Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M700820200 on March 8, 2007

J. Biol. Chem., Vol. 282, Issue 17, 12650-12660, April 27, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/17/12650    most recent
M700820200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Müller, D.
Right arrow Articles by Kontermann, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Müller, D.
Right arrow Articles by Kontermann, R. E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Improved Pharmacokinetics of Recombinant Bispecific Antibody Molecules by Fusion to Human Serum Albumin*

Dafne Müller, Anette Karle1, Bettina Meißburger, Ines Höfig2, Roland Stork, and Roland E. Kontermann3

From the Institute of Cell Biology and Immunology, University of Stuttgart, Allmandring 31, 70569 Stuttgart, Germany

Received for publication, January 29, 2007 , and in revised form, March 2, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Recombinant bispecific antibodies such as tandem scFv molecules (taFv), diabodies (Db), or single chain diabodies (scDb) have shown to be able to retarget T lymphocytes to tumor cells, leading to their destruction. However, therapeutic efficacy is hampered by a short serum half-life of these small molecules having molecule masses of 50–60 kDa. Thus, improvement of the pharmacokinetic properties of small bispecific antibody formats is required to enhance efficacy in vivo. In this study, we generated several recombinant bispecific antibody-albumin fusion proteins and analyzed these molecules for biological activity and pharmacokinetic properties. Three recombinant antibody formats were produced by fusing two different scFv molecules, bispecific scDb or taFv molecules, respectively, to human serum albumin (HSA). These constructs (scFv2-HSA, scDb-HSA, taFv-HSA), directed against the tumor antigen carcinoembryonic antigen (CEA) and the T cell receptor complex molecule CD3, retained full binding capacity to both antigens compared with unfused scFv, scDb, and taFv molecules. Tumor antigen-specific retargeting and activation of T cells as monitored by interleukin-2 release was observed for scDb, scDb-HSA, taFv-HSA, and to a lesser extent for scFv2-HSA. T cell activation could be further enhanced by a target cell-specific costimulatory signal provided by a B7-DbCEA fusion protein. Furthermore, we could demonstrate that fusion to serum albumin strongly increases circulation time of recombinant bispecific antibodies. In addition, our comparative study indicates that single chain diabody-albumin fusion proteins seem to be the most promising format for further studying cytotoxic activities in vitro and in vivo.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bispecific antibodies are designed to target two different antigens simultaneously (1). In the context of a tumor therapy they can be applied to selectively recruit potent effector cells of the immune system such as cytotoxic T lymphocytes to tumor cells (2). This is achieved by binding on the one side to a tumor-associated antigen and on the other side to a trigger molecule on the effector cell, leading to the activation of the effector cell and tumor cell destruction. To reduce potential side effects elicited by the Fc part of antibodies (3) small recombinant bispecific antibody formats composed only of the variable regions, which define the binding unit of an antibody, have been developed (1, 4). These formats include bispecific diabodies (Db),4 single chain diabodies (scDb), and tandem scFv (taFv) molecules, which have been applied successfully in vitro and also in vivo for the retargeting of cytotoxic T lymphocytes (via T-cell receptor molecule CD3) to tumor cells (e.g. recognizing CEA, EpCAM, or CD19) (5–8).

However, these small bispecific antibody molecules with molecular masses between 50 and 60 kDa are rapidly cleared from circulation with an initial half-life of less than 30 min (9, 10). This puts some obstacles on therapeutic applications, e.g. requirement of high doses and repeated injections or infusions (6). Hence, therapeutic applications should benefit from an improvement of serum half-life. To improve pharmacokinetic properties of small molecules most attempts have been directed so far to increase the apparent molecular size of the recombinant protein. One approach comprises chemical coupling of polyethylene glycol (PEG) chains to the recombinant antibody molecules (11). This way, longer circulation times could be achieved for scFv and F(ab') fragments (12–14). However, PEGylation can lead to reduced binding and activity of the proteins (14, 15). Other strategies to improve pharmacokinetic properties of bispecific recombinant antibodies employed fusion to heavy chain fragments (Fc/CH3) (16, 17) or multimerization strategies (10, 18). However, in these cases molecules contain two binding sites for each antigen bearing the risk of target cell-independent activation of effector cells.

New approaches to improve pharmacokinetics of small proteins are based on binding to or fusion with long-circulating serum proteins such as albumin (19–21). Albumin is the most abundant protein in the blood plasma. It is produced in the liver as a monomeric protein of 67 kDa. Besides its role in regulating the osmotic pressure of plasma, the physiologic functions comprise the transport of metabolites like long chain fatty acids, bilirubin, steroid hormones, tryptophan, and calcium, among others. Albumin also binds with high affinity to a broad range of drugs influencing their pharmacokinetic properties (22). Albumin has a simple molecular structure and is highly stable. It is abundantly present in vascular and extravascular compartments with a circulation half-life of 19 days in humans. Recent studies have shown that this long serum half-life is due to a recycling process mediated by the neonatal Fc receptor (FcRn), similar to that observed for IgG molecules (23, 24).

Taking advantage of these properties, human serum albumin (HSA) has been employed as macromolecular carrier for drug delivery or diagnostic purpose (19). Moreover, HSA has also been successfully used to generate fusion proteins, e.g. with hormones (insulin, human growth hormone) (25, 26) and cytokines (interferon-{alpha}, interferon-beta, IL-2) (27–29), to reduce immunogenicity and modulate the pharmacokinetic properties, thus improving therapeutic efficacy of these molecules. Improved pharmacokinetic properties have also been described for a scFv-HSA fusion protein as well as for F(ab') and F(ab')2 conjugated to rat serum albumin (RSA) for the targeting of human tumor necrosis factor (20).

Here, we have employed the albumin fusion strategy to recombinant bispecific antibody molecules. Three forms of recombinant bispecific antibody HSA fusion proteins based on single chain diabody, tandem scFv, or two different single chain Fv fragments were generated and produced in a mammalian expression system. These novel bispecific antibody molecules showed specific binding to both antigens (CEA and CD3) and were able to retarget and activate effector cells in vitro to various extents. Compared with the parental antibodies, all bispecific albumin fusion proteins showed strong increase of the serum half-life in mice.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Antibodies were purchased from Santa Cruz Biotechnology (CA) (HRP-conjugated anti-His tag antibody), Dianova (Hamburg, Germany) (unconjugated anti-His tag antibody), and Sigma (Taufkirchen, Germany) (anti-mouse IgG-fluorescein isothiocyanate or phycoerythrin-conjugated antibody). Carcinoembryonic antigen was obtained from Europa Bioproducts (Cambridge, UK). Total RNA from human liver was purchased from Stratagene (Amsterdam, Netherlands) and the First Strand cDNA Synthesis kit from Fermentas (St. Leon-Rot, Germany). The human colon adenocarcinoma cell line LS174T was purchased from ECACC (Wiltshire, UK) and cultured in Earle's minimal essential medium (Invitrogen, Karlsruhe, Germany) supplemented with 2 mM glutamine, 1% non-essential amino acids, and 10% fetal bovine serum. HT1080#13.8 were a kind gift of W. Rettig (Boehringer Ingelheim Pharma, Vienna, Austria). HT1080#13.8 were grown in RPMI 5% fetal bovine serum in the presence of 200 µg/ml G418. Jurkat and HEK293 were cultured in RPMI, 10 and 5% fetal bovine serum, respectively. Buffy coat from a healthy human donor was kindly provided by Prof. G. Multhoff (Regensburg, Germany). IL-2 was purchased from Immunotools (Friesoythe, Germany) and phytohemagglutinin-L from Roche Applied Science. CD1 mice were purchased from Elevage Janvier (Le Genest St. Isle, France).

Oligonucleotides—The following oligonucleotides were used: HSA-XhoI-back, 5'-ACCGTCTCGAGTGGTGGATCAGGCGGTGATGCACACAAGAGTGAGGTTGC-3'; HSA-Asc-for, 5'-GGCCGAGGCGCGCCCACCGCTGCCACCGGCAGCTTGACTTGCAGCAACAAG-3'; scFVCD3-Sfi-back, 5'-GACGCGGCCCAGCCGGCCGATATCCAGATGACCCAGTCCCCG-3'; scFvCD3-XhoI-for, 5'-ACCACTCGAGACGGTGACTAGGGTTCC-3'; scFvCEA-Asc-back, 5'-GGTGGGCGCGCCTCGGGCGGAGGTGGCTCAGGAGGGCAGGTGAAACTGCAGCAGTCTGGG-3'; scFvCEA-Not-for, 5'-GCTCGATGCGGCCGC TTAGTGATGGTGATGATGGTGACCTCCCCGTTTCAGCTCCAGCTTGGTGCC-3'; XhoI-M6-CEA-back, 5'-CCGCTCGAGTAGTACTGATGGTAATACTCAGGTGAAACTGCAGCAGTCTGG-3'; Not-HSA-back, 5'-ATAAGAATGCGGCCGCAGGTGGATCAGGCGGTGATGCACACAAGAGTGAGGTTGC-3'; LMB2, 5'-GTAAAACGACGGCCAGT-3'; HSA-His-stop-EcoRI-for, 5'-CCGGAATTCTTAGTGATGGTGATGATGGTGGCCACCGGCAGCTTGACTTGCAGCAACAAG-3'; NcoI-B7.2-back, 5'-CATGCCATGGCCGCTCCTCTGAAGATTCAAGCT-3'; B7.2-(2–225)-XhoI-for, 5'-TACCGCTCGAGCCACCTCCTGAACCGCCTCCAGGAATGTGGTCTGGGGGAGGCTG-3'; XhoI-CEA(VH)-back, 5'-AACCGCTCGAGCGGAGGCGGTTCACAGGTGAAACTGCAGCAGTCT-3'.

Cloning of Recombinant Antibody Fusion Proteins—scFvCEA corresponds to murine scFvMFE-23 (30) and was expressed in the VH-VL orientation using a (G4S)4 linker. scFvCD3 is derived from humanized variant 9 of UCHT-1 (31). VLCD3 and VHCD3 were linked by the sequence GGGGSGGRASGGGGSGGGGS.

scDbCEACD3 is organized VHCEA-VLCD3-VHCD3-VL-CEA. The cloning strategy for this format has been described elsewhere (32). All constructs were cloned in pAB1 via SfiI/NotI and exhibit a C-terminal c-Myc and a His6 tag. scFvCEA, scFvCD3, and scDbCEACD3 were further used as starting material for the cloning of taFvCD3CEA and the recombinant antibody-HSA fusion proteins. The coding sequence of HSA (amino acids 25–604 of the precursor protein) was amplified by PCR (primer: HSA-XhoI-back and HSA-Asc-for) with cDNA from human liver as a template and cloned into pAB1 via XhoI/AscI. scFvCD3 (primers: scFVCD3-Sfi-back and scFvCD3-XhoI-for) and scFvCEA (primers scFvCEA-Asc-back and scFv-CEA-Not-for) were PCR amplified and introduced N-terminal (scFvCD3) and C-terminal (scFvCEA) of the HSA sequence in the pAB1 vector, generating the bispecific scFvCD3-HSA-scFv-CEA (scFv2-HSA) construct. Through the primers, an -AAAGGSGG- linker was introduced between scFvCD3 and HSA and a -GGGGSGGRASGGGGS- linker between HSA and scFvCEA. taFvCD3CEA-HSA (taFv-HSA) was cloned by amplifying scFvCEA (primers XhoI-M6-CEA-back and LMB2) and HSA (primers Not-HSA-back and HSA-His-stop-EcoRI-for), respectively, and introducing first the HSA (NotI/EcoRI) behind the scFvCD3 into pAB1 scFvCD3-HSA-scFvCEA, generating an intermediate scFvCD3-HSA-scFvCEA-HSA product. In the next step, the HSA-scFvCEA region was replaced by scFvCEA (XhoI/NotI) introducing a -STDGNT- linker between scFvCD3 and scFvCEA and a -GGSGG- linker between scFvCEA and HSA. scDbCEACD3-HSA (scDb-HSA) was generated by replacing the scFvCD3-HSA-scFvCEA of the pAB1 scFvCD3-HSA-scFvCEA-HSA intermediate construct by scDbCEACD3 (SfiI/NotI). taFvCD3CEA was cloned by amplifying scFvCEA (primers XhoI-M6-CEA-back and scFv-CEA-Not-for) and cloning the fragment (XhoI/NotI) behind scFvCD3 in pAB1 scFvCD3-HSA-scFvCEA, replacing HSA-scFvCEA. Introduced by primer design, all cloned HSA fusion proteins and taFvCD3CEA contain a His6 tag at their C terminus. Finally, all HSA fusion protein constructs, as well as scDb-CEACD3 and the taFvCD3CEA were cloned as SfiI/EcoRI fragments into mammalian expression vector pSecTagA (Invitrogen, Karlsruhe, Germany).

For cloning of B7-DbCEA, the extracellular region of B7.2 (amino acids 2–225) was amplified by PCR (primers NcoI-B7.2-back and B7.2-(2–225)-XhoI-for) using cDNA provided by Prof. Winfried Wels (Frankfurt, Germany). In parallel DbCEA was amplified (primers XhoI-CEA(VH)-back and LMB2) from plasmid pAB1-DbCEA (33). PCR fragments of B7.2 and DbCEA were digested with NcoI/XhoI and XhoI/NotI, respectively, and cloned into pAB1 (NcoI/NotI). Finally, the whole B7-DbCEA construct was cloned (SfiI/NotI) into a modified pSecTagA vector (pSecTagA-His) devoid of the c-Myc tag sequence.

Expression and Purification of Recombinant Antibodies and Their Respective HSA Fusion Proteins—scFvCEA, scFvCD3, and scDbCEACD3 were expressed in the periplasm of Escherichia coli strain TG1. Two liters of 2x TY, 100 µg/ml ampicillin, 0.1% glucose were inoculated with 20 ml of overnight culture of transformed TG1 and grown to exponential phase (A600 = 0.8) at 37 °C. Protein expression was induced by addition of 1 mM isopropyl 1-thio-beta-D-galactopyranoside and bacteria were grown for an additional 3 h at room temperature. Cells were harvested by centrifugation and resuspended in 100 ml of 30 mM Tris-HCl, pH 8.0, 1 mM EDTA, 20% sucrose. After addition of 5 mg of lysozyme, cells were incubated for 15–30 min on ice. After addition of 10 mM Mg2SO4, cells were centrifuged at 10,000 x g for 30 min at 4 °C. Supernatant was dialyzed against PBS and loaded onto a nickel-nitrilotriacetic acid column (Qiagen, Hilden, Germany) equilibrated with 50 mM sodium phosphate buffer, pH 7.5, 500 mM NaCl, 20 mM imidazole. After a washing step (50 mM sodium phosphate buffer, pH 7.5, 500 mM NaCl, 35 mM imidazole) the His-tagged recombinant antibody fragments were eluted with 50 mM sodium phosphate buffer, pH 7.5, 500 mM NaCl, 100 mM imidazole. Protein fractions were pooled and dialyzed against PBS. Protein concentration was determined spectrophotometrically and calculated using the calculated {epsilon} value of each protein.

Plasmid-DNA (pSecTagA expression vector) encoding taFvCD3CEA, scFvCD3-HSA-scFvCEA, scDbCEACD3, scDb-CEACD3-HSA, taFvCD3CEA-HSA, and B7-DbCEA were transfected with LipofectamineTM 2000 (Invitrogen) into HEK293 cells. Stable transfectants were generated by selection with zeocin (300 µg/ml). Cells were expanded and grown in RPMI, 5% fetal calf serum to 90% confluence. For protein production cells were cultured in Opti-MEM® I (Invitrogen) replacing media every 3 days for 3–4 times. Supernatants were pooled and proteins were concentrated by ammonium sulfate precipitation (60% saturation), before loading onto a nickel-nitrilotriacetic acid column (Qiagen) (16). Purification by immobilized metal ion affinity chromatography was performed as described above.

Flow Cytometry—1 x 106 cells/well were incubated with 10 µg/ml recombinant antibody or recombinant antibody-HSA fusion protein for 2 h at 4°C. After washing, cells were incubated for 1 h at 4°C with mouse anti-His tag antibody followed by washing and 30 min incubation with fluorescein isothiocyanate-labeled anti-mouse IgG. Wash cycles and incubation steps were performed in PBS, 2% fetal calf serum, 0.02% azide. Finally, cells were analyzed by flow cytometry using an EPICS XL-MCL (Beckman Coulter, Krefeld, Germany).

ELISA—Binding properties of recombinant antibodies or antibody-HSA fusion proteins to CEA were analyzed by ELISA as following: 96-well plates were coated with carcinoembryonic antigen (300 ng/well) overnight at 4 °C. After 2 h blocking with 2% (w/v) dry milk/PBS, recombinant antibody fragments or HSA fusion proteins were titrated in duplicate and incubated for 1 h at room temperature. Detection was performed with mouse HRP-conjugated anti-His tag antibody using 3,3',5,5'-tetramethylbenzidine substrate (1 mg/ml 3,3',5,5'-tetramethylbenzidine, sodium acetate buffer, pH 6.0, 0.006% H2O2). The reaction was stopped with 50 µlof 1 M H2SO4. Absorbance was measured at 450 nm in an ELISA reader.

Binding properties of B7-DbCEA were analyzed in the following setting: 96-well plates were coated and blocked as described above, followed by incubation with 1 µM B7-DbCEA fusion protein or DbCEA for 1 h at room temperature. Detection was performed via binding to recombinant CTLA-4-Fc (1 h at room temperature) followed by anti-mouse Fc-HRP conjugate (1 h at room temperature). Plates were developed with 3,3',5,5'-tetramethylbenzidine substrate as described above.

Concentration of human IL-2 in the supernatant after T-cell retargeting was determined by an IL-2 sandwich ELISA. Anti-human IL-2 antibodies as well as the standard of recombinant human IL-2 was provided by the DuoSet IL-2 ELISA Development System kit (R&D Systems, Nordenstadt, Germany) and the assay was performed following the manufacturer's protocol.

Size Exclusion Chromatography—Apparent molecular weight of recombinant antibody and recombinant antibody-HSA fusion proteins was determined by HPLC on a BioSep-Sec-3000 column or a BioSep-Sec-2000 column (Phenomenex, Torrance, CA) with a flow rate of 0.5 ml/min and PBS as running buffer. The following standard proteins were used: thyroglobulin, apoferritin, beta-amylase, bovine serum albumin, carbonic anhydrase, and cytochrome c.

Preparation of Peripheral Blood Mononuclear Cells (PBMC)— Buffy coat (leukapheresis) from a healthy human donor was diluted 1:4 in RPMI 1640, layered onto a LSM 1077 Ficoll/Hypaque gradient (PAA, Cölbe, Germany), and centrifuged for 20 min at 670 x g at room temperature. The PBMC fraction was aspirated and washed once with medium, before resuspending in 10% Me2SO, 40% RPMI, 50% fetal calf serum and storing at -80 °C. For flow cytometry PBMCs were preactivated by incubation with phytohemagglutinin-L (1 µg/ml) and IL-2 (100 units/ml) for 3 days.


Figure 1
View larger version (38K):
[in this window]
[in a new window]

  		FIGURE 1.
Schematic presentation of recombinant antibodies and antibody fusion proteins with HSA or B7.2 extracellular domain. A, variable regions of VH and VL were joined by linkers of different length generating the recombinant antibody formats of scFv, scDb, taFv, and Db. Fusion of the recombinant antibody formats to HSA or B7.2 (ECD) led to the generation of bispecific recombinant antibody-HSA constructs (with specificity for CD3 and CEA) and the B7-Db fusion protein (with specificity for CEA and CD28/CTLA-4). B, structure of HSA with the N and C terminus marked. Structure was visualized with the PyMOL Molecular Graphics System (DeLano Scientific, San Carlos, CA).

 
Retargeting of T Cells—1 x 105 LS174T or HT1080#13.8 cells/100 µl/well were seeded in 96-well plates. The next day supernatant was removed and 100 µl of recombinant antibody ± costimulus added. After a 1-h preincubation at room temperature, 2 x 105 PBMC/100 µl/well were added. PBMCs had been thawed the day before and seeded on a culture dish, to remove monocytes by attachment to the plastic surface. Only cells that remained in suspension were used for the assay. After addition of PBMCs, the 96-well plate was incubated for 22–24 h at 37 °C, 5% CO2. Plates were centrifuged and cell-free supernatant was collected. IL-2 concentration in the supernatant was determined by ELISA.

In Vitro Stability—Antibody molecules were incubated with human serum at a concentration of 10 µg/ml for up to 24 days at 37 °C. Aliquots were taken at various time points and stored at -20 °C. The concentration of active antibody molecules was then determined by ELISA as described above including dilutions of untreated antibody molecules as reference. Half-lives were calculated by linear regression.

Pharmacokinetics—Animal care and all experiments performed were in accordance with federal guidelines and have been approved by university and state authorities. CD1 mice (female, 9–12 weeks, weight between 30 and 40 g, 3 mice/group) received intraveneous injections of 25 µg of recombinant antibody or antibody-HSA fusion protein in a total volume of 100–150 µl. In time intervals of 3, 10, 30, 60, 120, and 360 min (recombinant antibody) or 3, 30, 60, 120, 360 min, 24 h, and 6 days (recombinant antibody-HSA fusion protein) blood samples (100 µl) were taken from the tail and incubated on ice. Clotted blood was centrifuged at 10,000 x g for 10 min at 4 °C and serum samples stored at -20 °C. Serum concentration of CEA-binding recombinant antibody or recombinant antibody-HSA fusion proteins was determined by ELISA (as described above), interpolating the corresponding calibration curves. For comparison, the first value (3 min) was set to 100%. Pharmacokinetic parameters AUC, t1/2{alpha}, and t1/2beta were calculated with Excel using the first 3 times points to calculate t1/2{alpha} and the last 3 time points to calculate t1/2beta. For statistics, Student's t test was applied.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Generation of Bispecific Recombinant Antibody-HSA Fusion Proteins—The structure of HSA shows that the N and C terminus of the protein are located on opposite sites and stick out of the molecule, thus providing a good precondition for the generation of fusion proteins (Fig. 1). By genetically fusing various antibody formats to HSA, the recombinant bispecific antibody-HSA fusion proteins scFv2-HSA, scDb-HSA, and taFv-HSA were generated (Fig. 1). In the scFv2-HSA variant scFvCD3 was fused to the N terminus and scFvCEA to the C terminus of HSA by short glycine/serine-rich linkers of 5 and 15 amino acids, respectively. scDb-HSA and taFv-HSA fusion proteins were generated by fusing scDbCEACD3 or taFvCD3CEA, respectively, by a linker of 8 amino acids to the N terminus of HSA. All HSA fusion proteins were C-terminal endowed with a His tag for detection and purification.

scFvCD3 and scFvCEA were purified from the periplasm of transformed bacteria, whereas the HSA fusion proteins were purified from the cell culture supernatant of stably transfected HEK293 cells. scDb and taFv were produced in both expression systems. In the bacterial expression system the yield of scFv production was 0.3–0.35 mg/liter, i.e. three times higher than the yield of the scDb and taFv production (0.1 mg/liter). Higher yields of scDb and taFv were obtained in the mammalian expression system (5–6 mg/liter cell culture supernatant). The yields of purified HSA fusion proteins were 5 mg/liter for scFv2-HSA, 9 mg/liter for taFv-HSA, and 13 mg/liter for scDb-HSA.

In SDS-PAGE analyses all proteins were found to be highly pure and migrated according to their predicted molecular masses: scFvCD3 and scFvCEA, 28–30 kDa; scDb and taFv, 56 kDa; and scFv2-HSA, scDb-HSA, and taFv-HSA, 121 kDa (Fig. 2). Identities of the recombinant proteins were confirmed by Western blot analysis with anti-His tag antibody (not shown). Constructs were further analyzed by HPLC size exclusion chromatography (Fig. 3). scFvCEA eluted as a major peak (80%) corresponding to monomeric molecules of 29 kDa, but also contained a fraction (20%) of dimeric molecules. Similar results were obtained for scFvCD3 (not shown). scDbCEACD3 showed a major peak (96.3%) eluting with an apparent molecular mass of 48 kDa, with a small fraction corresponding in size to dimers. taFvCD3CEA also showed a predominant peak (98%) indicating an apparent molecular mass of ~27 kDa, however. This difference between calculated and apparent molecular mass was less pronounced applying fast protein liquid chromatography size exclusion chromatography using a Sephadex 200 column. In this experiment both scDb and taFv eluted at the same volume indicating an apparent molecular mass of 37–40 kDa applying the same standard proteins used for HPLC analysis (not shown). Thus, taFvCD3CEA but also scDbCEACD3 migrate in size exclusion chromatography with a lower apparent molecular mass as calculated from the amino acid sequence. Similar results were also described for other bispecific taFv molecules, e.g. directed against CD3 and fluorescein (34). All HSA fusion proteins eluted with a predominant peak (78.1% for scFv2-HSA, 96.3% for scDb-HSA and 95.1% for taFv-HSA) with an apparent molecular mass of 104–110 kDa, with the remaining protein corresponding in size mainly to dimeric molecules. Thus, the majority of HSA fusion proteins are present as monomeric molecules in the preparations.


Figure 2
View larger version (48K):
[in this window]
[in a new window]

  		FIGURE 2.
Analysis of recombinant antibodies and antibody-HSA fusion proteins by SDS-PAGE (10%). 3 µg of protein/lane was loaded under reducing (A) or non-reducing (B) conditions. The gel was stained with Coomassie Blue. Lane 1, marker; 2, scFvCEA; 3, scFvCD3; 4, scFv2-HSA; 5, scDb; 6, scDb-HSA; 7, taFv; 8, taFv-HSA; 9, HSA.

 
Binding Properties—Flow cytometry analysis of the constructs on CEA positive LS174T cells and CD3 positive PBMCs revealed strong binding of all constructs to the respective antigen-positive cells according to their specificities (Fig. 4). All CD3-specific constructs also bound to CD3+ Jurkat cells (not shown). No binding was observed to CD3 and CEA negative HEK293 cells. Furthermore, binding to purified CEA was shown in ELISA (Fig. 5). Here, binding properties of scFv, scDb, and taFv were similar, whereas signals of the respective HSA fusion proteins tended to be slightly reduced. No binding was observed with bovine serum albumin as control protein (not shown). These experiments clearly demonstrate that antigen binding of the various antibody molecules is not impaired by fusion to HSA.

Target Cell-dependent Effector Cell Activation—Bispecific antibody-mediated activation of T cells was measured by IL-2 release. In this assay, LS174T (CEA positive) target cells or CEA negative HT1080#13.8 control cells were preincubated with the constructs, followed by the addition of unstimulated PBMCs and quantification of released IL-2 after 24 h. To provide a costimulatory signal for T cell activation, a B7-DbCEA fusion protein was employed. This construct consists of the extracellular region of B7.2 (CD86) fused to the VH domain of a CEA specific diabody (Fig. 1). Due to assembly of two diabody chains the final construct possesses two B7.2 ligands as well as two CEA binding sites. The amino acid sequence of B7 contains 8 potential N-glycosylation sites. According to this, SDS-PAGE (Fig. 6A) and Western blot analysis (not shown) showed proteins migrating with an apparent molecular mass between 75 and 110 kDa, with a predominant band at 110 kDa, which is ~60 kDa larger than the molecular mass calculated from the amino acid sequence (54 kDa). This increased molecular weight is in accordance with data from a similar B7.2-scFv fusion protein directed against erbB2 and expressed in Pichia pastoris (35). This fusion protein migrated in SDS-PAGE with an apparent molecular mass of ~105 kDa, which was reduced to ~55 kDa after deglycosylation with protein N-glycosidase F. HPLC size exclusion chromatography revealed the presence of a single protein fraction with an apparent molecular mass of 490 kDa (Fig. 6B). This is about twice the size calculated for the dimeric B7-DbCEA molecule and might be due to an extended structure of this molecule. In comparison, a B7.2-scFvCEA fusion protein not prone to dimer formation eluted with a major peak corresponding to a molecular mass of 200 kDa and a minor peak with approximately twice the molecular mass, which most likely represent dimeric molecules (not shown). This finding further supports the assumption that the B7-DbCEA protein is present as a dimeric molecule. Simultaneous binding of B7-Db-CEA to CEA and the B7 receptor CTLA-4 was demonstrated in ELISA (Fig. 6C). Costimulatory activity of B7-DbCEA in combination with scDbCEACD3 as first stimulus was seen after binding to CEA positive cells incubated with 15 nM of both proteins (Fig. 6D). In this experiment, IL-2 release of PBMCs incubated with scDbCEACD3 and B7-DbCEA was increased 2.5-fold compared with cells incubated with scDbCEACD3 in the absence of B7-DbCEA (DbCEA or scFvCEA were added in these experiments as a substitute for B7-DbCEA). Only very small amounts of IL-2 (similar to medium control) were released after incubation of target and effector cells with B7-DbCEA, indicating that B7-DbCEA is not sufficient to stimulate effector cells on its own. Incubation of PMBCs with both antibody molecules in the absence of target cells caused only a marginal release of IL-2 (~10% of IL-2 release induced by cell-bound molecules) (Fig. 6D), clearly demonstrating that target cell-mediated presentation of the constructs is necessary for effector cell activation and costimulatory activity.


Figure 3
View larger version (24K):
[in this window]
[in a new window]

  		FIGURE 3.
HPLC size exclusion chromatography. HPLC analysis of scFvCEA (A), scDb (B), taFv (C), scFv2-HSA (D), scDb-HSA (E), and taFv-HSA (F) using BioSep-Sec-3000 or BioSep-Sec-2000 columns.

 


Figure 4
View larger version (21K):
[in this window]
[in a new window]

  		FIGURE 4.
Analysis of binding properties by flow cytometry. LS174T, preactivated PBMC, and HEK293 cells were incubated with 10 µg/ml of the recombinant antibody constructs. Detection was performed with anti-His tag antibody and fluorescein isothiocyanate-labeled anti-mouse IgG antibody. Filled, detection system; solid line, antibody molecules.

 


Figure 5
View larger version (19K):
[in this window]
[in a new window]

  		FIGURE 5.
Binding of recombinant antibodies and antibody-HSA fusion proteins to CEA in ELISA. Titration of scDb (A), scFvCEA (B), and taFv (C) and the respective HSA fusion proteins for binding to CEA. Detection was performed with an HRP-conjugated anti-His tag antibody. Duplicate samples were analyzed.

 


Figure 6
View larger version (34K):
[in this window]
[in a new window]

  		FIGURE 6.
Characterization of B7-DbCEA. A, Coomassie-stained SDS-PAGE (10%) of purified B7-DbCEA protein under reducing and non-reducing conditions. B, size exclusion chromatography of B7-DbCEA by HPLC. C, simultaneous binding of B7-DbCEA to CEA and recombinant CTLA-4. ELISA plate was coated with CEA (3 µg/ml) and incubated with 1 µM B7-DbCEA or DbCEA. Detection was performed by CTLA-4-Fc, followed by anti-mouse Fc-HRP. D, costimulatory property of B7-Db. PBMCs were incubated for 22 h with 15 nM scDb-CEACD3 in the presence or absence of B7-DbCEA in solution or with the constructs presented on LS174T cells. IL-2 release was determined by ELISA from duplicate samples.

 
Next, we analyzed all bispecific antibody molecules for activation of PBMCs in the presence or absence of a costimulatory signal applying 40 nM bispecific antibody molecules and B7-DbCEA. Using LS174T as CEA-expressing target cells all CEAxCD3 bispecific constructs induced IL-2 release from PBMCs, which was further ~2-fold increased in the presence of B7-DbCEA (Fig. 7A). No increased IL-2 release compared with medium control was observed for HSA or bispecific scDbFAPCD3 directed against fibroblast activation protein (FAP) and CD3 and included as negative control protein (see also Fig. 4). The scDb-HSA fusion protein induced IL-2 release similar to scDbCEACD3. scFv2-HSA showed a reduced release compared with scDb or scDb-HSA. taFvCD3CEA showed the strongest signals, whereas IL-2 release induced by taFv-HSA was between that of scDb-HSA and scFv2-HSA. In a further experiment we analyzed selectivity of activation using CEA negative but FAP positive HT1080#13.8 cells (Fig. 7B). As expected, scDb, scDb-HSA, and scFv2-HSA did not induce effector cell activation, in contrast to scDbFAPCD3, which is able to bind to these cells. Surprisingly, taFvCD3CEA also showed strong induction of IL-2 release when incubated with HT1080#13.8 cells similar to that observed with LS174T. These results were confirmed with 2 further independently prepared taFv samples produced in mammalian cells (not shown). Induction of IL-2 release was also observed when taFv was incubated with effector cells in the absence of target cells, whereas all other constructs did not induce any IL-2 release in these experiments (not shown). taFv-HSA showed some increased IL-2 release when incubated together with B7-DbCEA on CEA negative HT1080#13.8 cells. In further experiments we also tested lower concentrations of our bispecific molecules. Strong activation and costimulation was still seen using antibody concentrations of 5 nM. At this antibody concentration IL-2 release, especially that induced by scDb, was stronger compared with IL-2 release at 40 nM. This observation is in accordance with a more detailed titration of scDb for activation of PBMCs indicating an optimum between 2.5 and 10 nM under the applied assay conditions, which might be caused by competing effects of scFvCEA at higher concentrations (not shown). IL-2 release was reduced almost to background signals at 0.2 nM, with the exception of taFvCD3CEA, which induced strong IL-2 release also at this concentration (Fig. 7, C and D).

In Vitro Stability and Pharmacokinetic Properties—In vitro stability was analyzed by incubation of the constructs in human serum at 37 °C for up to 24 days and subsequent measurement of CEA binding activity in ELISA. All constructs were found to be highly stable under these conditions (t1/2 > 4 days) (not shown). The pharmacokinetic properties of the recombinant proteins were analyzed by ELISA of serum samples after a single dose injection (25 µg intravenously) into CD1 mice (Fig. 8 and Table 1). This allowed for the detection of molecules in the serum that retained binding activity for CEA. All proteins showed a biphasic elimination from circulation. scFvCEA was rapidly eliminated from circulation (t1/2{alpha} = 5 min). scDb and taFv showed a slightly increased circulation time (t1/2{alpha} = 8–9 min). Circulation time was drastically increased for all HSA fusion proteins. Thus, t1/2{alpha} was increased to 37 min for taFv-HSA, 43 min for scDb-HSA, and even 117 min for scFv2-HSA. The improvement of pharmacokinetic properties was also demonstrated by comparison of the area under the curve (AUC). For the bispecific constructs (scDb, taFv) the AUC(0–24 h) increased by a factor of 6–7 after fusion to HSA. The scFv2-HSA showed the highest AUC, which was ~1.3 times that of scDb-HSA and taFv-HSA.


View this table:
[in this window]
[in a new window]

  		TABLE 1
Pharmacokinetic parameters of recombinant antibodies and antibody-albumin fusion proteins

 


Figure 7
View larger version (31K):
[in this window]
[in a new window]

  		FIGURE 7.
Target cell-mediated activation of PBMCs by bispecific recombinant antibody-HSA fusion proteins. LS174T (A) and HT1080#13.8 (B) cells were preincubated for 1 h with 40 nM bispecific recombinant antibody construct in the presence (B7-DbCEA) or absence (scFvCEA) of 40 nM costimulus. PBMCs were added and IL-2 concentration in the cell culture supernatant measured after 22–24 h by ELISA from duplicate samples. Antibody constructs were further analyzed on LS174T cells applying 5 (C) or 0.2 (D) nM antibody molecules.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
In this study we show that fusion of recombinant antibody molecules to HSA leads to a drastic improvement of their pharmacokinetic properties, without impairing their target binding capacity. All HSA fusion proteins could be produced at high yields (5–13 mg/liter cell culture supernatant) in mammalian cells. These yields were similar to that observed for scDb and taFv molecules indicating that fusion to albumin does not interfere with protein synthesis and secretion. Comparable yields (7.5–9 mg/liter) were also described for scFv-HSA fusion proteins expressed in a P. pastoris expression system (20).

Our study showed that the biological activity, i.e. effector cell activation, is influenced by the format used for the generation of bispecific antibody albumin fusion proteins. Strong and target cell-dependent activation of effector cells was observed with scDb as well as with the scDb-HSA fusion protein. scFv2-HSA-mediated PBMC activation was significantly reduced compared with scDb-HSA. Considering the location of the scFv moieties on opposite sites of the HSA molecule, the HSA moiety might lead to insufficient cell proximity to promote strong receptor cross-linking. This is supported by the fact that in scDb molecules the two antigen-binding sites are ~6 nm apart, whereas in scFv2-HSA molecules this distance varies strongly and can be up to 18 nm.

Surprisingly, the taFv construct and to some extent also the taFv-HSA construct induced strong but nonspecific activation of PBMCs. Size exclusion chromatography indicates that this is most likely not caused by taFv multimers or aggregates. In addition, because all other antibody constructs were produced and purified the same way, it is unlikely that copurified molecules account for this stimulatory activity. Several other bispecific taFv molecules for the retargeting of T cells via CD3 to tumor cells have been described in the literature using different arrangements of variable domains and linker compositions (for an overview see Ref. 4). Target cell-specific T cell activation and cytotoxicity was described for these molecules. This points to an intrinsic T cell activating property of the taFv molecules analyzed in our study. The taFv molecule and the scDb molecule used in this study are composed of the same variable domains, differing only in the arrangement and the linker sequences used to connect these domains. The taFv format is predicted to be more flexible than the scDb format. This might be reflected in the unexpected behavior of the taFv molecule observed in the HPLC analysis. Furthermore, it might be possible that the taFv molecule binds to CD3 via the CD3-specific scFv moiety and that due to the flexibility of the molecule, especially of the middle linker region, other parts of the molecule interact with cell surface molecules or receptors of the T cell leading to target cell-independent activation and IL-2 release. Further studies, e.g. testing other taFv molecules or taFv molecules with different linker sequences, are necessary to clarify this issue.


Figure 8
View larger version (17K):
[in this window]
[in a new window]

  		FIGURE 8.
Improved pharmacokinetic properties of recombinant antibodies after fusion to HSA. Serum concentrations of the various recombinant bispecific antibodies and antibody HSA fusion proteins were determined after various time points after intravenous injection (25 µg) into CD1 mice (n = 3). Data were normalized considering maximal concentration at the first time point (3 min). A, scDb and scDb-HSA; B, taFv and taFv-HSA; C, scFv2-HSA and scFvCEA.

 
Our findings indicate that the scDb and scDb-HSA format is particularly effective in effector cell activation. Importantly, this activation did not occur in the absence of CEA-expressing target cells or with CEA negative target cells. Thus, T cell receptor clustering requires the membrane-bound presentation of the bispecific antibody molecule mediated by binding to the target antigen. Fusion to HSA does not impair this process. Target cell-dependent stimulation by scDb and scDb-HSA was further enhanced by the B7-DbCEA fusion protein. This is in accordance with previous data of a fusion protein of the extracellular region of B7-2 and a scFv specific for ErbB2 (35). In our hands a B7-2-(2–225)-scFvCEA molecule did not reach the costimulatory effect induced by the B7-DbCEA form, probably due to insufficient cross-linking (not shown). Thus, dimerization of the B7 component arising from the fusion to the diabody format might facilitate efficient clustering of CD28 on the T cell, gaining stronger costimulatory effects. For a B7-DbCEA construct, composed of the extracellular domain of B7.1 fused to DbCEA, cis- and trans-costimulation has been reported (36). In a gene therapy approach, DNA encoding this costimulatory molecule was applied together with DNA for the bispecific DbCEACD3 in a xenograft mouse model, leading to growth delay of established tumors (5). B7-recombinant antibody fusion proteins are thought to open the possibility to direct and localize the costimulatory activity to the tumor site. If this promising concept is also applicable for the B7-DbCEA in vivo remains to be demonstrated in further studies.

Prolonged circulation times were found for all albumin fusion proteins. The increase in circulation half-lives and AUC correlates with data of Smith and co-workers (20), who reported pharmacokinetic properties of different recombinant antibody-albumin conjugates and fusion proteins in rat. In this study, scFv-HSA fusion proteins showed ~12-fold longer half-lives in comparison with a F(ab')-Cys recombinant antibody. In addition, the conjugation of F(ab') to RSA as well as an RSA binding approach through bispecific F(ab')2 (anti-RSA x anti-tumor necrosis factor) resulted in a significant increase (17- and 8-fold) in AUC(0-°) compared with F(ab')-Cys and a control F(ab')2 construct (not specific for RSA). In rats the pharmacokinetics of RSA and HSA differed markedly, i.e. HSA showed a faster elimination than RSA. Thus, RSA had a t1/2{alpha} = 4.1 h and a t1/2beta = 49.1 h, whereas HSA had a t1/2{alpha} = 0.8 h (48 min) and a t1/2beta = 14.8 h. Our HSA fusion proteins showed similar or even better values in mice with t1/2{alpha} between 37 and 117 min and a t1/2beta between 40 and 47 h indicating that the antibody fusion part (probably through increase in size of the fusion protein) also contributes to prolonged circulation time. This finding is in accordance with results of various other HSA fusion proteins, which showed improved pharmacokinetic properties in various animals including mice (25, 27–29). In addition, improved therapeutic activities were observed for HSA fusion proteins (25–28). Very little data are available on the pharmacokinetic properties of albumin fusion proteins in humans. A prolonged circulation time of an albumin-interferon-{alpha} fusion protein was reported in a phase I/II clinical trial. In this study an increase of mean elimination half-life from 2–3 to 159 h (6.6 days) was observed, supporting a dosing schedule at 2–4-week intervals (37). This half-life is significantly shorter than that of albumin, which is 19 days in humans. Currently, we cannot exclude that fusion of an antibody molecule or other proteins to the N and/or C terminus of albumin has an influence on pharmacokinetic properties mediated by the albumin moiety, e.g. whether FcRn-mediated recycling is affected.

Other approaches to improve pharmacokinetic properties of recombinant antibodies focus on increasing the apparent molecular size by PEGylation. Several recombinant antibody formats have been conjugated in a site-specific manner to PEG chains of different length (5–40 kDa) increasing the serum half-life significantly (11). However, cases have been reported where PEGylation of monomeric or dimeric scFv molecules led to a reduced affinity (38). PEGylated F(ab')2 and diabody fragments specific for CEA have shown in xenograft tumor mouse models prolonged plasma half-life and increased tumor accumulation (39, 40). The latter is thought to be attributed in part to the enhanced permeability and retention effect (EPR) observed in solid tumors, where enhanced vascular permeability goes along with the retention of macromolecules inside the tumor. This aspect might be also conceivably important for HSA-antibody fusion proteins.

In summary, we could show that fusion of recombinant bispecific antibody molecules to albumin results in a prolonged circulation. Furthermore, our findings indicate that the scDb-HSA format is particularly effective in effector cell activation in a target cell-dependent manner. Further studies have to show if this improvement of pharmacokinetic properties translates into improved anti-tumor activity in vivo.


   FOOTNOTES
 
* This work was supported in part by Deutsche Forschungsgemeinschaft Grant Ko1461/2. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Current address: Hoffmann-La Roche AG, Grenzacherstrasse 124, CH-4070 Basel, Switzerland. Back

2 Current address: GSF-National Research Center for Environment and Health, Marchioninistr. 25, 81377 München, Germany. Back

3 To whom correspondence should be addressed. Tel.: 49-711-685-66989; Fax: 49-711-685-67484; E-mail: roland.kontermann{at}izi.uni-stuttgart.de.

4 The abbreviations used are: Db, diabody; AUC, area under the curve; CEA, carcinoembryonic antigen; HSA, human serum albumin; PBMC, peripheral blood mononuclear cell; PEG, polyethylene glycol; RSA, rat serum albumin; scFv, single chain Fv; scDb, single chain diabody; taFv, tandem scFv; IL, interleukin; PBS, phosphate-buffered saline; ELISA, enzyme-linked immunosorbent assay; HPLC, high performance liquid chromatography; FPLC, fast protein liquid chromatography; FAP, fibroblast activation protein; VH, heavy chain variable domain; VL, light chain variable domain. Back


   ACKNOWLEDGMENTS
 
We thank Katja Stolpa for technical assistance. Furthermore, we thank Genentech for making DNA of the humanized anti-CD3 antibody UCHT1 available. We also thank Prof. Winfried Wels (Georg-Speyer-Haus, Frankfurt) for providing B7.2 cDNA, Prof. Gabriele Multhoff for supplying buffy coat from a healthy human donor, and Sabine Münkel (IZI, Stuttgart) for HPLC analysis.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Müller, D., and Kontermann, R. E. (2007) in Handbook of Therapeutic Antibodies (Kontermann, R. E., and Dübel, S. eds), Vol. 2, pp. 345-378, Wiley-VCH, Weinheim
  2. Peipp, M., and Valerius, T. (2002) Biochem. Soc. Trans. 30, 507-511[CrossRef][Medline] [Order article via Infotrieve]
  3. Van Spriel, A. B., van Ojik, H. H., and van de Winkel, J. G. J. (2000) Immunol. Today 21, 391-396[CrossRef][Medline] [Order article via Infotrieve]
  4. Kontermann, R. E. (2005) Acta Pharmacol. Sin. 26, 1-9[CrossRef][Medline] [Order article via Infotrieve]
  5. Blanco, B., Holliger, P., Vile, R. G., and Alvarez-Vallina, L. (2003) J. Immunol., 171, 1070-1077[Abstract/Free Full Text]
  6. Schlereth, B., Fichtner, I., Lorenczewski, G., Kleindienst, P., Brischwein, K., da Silva, A., Kufer, P., Lutterbuese, R., Junghahn, I., Kasimir-Bauer, S., Wimberger, P., Kimmig, R., and Baeuerle, P.A. (2005) Cancer Res. 65, 2882-2889[Abstract/Free Full Text]
  7. Dreier, T., Baeuerle, P. A., Fichtner, I., Grun, M., Schlereth, B., Lorenczewski, G., Kufer, P., Lutterbuse, R., Riethmüller, G., Gjorstrup, P., and Bargou, R. C. (2003) J. Immunol. 170, 4397-4402[Abstract/Free Full Text]
  8. Cochlovius, B., Kipriyanov, S. M., Stassar, M. J., Christ, O., Schuhmacher, J., Strauss, G., Moldenhauer, G., and Little, M. (2000) J. Immunol. 165, 888-895[Abstract/Free Full Text]
  9. Huhalov, A., and Chester, K. A. (2004) Q. J. Nucl. Med. Mol. Imaging 48, 279-288[Medline] [Order article via Infotrieve]
  10. Kipriyanov, S. M., Moldenhauer, G., Schuhmacher, J., Cochlovius, B., Von der Lieth, C. W., Matys, E. R., and Little, M. (1999) J. Mol. Biol. 293, 41-56[CrossRef][Medline] [Order article via Infotrieve]
  11. Chapman, A. P. (2002) Adv. Drug Delivery Rev. 54, 531-545[CrossRef][Medline] [Order article via Infotrieve]
  12. Chapman, A. P., Antoniw, P., Spitali, M., West, S., Stephens, S., and King, D. J. (1999) Nat. Biotechnol. 17, 780-783[CrossRef][Medline] [Order article via Infotrieve]
  13. Yang, K., Basu, A., Wang, M., Chintala, R., Hsieh, M. C., Liu, S., Hua, J., Zhang, Z., Zhou, J., Li, M., Phyu, H., Petti, G., Mendez, M., Janjua, H., Peng, P., Longley, C., Borowski, V., Mehlig, M., and Filpula, D. (2003) Protein Eng. 16, 761-770[Abstract/Free Full Text]
  14. Kubetzko, S., Sarkar, C. A., and Plückthun, A. (2005) Mol. Pharmacol. 68, 1439-1454[Abstract/Free Full Text]
  15. Bailon, P., Palleroni, A., Schaffer, C. A., Spence, C. L., Fung, W. J., Porter, J. E., Ehrlich, G. K., Pan, W., Xu, Z. X., Modi, M. W., Farid, A., and Berthold, W. (2001) Bioconjugate Chem. 12, 195-202[CrossRef][Medline] [Order article via Infotrieve]
  16. Alt, M., Müller, R., and Kontermann, R. E. (1999) FEBS Lett. 454, 90-94[CrossRef][Medline] [Order article via Infotrieve]
  17. Marvin, J. S., and Zhu, Z. (2005) Acta Pharmacol. Sin. 26, 649-658[CrossRef][Medline] [Order article via Infotrieve]
  18. Völkel, T., Korn, T., Bach, M., Müller, R., and Kontermann, R. E. (2001) Protein Eng. 14, 815-823[Abstract/Free Full Text]
  19. Chuang, V. T., Kragh-Hansen, U., and Otagiri, M. (2002) Pharmacol. Res. 19, 569-577[CrossRef]
  20. Smith, B. J., Popplewell, A., Athwal, D., Chapman, A. P., Heywood, S., West, S. M., Carrington, B., Nesbitt, A., Lawson, A. D., Antoniw, P., Eddelston, A., and Suitters, A. (2001) Bioconjugate Chem. 12, 750-756[CrossRef][Medline] [Order article via Infotrieve]
  21. Dennis, M. S., Zhang, M., Meng, Y. G., Kadkhodayan, M., Kirchhofer, D., Combs, D., and Damico, L. A. (2002) J. Biol. Chem. 277, 35035-35043[Abstract/Free Full Text]
  22. Kragh-Hansen, U., Chuang, V. T., and Otagiri, M. (2002) Biol. Pharm. Bull. 25, 695-704[CrossRef][Medline] [Order article via Infotrieve]
  23. Chaudhury, C., Mehnaz, S., Robinson, J. M., Hayton, W. L., Pearl, D. K., Roopenian, D. C., and Anderson, C. L. (2003) J. Exp. Med. 197, 315-322[Abstract/Free Full Text]
  24. Chaudhury, C., Brooks, C. L., Carter, D. C., Robinson, J. M., and Anderson, C. L. (2006) Biochemistry 45, 4983-4990[CrossRef][Medline] [Order article via Infotrieve]
  25. Duttaroy, A., Kanakaraj, P., Osborn, B. L., Schneider, H., Pickeral, O. K., Chen, C., Zhang, G., Kaithamana, S., Singh, M., Schulingkamp, R., Crossan, D., Bock, J., Kaufman, T. E., Reavey, P., Carey-Barber, M., Krishnan, S. R., Garcia, A., Murphy, K., Siskind, J. K., McLean, M. A., Cheng, S., Ruben, S., Birse, C. E., and Blondel, O. (2005) Diabetes 54, 251-258[Abstract/Free Full Text]
  26. Osborn, B. L., Sekut, L., Corcoran, M., Poortman, C., Sturm, B., Chen, G., Mather, D., Lin, H. L., and Parry, T. J. (2002) Eur. J. Pharmacol. 456, 149-158[CrossRef][Medline] [Order article via Infotrieve]
  27. Osborn, B. L., Olsen, H. S., Nardelli, B., Murray, J. H., Zhou, J. X., Garcia, A., Moody, G., Zaritskaya, L. S., and Sung, C. (2002) J. Pharmacol. Exp. Ther. 303, 540-548[Abstract/Free Full Text]
  28. Sung, C., Nardelli, B., LaFleur, D. W., Blatter, E., Corcoran, M., Olsen, H. S., Birse, C. E., Pickeral, O. K., Zhang, J., Shah, D., Moody, G., Gentz, S., Beebe, L., and Moore, P. A. (2003) J. Interferon Cytokine Res. 23, 25-36[CrossRef][Medline] [Order article via Infotrieve]
  29. Melder, R. J., Osborn, B. L., Riccobene, T., Kanakaraj, P., Wei, P., Chen, G., Stolow, D., Halpern, W. G., Migone, T. S., Wang, Q., Grzegorzewski, K. J., and Gallant, G. (2005) Cancer Immunol. Immunother. 54, 535-547[CrossRef][Medline] [Order article via Infotrieve]
  30. Chester, K. A., Begent, R. H., Robson, L., Keep, P., Pedley, R. B., Boden, J. A., Boxer, G., Green, A., Winter, G., Cochet, O., and Hawkins, R. E. (1994) Lancet 343, 455-456[CrossRef][Medline] [Order article via Infotrieve]
  31. Zhu, Z., and Carter, P. (1995) J. Immunol. 155, 1903-1910[Abstract]
  32. Korn, T., Völkel, T., and Kontermann, R. E. (2001) in Antibody Engineering, A Laboratory Manual (Dübel, S., ed) 1st Ed., pp. 619-636, Springer, Heidelberg
  33. Kontermann, R. E., Martineau, P., Cummings, C. E., Karpas, A., Allen, D., Derbyshire, E., and Winter, G. (1997) Immunotechnology 3, 137-144[CrossRef][Medline] [Order article via Infotrieve]
  34. Gruber, M., Schodin, B. A., Wilson, E. R., and Kranz, D. M. (1994) J. Immunol. 152, 5368-5374[Abstract]
  35. Gerstmayer, B., Altenschmidt, U., Hoffmann, M., and Wels, W. (1997) J. Immunol. 158, 4584-4590[Abstract]
  36. Blanco, B., Holliger, P., and Alvarez-Vallina, L. (2002) Cancer Gene Ther. 9, 275-281[CrossRef][Medline] [Order article via Infotrieve]
  37. Balan, V., Nelson, D. R., Sulkowski, M. S., Everson, G. T., Lambiase, L. R., Wiesner, R. H., Dickson, R. C., Post, A. B., Redfield, R. R., Davis, G. L., Neumann, A. U., Osborn, B. L., Freimuth, W. W., and Subramanian, G. M. (2006) Antiviral Ther. 11, 35-45[Medline] [Order article via Infotrieve]
  38. Kubetzko, S., Balic, E., Waibel, R., Zangemeister-Wittke, U., and Plückthun, A. (2006) J. Biol. Chem. 281, 35186-35201[Abstract/Free Full Text]
  39. Pedley, R. B., Boden, J. A., Boden, R., Begent, R. H., Turner, A., Haines, A. M., and King, D. J. (1994) Br. J. Cancer 70, 1126-1130[Medline] [Order article via Infotrieve]
  40. Li, L., Yazaki, P. J., Anderson, A. L., Crow, D., Colcher, D., Wu, A. M., Williams, L. E., Wong, J. Y., Raubitschek, A., and Shively, J. E. (2006) Bioconjugate Chem. 17, 68-76[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Protein Eng Des SelHome page
C. Germain, E. Campigna, I. Salhi, S. Morisseau, I. Navarro-Teulon, J.-P. Mach, A. Pelegrin, and B. Robert
Redirecting NK cells mediated tumor cell lysis by a new recombinant bifunctional protein
Protein Eng. Des. Sel., November 1, 2008; 21(11): 665 - 672.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. Stork, K. A. Zettlitz, D. Muller, M. Rether, F.-G. Hanisch, and R. E. Kontermann
N-Glycosylation as Novel Strategy to Improve Pharmacokinetic Properties of Bispecific Single-chain Diabodies
J. Biol. Chem., March 21, 2008; 283(12): 7804 - 7812.
[Abstract] [Full Text] [PDF]

Home page
 Protein Eng Des SelHome page
R. Stork, D. Muller, and R. E. Kontermann
A novel tri-functional antibody fusion protein with improved pharmacokinetic properties generated by fusing a bispecific single-chain diabody with an albumin-binding domain from streptococcal protein G
Protein Eng. Des. Sel., November 3, 2007; (2007) gzm061v1.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/17/12650    most recent
M700820200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Müller, D.
Right arrow Articles by Kontermann, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Müller, D.
Right arrow Articles by Kontermann, R. E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement