| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 282, Issue 16, 11969-11981, April 20, 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1223245
From the
Cancer Biology and ¶Molecular Oncology, Department of Medicine, ENH Research Institute, Feinberg School of Medicine, and Department of Biochemistry, Molecular Biology, and Cell Biology, Northwestern University, Evanston, Illinois 60201, the Department of Radiation Oncology, New England Medical Center, Boston, Massachusetts 02111, the ||Breast Cancer Program and Department of Pharmacology and Experimental Therapeutics, Cardinal Bernardin Cancer Center, Loyola University Medical Center, Chicago, Illinois 60153, and the **Dana-Farber Cancer Institute, Boston, Massachusetts 02115
Received for publication, September 20, 2006 , and in revised form, February 9, 2007.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
In addition to modifications that result in an increase in p53 levels and activation of its specific DNA binding, recruitment of transcriptional coactivators to target gene promoter-associated p53 plays an essential role in p53-mediated transcriptional responses (6, 7). Coactivators typically facilitate transcription by bridging transcription factors to basal transcription machinery as well as to chromatin-modifying complexes, in particular the histone acetyltransferase machinery (8). Indeed, coactivators with histone acetyltransferase activity, such as p300, CBP,6 and PCAF, have been demonstrated to interact with and regulate p53-dependent transcription (7–9). Recent studies have identified additional p53 coactivators, such as ADA3, that stabilize p53 and apparently recruit the ADA complex-associated histone acetyltransferase activities of GCN5 and PCAF (6, 10). In turn, well documented p53 coactivators, such as p300/CBP, also interact and functionally regulate other transcription factors. For example, p300 plays an important role in regulating Notch-dependent transcriptional activation (11, 12). Given the fundamental importance of elucidating biochemical mechanisms of p53-mediated transcriptional responses, the potential role of novel coactivators of p53 is of substantial interest.
In this study, we have investigated the potential role of MAML1 as a p53 coactivator. MAML1 is a member of the Drosophila Mastermind-like (MAML) gene family (MAML1–3) that functions as coactivators for Notch-dependent transcription (13). Although mammals express three distinct MAML genes (MAMl1–3) (14, 15), a single gene is found in Drosophila (mastermind) and Caenorhabditis elegans (Lag-3/Sel-8), the latter coding for two alternatively spliced transcripts (16, 17). The role of mastermind and MAML proteins in canonical Notch signaling has been documented in substantial detail. Interaction of a Notch ligand (of which there are five in mammals, including Jagged-1, Jagged-2, and Delta-1/2/3) with a Notch receptor (four in mammals, Notch 1–4) leads to a 2-step proteolytic cleavage of Notch receptors, first by an ADAM protease and subsequently by 
-secretase (12). The latter cleaves within the transmembrane region, thereby releasing the active intracellular domain of Notch (ICN). The ICN then translocates to the nucleus where it binds to the CSL (CBF1/RBP-J
in mammals, Su(H) in Drosophila, and Lag-1 in C. elegans) family of DNA-binding transcription factors (18). MAML proteins form a ternary complex with CBF1-ICN (19) via a direct interaction and play a critical role in transcriptional activation of Notch targets by recruiting p300/CBP, which in turn mediates chromatin remodeling via histone acetylation (11).
A number of observations suggested the possibility that MAML1 may function as a p53 coactivator. Although MAML proteins have been considered Notch-specific coactivators, recent mouse knock-out data demonstrated that MAML1 also functions as a coactivator of muscle differentiation-related transcription factor MEF2 independent of Notch; in fact, Notch and MEF2 function antagonistically in myoblast differentiation, yet MAML1 can play a coactivator role for both pathways (20, 21). Furthermore, the observations that MAML1 recruits p300 to Notch and that p300 is a known p53 coactivator (8, 18) raised the possibility that MAML1 may also function as a p53 coactivator. Importantly, recent findings have suggested a cross-talk between Notch and p53, as activation of Notch signaling was shown to inhibit p53-mediated apoptosis (22, 23). Furthermore, Notch activation in neural progenitor cells led to elevated levels of p53 and its targets, and p53-deficient cells showed a suppression of Notch-mediated apoptosis (23). Finally, similar to ADA3 (6), MAML1 was identified as a human papilloma virus E6-binding protein7,8; given the ability of ADA3 to function as a p53 coactivator, we considered the possibility that MAML1 may also play such a role aside from its known function as a Notch coactivator.
Here, we demonstrate that MAML1 interacts with p53 in vitro and in vivo, associates with p53 transcriptional complexes bound to native p53-reponsive promoters, and upon overexpression markedly enhances p53-mediated gene transcription as well as biological function. Overexpression of p53 inhibits MAM-induced CBF-luciferase activity, suggesting that p53 and CBF may compete for MAML1 under certain conditions. Complementary in vivo studies utilizing RNAi-mediated knockdown demonstrate that Lag-3, the sole MamL ortholog in C. elegans, demonstrates an important role in a p53 (Cep-1 in C. elegans)-mediated pathway that leads to apoptosis in the germ line (24). Taken together, our data demonstrate a novel and evolutionarily conserved role for the Notch coactivator MAML1 (and Lag-3) in p53-mediated transactivation and biological function.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
-minimum Eagle's medium (Invitrogen) supplemented with 10% fetal calf serum. These cell lines were obtained from the ATCC. 76N-derived immortal mammary epithelial cell lines 76N-TERT (p53-positive) and 76R-30 (p53-negative) were grown in DFCI medium (25). Plasmid Constructs—Plasmids encoding FLAG-tagged full-length MAML1 (FLAG-MAML1) and truncated mutants 1–302 (FLAG-MAML1-(1–302)) been described earlier (13). FLAG-MAML-(742–1016) was derived by subcloning MAML1 sequences encoding amino acids 742–1016 from a pGAD10 construct isolated in a yeast two-hybrid interaction with HPV16 E6.8 FLAG-MAML1 was further subcloned into pEF-HisB vector (Invitrogen) for mammalian expression using BamHI and DraI and into pet14b vector for bacterial expression using a BamHI site. Retroviral constructs of MAML1 and its mutant 742–1016 were derived by subcloning the corresponding fragments from PEF-His constructs into the pMSCVpuro vector (Invitrogen). GST-MAM-CT was constructed by cloning the 742–1016 fragment from the original pGAD10 clone into pGEX-4T1 vector (Roche Applied Science). Wild-type p53 and its truncation mutants were derived by subcloning cDNA inserts from pCMV-p53 (obtained from Bert Vogelstein, The Johns Hopkins Medical Center) into PCR3.1 plasmid. Additional truncation mutants of p53 containing residues 1–101, 102–292, and 292–393 were generated by the PCR cloning using the primer sets caagaattcatggaggagccgcagtcagatcctagcgtc and cggctcgagtcatttctgggaagggacagaagatgac, cgagaattcatgacctaccagggcagctacggtttc and cggctgcaggcggccgctcatttcttgcggagattctcttcctc, and cgagaattcatgggggagcctcaccacgagctgcc and cggctcgagtcagtctgagtcaggcccttctgtcttgaac, respectively. Luciferase reporter plasmids containing the p53-responsive elements of Bax, Gadd45, and p21 were obtained from Dr. Carol Prives (Columbia University, New York) and the pG13 reporter originally obtained from Dr. Bert Vogelstein (The Johns Hopkins School of Medicine, Baltimore), was provided by Dr. Wafik El-Deiry (University of Pennsylvania).
In Vitro Binding Assays—35S-Labeled p53 or its truncation mutants were generated using [35S]methionine and the TNT T7-coupled rabbit reticulocyte system (Promega). In vitro translated proteins were treated with 1 unit of DNase I for 30 min prior to the binding reaction. One µg each of GST or GST-MAML1, noncovalently bound to glutathione beads in 500 µl of lysis buffer (100 mM Tris, pH 8.0, 150 mM NaCl, 1% Nonidet P-40), were incubated with the in vitro translated proteins for 1 h at 4 °C and washed five times with lysis buffer. The 35S-labeled p53 or its truncation mutants bound to GST fusion products were analyzed by SDS-PAGE and subsequent autoradiography. Binding reactions using cell lysates were carried out with 1 µg of His-MAML1 immobilized on His-bind resin (Novagen), or His-Bind resin alone, in 200 µl of binding buffer (100 mM Tris, pH 8.0, 120 mM NaCl, 0.5% Nonidet P-40, 30 mM imidazole) for 5 min at 4 °C and washed six times with binding buffer. Bound proteins were resolved by SDS-PAGE and visualized by fluorography or analyzed by immunoblotting followed by ECL (reagents from Amersham Biosciences).
In Vivo Association between MAML1 and p53—For coimmunoprecipitation analyses, 5 x 105 U2OS cells expressing endogenous wild-type p53 were transfected with 5 µg of FLAG-MAML1 or vector, using the FuGENE 6 reagent, according to the supplier's instructions (Roche Applied Science). 48 h later, the cells were harvested in lysis buffer, and 1-mg aliquots of cell lysate protein were pre-cleared with protein G-agarose, subjected to immunoprecipitation with an anti-p53 antibody (ab-1, Oncogene Research), and immunoblotted for MAML1 using an anti-FLAG antibody (M2, Sigma) followed by ECL detection. For His tag pulldown analyses, 5 x 105 293T cells were transfected with 5 µg of His-MAML1 and 1 µg of FLAG-p53 using the calcium phosphate method. 48 h post-transfection, the cells were lysed in the binding buffer (50 mM Tris, pH 8.0, 100 mM NaCl, 0.5% Nonidet P-40), and 400 µg of protein was incubated with His-Bind resin (Novagen) for 5 min at 4 °C. Beads were washed six times with binding buffer, and bound proteins were subjected to immunoblotting with anti-FLAG and anti-His (Santa Cruz Biotechnology) antibodies to detect p53 and MAML1, respectively.
To demonstrate the interaction of endogenous p53 with MAML1, U2OS cells were treated with 10 ng/ml leptomycin B (Sigma) or an equal volume of 70% methanol (as control) for 4 h, and the cells were lysed in NETN buffer (100 mM Tris, pH 8.0; 100 mM NaCl; 0.5% Nonidet P-40; 1 mM phenylmethylsulfonyl fluoride). Cell lysates were pre-cleared with protein-G beads, and immunoprecipitation from aliquots was carried out with a mixture of six anti-p53 monoclonal antibodies (p53 (DO-1), p53 (pAb1801), p53 (pAb 240) from Santa Cruz Biotechnology; p53 (polyclonal antibody 421) from Calbiochem; p53 (pAb122) from NeoMarkers, or normal mouse IgG (negative control)). p53-associated MamL1 was analyzed by immunoblotting with an anti-MamL1 monoclonal antibody and visualized using ECL.
Transactivation Assays—For the p53-mediated transactivation, 5 x 105 Saos2 (a p53-negative osteosarcoma cell line) or MCF-7 cells per 100-mm dish or 2 x 105 per 60-mm dish were transfected with the indicated luciferase reporters, MAML1, p53, as indicated in figure legends. Each dish also received 20 ng of SV40-Renilla luciferase reporter (pRL-SV40) to normalize for differences in transfection. Total DNA was kept constant by addition of vector DNA. Luciferase activity was measured 24 h later, using a dual-luciferase kit (Promega, WI). For the ICN-mediated transactivation, 1 x 105 cells/well of a 6-well plate were transfected with various constructs (100 ng of CBF1 reporter, 10 ng each of ICN1 and SV40 Renilla reporter, and different doses of p53 and MamL1, as indicated in the figures legends) using the FuGENE 6 reagent.
Chromatin Immunoprecipitation (ChIP) Assay to Detect the Native p21, Bax, and GADD45 Promoters-bound MamL1 and p53—Subconfluent MCF-7, a wild-type p53-containing cell line, was used for ChIP analysis. The native protein-DNA complexes were cross-linked by treatment with 1% formaldehyde for 15 min. The ChIP assay was carried out as reported earlier (26). Briefly, equal aliquots of isolated chromatin were subjected to immunoprecipitation with an anti-p53 (DO1; Santa Cruz Biotechnology) anti-MamL1 (13), anti-polymerase II, or IgG monoclonal antibodies. DNA associated with immunoprecipitates was used as a template for PCR to amplify different p53 target promoters containing the p53-binding site. The primers used were as follows: p21, 5' primer 5'-TCCATCCCTATGCTGCCTGCT and 3' primer 5'-CAAGGATCCTGCTGGCAGATC; GADD45, 5' primer 5'-GGATCTGTGGTAGGTGAGGGTCAGG and 3' primer 5'-GGAATTAGTCACGGGAGGCAGTGCAG; and Bax, 5' primer 5'-GATTGGGCCACTGCACTCCAG and 3' primer 5'-TGACTAAAAACTGAGTGG. As a specificity control, the GAPDH promoter was amplified from the same templates using the following primers: 5' primer 5'-AAAAGCGGGGAGAAAGTAGG and 3' primer 5'-CTAGCCTCCCGGGTTTCTCT.
Antibodies—Monoclonal antibodies against p53 (DO1), p21, and GFP were purchased from Santa Cruz Biotechnology (Santa Cruz, CA); anti-acetylated p53 antibody was obtained from Upstate (Temecula, CA); anti-FLAG antibodies were from Sigma; 
-actin antibodies were from Abcam Inc.(Cambridge, MA), and anti-phospho-p53 (Ser-15) was from Cell Signaling Technology (Boston).
Transient Transfection and Western Blotting—For transfection experiments, Saos-2 cells were plated in100-mm dishes and transfected with the indicated expression constructs (see figure legends) using FuGENE 6 (Roche Applied Science). The cells were lysed 40 h post-transfection in lysis buffer (50 mM Tris-Cl, 400 mM NaCl, 0.2% Nonidet P-40, 10% glycerol) and protease inhibitors from Roche Applied Science, and equivalent amounts of whole cell extracts were processed for SDS-PAGE and subjected to immunoblotting with the appropriate antibodies.
RNA Extraction and RT-PCR—The total RNA was extracted using TRIzol reagent (Invitrogen). The semiquantitative RT-PCR was performed with 200 ng of total RNA using the following primers: (a) p53, forward primer 5'-CAGCCAAGTCTGTGACTTGCACGTAC-3' and reverse primer 5'-CTATGTCGAAAAGTGTTTCTGTCATC-3';(b) p21, forward primer 5'-GTGAGCGATGGAACTTCGACTT-3' and reverse primer 5'-GGCGTTTGGAGTGGTAGAAATC-3';(c) GAPDH forward primer 5'-ACCTGACCTGCCGTCTAGAA-3' and reverse primer 5'-TCCACCACCCTGTTGCTGTA-3';(d) MamL1 forward primer 5'-CAGCATCAGTTGCTTTTGGA-3' and reverse primer 5'-CTGCTCTGAGGCATGTTTTG-3'. The RT-PCR products were visualized under UV light after running on ethidium bromide-stained 2% agarose gel.
Analysis of the p53 Protein Turnover—100-mm dishes of Saos-2 cells were transfected with plasmids expressing p53 alone or in combination with MamL1. At 16 h post-transfection cells were trypsinized, and equal numbers of cells were replated on five 6-well plates. After 16 h, 100 µg/ml cycloheximide (Sigma) was added to the medium, and cells were harvested at the indicated time points. Total cell extracts were prepared, and equivalent amounts were run on SDS-PAGE and analyzed by Western blotting. Densitometry analysis was carried out on scanned images using Scion Image for Windows software (Scion Corp., Frederick, MD).
Apoptosis Assay (FACS Analysis of Pre-G1 Cells)—76NTERT cells (containing wild-type p53) and 76R30 cells (containing mutant p53) were infected with retroviruses expressing full-length MAM and various fragments of MAML1 for 48 h and selected in 100 µg/ml G418 for 48 h. The cells were then plated into 100-mm dishes for Western blotting and in 6-well plates for fluorescence-activated cell sorting (FACS) analysis. 48 h later cells were treated with adriamycin (0.25 µg/ml) for 18 h. Cells were then harvested and resuspended in 1 ml of phosphate-buffered saline containing 5 mM EDTA, and ice-cold 100% ethanol was gently added to make the final ethanol concentration to 50%. The cell solution was incubated at room temperature for 30 min in the dark. The cells were spun down and resuspended in 0.5 ml of RNase solution (40 µg/ml), and the tubes were vortexed and incubated at room temperature for 30 min. 0.5 ml of diluted propidium iodide solution (final concentration 0.1 mg/ml) was added to each tube, and the samples were analyzed for the pre-G1 phase of the cell cycle.
Construction of RNAi against p53 and MAML1—To construct a retrovirus-based vector expressing MamL1 RNAi, we used Oligoengine software and used the sequence gaggaatcttgacagcgcc (336–354) for MAML1 RNAi 1 and sequence gcagcctttgagcaagaac (913–931) for MamL1 RNAi 2 to synthesize complementary strands of a 64-bp oligonucleotide with BglII cohesive site at the 5' end and HindIII cohesive site at the 3' end. Cloning was done into the retroviral vector pSuper Retro-Neo (pSRNeo) from Oligoengine (Seattle, WA). RNAi against p53 was designed according to the literature (27) and cloned into pSRNeo BglII and HindIII sites.
Duplex RNAi oligonucleotides were also utilized in our experiments. The RNA oligonucleotides used to generate 21-nucleotide siRNA duplexes were synthesized through Dharmacon, corresponding to the human MAML1 sequences in open reading frame siRNA 1 (nucleotides 336–354) (5'-GAGGAATCTTGACAGCGCC-3'), siRNA 2 (nucleotides 913–931) (5'-GCAGCCTTTGAGCAAGAAC), and control siRNA (5'-CCAAGATCATCACCGCCTG-3').
C. elegans Strains and Culture Conditions—C. elegans worms were cultured at 22 °C, unless otherwise indicated, under standard growth conditions (28). Strains used in this study were Bristol strain N2 (wild-type) and dpy-20 (el282); grls50 expresses a GFP-tagged Lag-3 and was kindly provided by Iva Greenwald (see Ref. 17).
C. elegans Feeding RNAi—The RNAi construct used to target Lag-3 was constructed by cloning into the BamHI and HindIII sites of plasmid L4440(2xT7) PCR amplified Lag-3 cDNA. cDNA was synthesized from total RNA from N2 worms using One-step PCR (Invitrogen) and the following primers. The forward primer sequence was 5'-CGCGGATCCATGAAACCGTCGACA and the reverse primer was 5'-CGGGGTACCTCAATTGATATTAGC. Feeding RNAi experiments were performed under the same conditions as those described by Timmons et al. (29). Following overnight egg laying at 22 °C by gravid hermaphrodites, the plates were kept at 15 °C.
C. elegans Germ Line Apoptosis Assay—Germ line apoptosis assays were performed similarly to previously described experiments (24). Briefly, synchronized L4 stage worms fed with the indicated RNAi plasmid transformed bacteria were either left untreated or were subjected to 120 Gy of -irradiation using a 137Cs source. Following irradiation, the animals were maintained at 22 °C for 21 h at which time the worms were collected for staining with 33 µM SYTO 12 (Invitrogen) for 2 h. The worms were then washed with M9 (22 mM KH2PO4, 42 mM Na2HPO4, 85.5 mM NaCl, 1 mM MgSO4) buffer and then transferred to seeded plates to allow for clearing of SYTO 12-stained bacteria from the guts of the worms for 45 min. The worms were then mounted onto coverslips with agar pads to be observed with both Normarski optics and fluorescence microscopy. SYTO 12-stained cells were counted and averaged from about 15–25 animals per condition.
Real Time RT PCR—Worms were treated with -irradiation as indicated above. Twenty four hours after irradiation, adult worms were picked from the plates, and total RNA was extracted using TRIzol reagent (Invitrogen). cDNA was synthesized using random primers and Moloney murine leukemia virus reverse transcriptase (Stratagene). Real time PCR was performed using custom TaqMan gene expression assays (Applied Biosystems) directed against Ced-13, Egl-1, and C. elegans actin as an internal control. The assays were performed using Mx3000P QPCR machine (Stratagene, TX). Expression of Ced-13 and egl-1 was normalized to actin expression, and fold induction was calculated.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
To further characterize the interaction of MAML1 with p53 and to identify the p53 domain that interacts with MAML1, in vitro binding experiments were performed with in vitro-translated 35S-labeled p53 protein or its fragments and the bacterially expressed GST-MAML1 or GST protein alone. As expected, GST alone showed no binding (Fig. 1B), whereas clear binding was seen between the full-length p53 and GST-MAML1 (Fig. 1B). Notably, the N terminus (amino acids 1–101) or the C terminus (tetramerization and regulatory domains) of p53 showed no binding to MamL1. In contrast, the DNA binding domain of p53 (amino acids 102–292; Fig. 1B) showed binding to MAML1. Together, the in vitro binding results are consistent with specific binding between MAML1 to p53 via an interaction between the N-terminal region of MAML1 and the DNA binding domain of p53. The stickiness of the DNA binding region of p53 was ruled out by performing the reactions after DNase I digestion of the in vitro translated proteins.
p53 Associates with MAML1 in Vivo—Given the in vitro interaction between MAML1 and p53, we examined whether these proteins associate in vivo using two different cell types. First, p53-positive U2OS osteosarcoma cells were transfected with empty vector or with FLAG-tagged MAML1. Cell lysates were immunoprecipitated with p53 antibody followed by immunoblotting with an anti-FLAG antibody to detect p53-associated MAML1. As expected, no protein was detected in vector-transfected cells (Fig. 2A, lane 3), whereas MAML1 was clearly coimmunoprecipitated with endogenous p53 in MAML1-transfected U2OS cells (Fig. 2A, lane 4).
|
Endogenous MAML1 and p53 Associate with Each Other— Because the overexpressed MAML1 interacted with both the overexpressed (Fig. 2B) and the endogenous p53 (Fig. 2A), we set out to examine if the endogenous MAML1 and p53 proteins associate with each other. U2OS cells were treated with the nuclear export inhibitor leptomycin B, and cell lysates were subjected to immunoprecipitation with a control IgG or anti-p53 antibodies (using a mixture of anti-p53 monoclonal antibodies) followed by an immunoblot with an anti-MAML1 monoclonal antibody. No MAML1 signal was seen in control IgG lane (Fig. 2C, lane 1), whereas a clear MAML1 band was observed in anti-p53 immunoprecipitation lane (lane 2). As anticipated, treatment with leptomycin B enhanced the association between p53 and MAML1 (Fig. 2C, lane 4). The immunoblotting of input lanes and anti-p53 immunoblotting of immunoprecipitation lanes demonstrated the expected proteins bands in appropriate lanes. These results demonstrate that endogenously expressed p53 and MAML1 proteins form a complex.
|
|
|
We further confirmed the ability of MAML1 to enhance the p53-mediated transactivation using luciferase reporters linked to promoters of several additional p53 target genes, including GADD45 and p21, as well as the pG13-luciferase (a p53-responsive reporter containing 13 repeats of a consensus p53-binding site upstream of the firefly luciferase) (33). In each case, MAML1 enhanced the p53-mediated transactivation of the reporters, whereas little or no transactivation was observed in the absence of p53 cotransfection (Fig. 4B, C and D). Taken together, these results demonstrate that MAML1 functions as a coactivator for p53-dependent transactivation in mammalian cells.
Ectopic MamL1 Expression Increases the Stability of p53 Protein—Given the importance of the regulated p53 protein degradation in the cells, it appeared likely that MAML1-dependent increase in p53 levels may reflect a post-translational mechanism. However, we wanted to first rule out any influence of MAML1 expression on p53 mRNA levels. For this purpose, Saos-2 cells were transfected with p53 and Vector or p53 with MAML1 plasmid. Parallel samples were processed for Western blotting of protein lysates and RT-PCR analysis of p53 mRNA levels. Although MAML1 increases p53 protein levels, RT-PCR analysis showed that p53 mRNA levels remained unchanged similar to mRNA levels of the housekeeping gene GAPDH, used as a loading control (Fig. 5, A and B). In contrast, the increase in the level of p21 protein, a transcriptional target of p53, was accompanied by an expected MAML1-dependent increase in p21 mRNA levels (Fig. 5B). These observations indicated that the accumulation of p53 protein upon MAML1 overexpression is likely to be due to a post-transcriptional mechanism.
To investigate if the MAML1-dependent increase in p53 levels reflected an increase in the stability of p53 protein, we assessed the half-life of p53 protein following cycloheximide block of new protein synthesis. For this purpose, p53-null Saos-2 cells were transfected with p53 expression vector pCMV-p53 alone or together with MAML1 expression vector. The transfected cells were incubated in the presence of cycloheximide, and p53 levels were assessed by immunoblotting of cellular extracts prepared at various times after cycloheximide addition followed by densitometry to assess the half-life. As shown in Fig. 5C, the overexpression of MAML1 resulted in a slower loss of p53 signals compared with cells without MAML1 overexpression. The half-life of the p53 protein increased from 20 min in cells without MAML1 overexpression to 70 min in cells with MAML1 overexpression (Fig. 5D). This finding, together with lack of any effect on p53 mRNA levels, supports our conclusion that ectopic MAML1 overexpression increases p53 protein levels by promoting its stability.
MAML1 Overexpression Enhances the Level of p53 Phosphorylation and Acetylation—Stability of p53 is controlled by post-translational modifications with ubiquitination signaling protein degradation and a number of other modifications such as acetylation and phosphorylation. We hypothesized that MAML1 may stabilize p53 by promoting its phosphorylation or acetylation. To test this possibility, Saos-2 cells were transfected with p53 alone or cotransfected with MAML1. 16 h after transfection, each transfected plate was split into two plates. One plate in each set was used as a control, whereas the other plates were exposed to adriamycin for 2, 4, and 8 h to induce DNA damage, and cell lysates were analyzed for total, phosphorylated, and acetylated p53 levels using immunoblotting.
As expected, total as well as phosphorylated and acetylated p53 levels increased (about 2-fold) upon adriamycin treatment (Fig. 6, A–C). Notably, acetylated p53 levels were higher in cells overexpressing MAML1, and these levels increased further upon adriamycin treatment; the MAML1-dependent increase in phosphorylated and acetylated p53 paralleled the increase in total p53 levels (Fig. 6, A–C).
|
|
Requirement of the C. elegans MAML1 Ortholog in p53-mediated Germ Cell Apoptosis as Demonstrated by RNAi Knockdown—Given the expression of three MamL family members in mammalian cells and the associated complexities, we used a simpler C. elegans system in which a single MamL1 ortholog, Lag-3/Sel-8, is expressed (16, 17) so that its biological role in p53-mediated functional responses could be assessed in an in vivo stetting. Lag-3, like other MAM proteins, is known to function as a coactivator of Notch signaling (Lin-12 and GLP-1 in C. elegans) (16, 17).
To assess the role of Lag-3 as a p53 coactivator in C. elegans, we examined the effect of knocking down Lag-3 expression by RNAi feeding on germ cell apoptosis. It is well documented that the C. elegans p53 ortholog, Cep-1, is required for apoptosis of germ line cells in the region of the hermaphrodite gonad where these cells complete the pachytene stage of meiosis, and DNA damage is known to induce p53-dependent apoptosis of these cells (34, 35). Given the lethality of lag-3 knockdown because of its effects on Notch signaling (16, 17), we utilized a feeding RNAi protocol that allowed us to obtain viable F1 generation adult worms with a reduction in Lag-3 expression in tissues where Lag-3 is normally expressed, such as in the vulva and in developing embryos (Fig. 9A); as expected in these worms, Lag-3 expression in neuronal cells was not reduced. Accordingly, the majority of F2 generation eggs failed to hatch, and those that did had similar developmental defects as reported previously and were unable to develop to adulthood. Furthermore, as compared with the N2 wild-type worms, the age-1 worms exhibit an extended life span, and daf-16 worms exhibit a shortened life span (36, 37), and the Lag-3 RNAi F1 adults exhibited a normal life span (data not shown). Thus, we used the F1 generation Lag-3 RNAi to assess the role of Lag-3 in p53-mediated germ cell apoptosis.
The F1 generation N2 (wild type) worms grown on control RNAi (cRNAi) bacteria, Lag-3 RNAi, or Cep-1 RNAi throughout their development were treated with 120 Gy of -irradiation to induce the DNA damage (34, 35, 38). Twenty four hours after irradiation, the number of SYTO 12-stained (apoptotic) cells or corpses were counted using fluorescent microscopy. As shown in Fig. 9B, N2 control RNAi worms treated with 120 Gy of -irradiation exhibited an 
4-fold increase in germ line corpses per gonad arm compared with untreated worms. As expected, no change in the number of apoptotic cells was observed in Cep-1 RNAi worms indicating that apoptosis is p53-dependent. Notably, Lag-3 RNAi-treated F1 generation worms showed a partial decrease in induction of apoptotic germ line cells (Fig. 9B). These data are consistent with the role of Lag-3 in Cep-1 (p53)-mediated apoptosis in germ line cells.
RNAi-mediated Lag-3 Knockdown Reduces the Expression of p53 Target Genes—Schumacher et al. (38) recently showed that Cep-1 mediates the DNA-damage induced expression of Ced-13 and egl-1, the C. elegans orthologs of the Bcl-2 homology 3 domain containing human proteins Puma and Noxa, respectively, that are involved in the apoptotic response (38). Thus, we asked if Lag-3 is required for Cep-1-dependent expression of ced-13 and egl-1. Quantitative real time PCR analysis of RNA isolated from untreated versus 120 Gy -irradiation-treated worms showed that RNAi-mediated reduction of Lag-3 expression resulted in a significant decrease in Ced-13 and egl-1 induction upon -irradiation (Fig. 10, A and B, respectively). These results demonstrate that MamL1/Lag-3 is required for p53/Cep-1-mediated transcriptional activation in the in vivo C. elegans system.
Taken together, the results presented above indicate that Lag-3/MamL1 functions as a transcriptional coactivator for p53 and thus enhances the p53-mediated transactivation and apoptosis in both in vitro and in vivo systems.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
50% of all cancers (39). p53 is a sequence-specific homotetrameric transcription factor that becomes activated in response to many forms of cellular stress such as irradiation, hypoxia, drug-induced DNA damage, and oncogene activation; in response p53 orchestrates the transcription of many genes to either arrest cell proliferation or, more dramatically, to induce apoptosis. Substantial evidence points to a critical role for the p300/CBP coactivators in p53 responses to DNA damage (5, 8). p300/CBP and the associated protein P/CAF bind to and acetylate p53 during the DNA damage response in addition to histone acetylation, and they are needed for full p53 transactivation as well as for downstream p53 effects of growth arrest and/or apoptosis (4). Through physical interaction, the p300/CBP histone acetyltransferase/ubiquitin ligase can positively or negatively regulate p53 transactivation as well as p53 protein turnover, depending on cellular context and the environmental stimulus (4, 5). Recent work has also identified another coactivator ADA3 that binds to p53 and positively regulates its protein level and transcriptional activity (6, 10). Given the versatile functional roles of p53 as a tumor suppressor and its ability to control the expression of a diverse set of genes, identification of additional p53 coactivators continues to be an important area of research in p53 biology. Here we have used both in vitro and in vivo assays to demonstrate, for the first time, that the Notch coactivator MAML1 interacts with p53. We defined the N terminus of MAML1 as the binding domain for p53 and reciprocally the DNA-binding domain on p53 as the interacting domain for MAML1. Our ChIP assay findings that MAML1 is a part of the activator complex that binds to the native p53 target promoters strongly suggested that the MAML1-p53 interaction is functionally significant.
Similar to other p53 coactivators, such as p300 and ADA3, we also demonstrate that interaction with MAML1 stabilizes the p53 protein. p300 has been reported to stabilize p53 by interfering with Mdm2 interaction; whether a similar mechanism might mediate MAML1-dependent increase in p53 levels will need to be addressed through future studies. Interestingly, it has also been reported that MAML1 has a p300-binding domain (11). Thus, it is possible that p53, MAML1, and p300 function together in one protein complex. Previous studies have shown that the human papilloma virus E6 protein interacts with the p53 coactivator p300 as well as human ADA3 and inhibits their coactivator function for p53. It is notable that we and others (unpublished) isolated MAML1 in a screen for HPV16 E6-interacting proteins in a yeast two-hybrid screen, suggesting the role of MAML1 in HPV16E6-induced transformation and in cervical cancer (15). The recently elucidated structure of a ternary Notch-CSL-MAML1 complex (19, 40) indicates that the N terminus of MAML1 binds as a kinked -helix to a composite surface formed by the interaction of the ankyrin domain of Notch-1 and CSL. Our data suggest that the N terminus of MAML1 is also involved in the interaction with p53.
One of the important functions of p53 is to induce apoptosis under DNA damage conditions. We demonstrate here that wild-type MAML1 promotes p53-dependent apoptosis during DNA damage, whereas cells lacking wild-type p53 or expressing a mutant of MAML1 that does not interact with p53 showed no response. We also demonstrate that MAML1 enhances p53 acetylation/phosphorylation upon DNA damage. Furthermore, our analyses using the C. elegans model system with a single MAML1 homolog, Lag-3, support the conclusion that MAML1 functions as a transcriptional coactivator of p53. We demonstrate that knocking down Lag-3 expression in the worm mimics a p53-deficient response to radiation-induced DNA damage. The result that Lag-3 RNAi incompletely abrogated the germ cell apoptotic response, in contrast to a nearly complete abrogation with Cep-1 (p53) knockdown, is likely to be due to residual Lag-3 expression in the F1 generation worms or because of the continued function of other transcriptional coactivators of Cep-1. Consistent with our conclusions, Lag-3 down-regulation led to reduced induction of the Cep-1 target genes Egl-1 and Ced-13 that are involved in the apoptotic response. Thus, our C. elegans studies strongly suggest that Lag-3 is an important transcriptional coactivator of Cep-1, further supporting our conclusion from mammalian cell studies that MAML1 is a coactivator of p53. In addition to providing an in vivo biological system, the C. elegans studies also circumvented the complexities of investigating the functional roles of a three-member gene family in mammalian cells. Importantly, these results strongly suggest that the p53 coactivator role of MAML1 identified here is evolutionarily conserved.
|
|
|
|
This idea is consistent with recent data indicating that alternative association of MamL1 with Notch or MEF2 transcription factor controls distinct and apparently opposite fates of myoblast cells (21). Our findings that a deletion mutant of MAML1 that is known to be deficient in Notch-mediated transactivation but still functions as a p53 coactivator are reminiscent of MAML1 association with MEF2 versus Notch. These similarities further suggest that the interaction of MAML1 with p53 may regulate distinct transcriptional programs and the associated biological responses from those mediated through Notch, and these may be cooperative or antagonistic with Notch-mediated responses. In this regard, it is quite possible that coactivator roles of MAML1 for Notch versus p53, MEF2, and other uncharacterized transcription factors are exerted in distinct cellular or tissue contexts or at different stages of development, as is well known for Notch (49).
In conclusion, our identification of MAML1 as a coactivator of p53 provides a new insight into p53 biology as well as a novel function of MAML1, which has previously been thought to only function as a Notch coactivator but is now emerging as a multifaceted regulator of transcriptional programs distinct from Notch (13, 21). Further studies should help determine the relative importance of the roles of MAML1 and its family members that are mediated via Notch versus other transcriptional pathways.
|
FOOTNOTES |
|---|
1 Recipient of National Institutes of Health postdoctoral fellowship of Signal Transduction and Cancer Training Grant T32CA70085.
2 Supported by the Department of Defense Postdoctoral Traineeship Grant DAMD-17-03-1-0585.
3 Recipient of Carol and Marvin Gollob Fellowship.
4 Supported by the Jean Ruggles-Romoser Chair for Cancer Research.
5 To whom correspondence should be addressed: Division of Cancer Biology, ENH Research Institute, 1001 University Place, Evanston, IL 60201. Tel.: 224-364-7501; Fax: 224-364-7402; E-mail: v-band{at}northwestern.edu.
6 The abbreviations used are: CBP, CREB-binding protein; GST, glutathione S-transferase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ChIP, chromatin immunoprecipitation; RNAi, RNA interference; cRNA, control RNAi; Gy, gray; FACS, fluorescence-activated cell sorter; siRNA, short interfering RNA; GFP, green fluorescent protein; RT, reverse transcription.
7 L. Wu and J. D. Griffin, manuscript in preparation.
8 I. Bhat, L. Delmolino, Y. Zhang, Y. Zhao, Q. Gao, D. E. Wazer, H. Band, and V. Band, manuscript in preparation.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
