. D., Gavin, M. A., and Rudensky, A. Y. (2003) Nat. Immunol. 4, 330–336[CrossRef][Medline] [Order article via Infotrieve]
31. Onishi, M., Nosaka, T., Misawa, K., Mui, A. L.-F., Gorman, D., McMahon, M., Miyajima, A., and Kitamura, T. (1998) Mol. Cell Biol. 18, 3871–3879[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				C. S. Ma, G. Y.J. Chew, N. Simpson, A. Priyadarshi, M. Wong, B. Grimbacher, D. A. Fulcher, S. G. Tangye, and M. C. Cook Deficiency of Th17 cells in hyper IgE syndrome due to mutations in STAT3 J. Exp. Med., July 7, 2008; 205(7): 1551 - 1557. [Abstract] [Full Text] [PDF]

				L. de Beaucoudrey, A. Puel, O. Filipe-Santos, A. Cobat, P. Ghandil, M. Chrabieh, J. Feinberg, H. von Bernuth, A. Samarina, L. Janniere, et al. Mutations in STAT3 and IL12RB1 impair the development of human IL-17-producing T cells J. Exp. Med., July 7, 2008; 205(7): 1543 - 1550. [Abstract] [Full Text] [PDF]

				K. Ichiyama, H. Yoshida, Y. Wakabayashi, T. Chinen, K. Saeki, M. Nakaya, G. Takaesu, S. Hori, A. Yoshimura, and T. Kobayashi Foxp3 Inhibits ROR{gamma}t-mediated IL-17A mRNA Transcription through Direct Interaction with ROR{gamma}t J. Biol. Chem., June 20, 2008; 283(25): 17003 - 17008. [Abstract] [Full Text] [PDF]

				L. J. Quinton, M. R. Jones, B. E. Robson, B. T. Simms, J. A. Whitsett, and J. P. Mizgerd Alveolar Epithelial STAT3, IL-6 Family Cytokines, and Host Defense during Escherichia coli Pneumonia Am. J. Respir. Cell Mol. Biol., June 1, 2008; 38(6): 699 - 706. [Abstract] [Full Text] [PDF]

				A. Mangalam, D. Luckey, E. Basal, M. Behrens, M. Rodriguez, and C. David HLA-DQ6 (DQB1*0601)-Restricted T Cells Protect against Experimental Autoimmune Encephalomyelitis in HLA-DR3.DQ6 Double-Transgenic Mice by Generating Anti-Inflammatory IFN-{gamma} J. Immunol., June 1, 2008; 180(11): 7747 - 7756. [Abstract] [Full Text] [PDF]

				B. P. Pappu, A. Borodovsky, T. S. Zheng, X. Yang, P. Wu, X. Dong, S. Weng, B. Browning, M. L. Scott, L. Ma, et al. TL1A-DR3 interaction regulates Th17 cell function and Th17-mediated autoimmune disease J. Exp. Med., May 12, 2008; 205(5): 1049 - 1062. [Abstract] [Full Text] [PDF]

				X. O. Yang, S. H. Chang, H. Park, R. Nurieva, B. Shah, L. Acero, Y.-H. Wang, K. S. Schluns, R. R. Broaddus, Z. Zhu, et al. Regulation of inflammatory responses by IL-17F J. Exp. Med., May 12, 2008; 205(5): 1063 - 1075. [Abstract] [Full Text] [PDF]

				X. Liu, Y. S. Lee, C.-R. Yu, and C. E. Egwuagu Loss of STAT3 in CD4+ T Cells Prevents Development of Experimental Autoimmune Diseases J. Immunol., May 1, 2008; 180(9): 6070 - 6076. [Abstract] [Full Text] [PDF]

				S. A. Diehl, H. Schmidlin, M. Nagasawa, S. D. van Haren, M. J. Kwakkenbos, E. Yasuda, T. Beaumont, F. A. Scheeren, and H. Spits STAT3-Mediated Up-Regulation of BLIMP1 Is Coordinated with BCL6 Down-Regulation to Control Human Plasma Cell Differentiation J. Immunol., April 1, 2008; 180(7): 4805 - 4815. [Abstract] [Full Text] [PDF]

				K. Tanaka, K. Ichiyama, M. Hashimoto, H. Yoshida, T. Takimoto, G. Takaesu, T. Torisu, T. Hanada, H. Yasukawa, S. Fukuyama, et al. Loss of Suppressor of Cytokine Signaling 1 in Helper T Cells Leads to Defective Th17 Differentiation by Enhancing Antagonistic Effects of IFN-{gamma} on STAT3 and Smads J. Immunol., March 15, 2008; 180(6): 3746 - 3756. [Abstract] [Full Text] [PDF]

				T. Owaki, M. Asakawa, N. Morishima, I. Mizoguchi, F. Fukai, K. Takeda, J. Mizuguchi, and T. Yoshimoto STAT3 Is Indispensable to IL-27-Mediated Cell Proliferation but Not to IL-27-Induced Th1 Differentiation and Suppression of Proinflammatory Cytokine Production J. Immunol., March 1, 2008; 180(5): 2903 - 2911. [Abstract] [Full Text] [PDF]

				M. Huber, V. Steinwald, A. Guralnik, A. Brustle, P. Kleemann, C. Rosenplanter, T. Decker, and M. Lohoff IL-27 inhibits the development of regulatory T cells via STAT3 Int. Immunol., February 1, 2008; 20(2): 223 - 234. [Abstract] [Full Text] [PDF]

				M. Fukata, K. Breglio, A. Chen, A. S. Vamadevan, T. Goo, D. Hsu, D. Conduah, R. Xu, and M. T. Abreu The Myeloid Differentiation Factor 88 (MyD88) Is Required for CD4+ T Cell Effector Function in a Murine Model of Inflammatory Bowel Disease J. Immunol., February 1, 2008; 180(3): 1886 - 1894. [Abstract] [Full Text] [PDF]

				G. Jiang, Y. Ke, D. Sun, G. Han, H. J. Kaplan, and H. Shao Reactivation of Uveitogenic T Cells by Retinal Astrocytes Derived from Experimental Autoimmune Uveitis-Prone B10RIII Mice Invest. Ophthalmol. Vis. Sci., January 1, 2008; 49(1): 282 - 289. [Abstract] [Full Text] [PDF]

				L. Wei, A. Laurence, K. M. Elias, and J. J. O'Shea IL-21 Is Produced by Th17 Cells and Drives IL-17 Production in a STAT3-dependent Manner J. Biol. Chem., November 30, 2007; 282(48): 34605 - 34610. [Abstract] [Full Text] [PDF]

				A. De Luca, C. Montagnoli, T. Zelante, P. Bonifazi, S. Bozza, S. Moretti, C. D'Angelo, C. Vacca, L. Boon, F. Bistoni, et al. Functional yet Balanced Reactivity to Candida albicans Requires TRIF, MyD88, and IDO-Dependent Inhibition of Rorc J. Immunol., November 1, 2007; 179(9): 5999 - 6008. [Abstract] [Full Text] [PDF]

				S. M. Holland, F. R. DeLeo, H. Z. Elloumi, A. P. Hsu, G. Uzel, N. Brodsky, A. F. Freeman, A. Demidowich, J. Davis, M. L. Turner, et al. STAT3 Mutations in the Hyper-IgE Syndrome N. Engl. J. Med., October 18, 2007; 357(16): 1608 - 1619. [Abstract] [Full Text] [PDF]

				T. J. Harris, J. F. Grosso, H.-R. Yen, H. Xin, M. Kortylewski, E. Albesiano, E. L. Hipkiss, D. Getnet, M. V. Goldberg, C. H. Maris, et al. Cutting Edge: An In Vivo Requirement for STAT3 Signaling in TH17 Development and TH17-Dependent Autoimmunity J. Immunol., October 1, 2007; 179(7): 4313 - 4317. [Abstract] [Full Text] [PDF]

				A. Kimura, T. Naka, and T. Kishimoto IL-6-dependent and -independent pathways in the development of interleukin 17-producing T helper cells PNAS, July 17, 2007; 104(29): 12099 - 12104. [Abstract] [Full Text] [PDF]

				M. Nishihara, H. Ogura, N. Ueda, M. Tsuruoka, C. Kitabayashi, F. Tsuji, H. Aono, K. Ishihara, E. Huseby, U. A. K. Betz, et al. IL-6-gp130-STAT3 in T cells directs the development of IL-17+ Th with a minimum effect on that of Treg in the steady state Int. Immunol., June 1, 2007; 19(6): 695 - 702. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 282/13/9358    most recent C600321200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal