HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 282, Issue 18, 13180-13189, May 4, 2007

This Article Abstract Full Text (PDF) All Versions of this Article: 282/18/13180    most recent M607849200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Doerner, J. F. Articles by Wetzel, C. H. Search for Related Content PubMed PubMed Citation Articles by Doerner, J. F. Articles by Wetzel, C. H. Social Bookmarking                      What's this?

Transient Receptor Potential Channel A1 Is Directly Gated by Calcium Ions^*

From the Lehrstuhl fuer Zellphysiologie, Fakultaet Biologie, Ruhr-Universitaet Bochum, 44780 Bochum, Germany

Received for publication, August 16, 2006 , and in revised form, February 20, 2007.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Members of the superfamily of transient receptor potential (TRP) channels are proposed to play important roles in sensory physiology. As an excitatory ion channel TRPA1 is robustly activated by pungent irritants in mustard and garlic and is suggested to mediate the inflammatory actions of environmental irritants and proalgesic agents. Here, we demonstrate that, in addition to pungent natural compounds, Ca²⁺ directly gates heterologously expressed TRPA1 in whole-cell and excised-patch recordings with an apparent EC₅₀ of 905 nM. Pharmacological experiments and site-directed mutagenesis indicate that the N-terminal EF-hand calcium-binding domain of the channel is involved in Ca²⁺-dependent activation. Furthermore, we determine Ca²⁺ as prerequisite for icilin activity on TRPA1.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The transient receptor potential channel A1 (TRPA1)² is a member of the superfamily of TRP channels. In mammals, A1 forms its own subfamily and is distinguished from other TRP channels by the presence of 14 ankyrin repeats in its N terminus (1). TRPA1 was initially described as a cold sensitive nonselective cation channel (2), but it also functions as a ligand-gated channel in heterologous expression systems and sensory neurons (3). The pungent ingredients in mustard (allyl isothiocyanate, AITC) and garlic (allicin) robustly activate TRPA1 currents (4–6). In addition, TRPA1 appears to be regulated by phospholipase C (PLC)-coupled receptors, suggesting that channel opening can be mediated by second messengers (4, 7, 8).

TRPA1 expression was first described in a subset of sensory neurons of dorsal root and trigeminal ganglia that contribute to nociception and co-express calcitonin gene related peptide, substance P and TRPV1 (2, 4). Recent studies on TRPA1 deficient mice support a role of the channel in inflammatory pain and sensation of noxious cold (8, 9). A model suggests TRPA1 activation by bradykinin, a potent algogenic substance released due to tissue injury and inflammation, in two possible ways: through PLC-mediated increases in intracellular Ca²⁺ or other metabolites (e.g. diacylglycerol) and via Ca²⁺ influx through TRPV1 (9). Whether an increase in intracellular Ca²⁺ is sufficient to activate TRPA1 is still debated (4, 7), but several findings indicate a role of Ca²⁺ on TRPA1 function. It was shown that extracellular Ca²⁺ enhances the current rate and magnitude of AITC-induced currents (4, 10). Furthermore, Ca²⁺ is thought to be responsible for fast channel closure (10). In addition, single channel recordings of heterologously expressed TRPA1 revealed an AITC-induced conductance, which is reduced in the presence of Ca²⁺ (10). Together these reports emphasize the importance of Ca²⁺ for TRPA1 function.

Very recently the existence of a putative EF-hand calcium-binding domain (EF-hand CBD) at the N terminus of TRPA1 was reported (11). The EF-hand CBD is the most common motif among Ca²⁺-binding sites of a large number of Ca²⁺-interacting proteins (12). The classical EF-hand is a helix-loop-helix motif that coordinates the Ca²⁺ ion in a pentagonal pyramidal configuration. The domain consists usually of 12 residues, whereas six residues in positions 1, 3, 5, 7, 9, and 12 are postulated to be involved in Ca²⁺-binding (12).

In this study we set out to clarify the role of Ca²⁺ on TRPA1 channel activation by studying human TRPA1 transiently expressed in HEK293 cells. Consistent with previous studies on AITC, our results show that Ca²⁺ potentiates the cinnamaldehyde- and carvacrol-induced responses. In addition, we determine Ca²⁺ as essential co-agonist for icilin activity on TRPA1. Interestingly, Ca²⁺ also directly activates TRPA1 (EC₅₀ of 905 nM) in whole-cell and excised inside-out patch recordings. The mechanism underlying Ca²⁺-dependent activation is analyzed using pharmacological approaches and mutagenesis studies, thereby identifying the EF-hand CBD as potential Ca²⁺-binding site.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Cells Culture—Human embryonic kidney 293 and 293T cells (HEK293) were grown in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 2 mM L-glutamine, 100 µg/ml penicillin/streptomycin (Invitrogen, Karlsruhe, Germany) at 37 °C in a humidity controlled incubator with 5% CO₂.

Transient Expression of Human TRPA1 and Mutagenesis—For transient expression of human TRPA1 (hTRPA1) we used a recombinant expression plasmid (pcDNA5-FRT) carrying the entire protein coding region for hTRPA1. The plasmid was kindly provided by H.-J. Behrendt. Semiconfluent HEK293 cells were transiently transfected (2 µg of hTRPA1 cDNA per dish) in 35-mm dishes (Flacon, BD Bioscience, Heidelberg, Germany) using the CaP-precipitation method as described previously (13). Co-transfected pIRES-EGFP (0.2 µg per dish) served as transfection marker. All recordings were performed at room temperature 24–48 h after transfection. Untransfected cells were used for control recordings.

For point mutations to the putative TRPA1 EF-hand CBD we followed established protocols. Briefly, overlap extension PCR (14) was used to perform site-directed mutagenesis of the EF-hand domain. The six residues reported to be involved in binding of the Ca²⁺ ion are in positions 1, 3, 5, 7, 9, and 12 (12). We exchanged the amino acids in these positions to alanine to induce the loss of Ca²⁺-binding capability (D468A, S470A, T472A, L474A, N476A, D479A). The primer pairs used for mutations were as follows: external primers, CTGATGATATCGTCCTATTCTGGTAGCG (forward) and GCATCATGCTGAAGGTCTGGATTATAGA (reverse); pos 1 (D468A), GAGGCTCCTACAAGCCATAAGTGA (forward) and CTCGTATCACTTATGGCTTGTAGGAGC (reverse); pos 3 (S470A), CTACAAGACATAGCTGATACGAGG (forward) and AAGCCTCGTATCAGCTATGTCTTGTAG (reverse); pos 5 (T472A), ATAAGTGATGCGAGGCTTCTGAATG (forward) and CTTCATTCAGAAGCCTCGCATCACTTATG (reverse); pos 7 (L474A), GATACGAGGGCTCTGAATGAAGGTGAC (forward) and AGGTCACCTTCATTCAGAGCCCTCGTATC (reverse); pos 9 (N476A), AGGCTTCTGGCTGAAGGTGACCTTCA (forward) and CATGAAGGTCACCTTCAGCCAGAAGCCTCG (reverse); pos 12 (D479A), GAATGAAGGTGCACTTCATGGAATG (forward) and GTCATTCCATGAAGTGCACCTTCATTC (reverse). The different PCR products carrying the corresponding mutation were cloned into the HpaI/BamHI sites of hTRPA1. The nucleotide sequence of the mutants was verified by sequencing the corresponding cDNA.

Solutions—For electrophysiological measurements all solutions were adjusted to pH 7.3. The experimental solutions contained the following (in mM) for whole-cell experiments: standard extracellular solution, 140 NaCl, 5 KCl, 10 HEPES, 2 CaCl₂, 1 MgCl₂; Ca²⁺-free solution, 140 NaCl, 5 KCl, 10 HEPES, 1 MgCl₂, 5 EGTA; standard intracellular solution, 140 KCl, 1 MgCl₂, 0.1 CaCl₂, 5 EGTA, 10 HEPES. For ramp protocols KCl was replaced by CsCl.

For whole-cell recordings of Ca²⁺-activated currents, CaCl₂ was added either to the standard extracellular solution resulting in a concentration of 10 mM CaCl₂ or to the standard intracellular solution resulting in a concentration of 5 mM CaCl₂. The intracellular solution for the Ca²⁺ dose-response curve contained 140 KCl, 10 HEPES, 1 MgCl₂, 10 EGTA. Ca²⁺ was added as follows: 4.918 mM CaCl₂ for 100 nM free Ca²⁺, 7.421 mM CaCl₂ for 300 nM free Ca²⁺, 9.05 mM CaCl₂ for 1 µM free Ca²⁺, 9.663 mM CaCl₂ for 3 µM free Ca²⁺, 9.906 mM CaCl₂ for 10 µM free Ca²⁺, 9.995 mM CaCl₂ for 30 µM free Ca²⁺. The free Ca²⁺ concentration was calculated by the software WCabuf (G. Droogmans, Leuven, Belgium).

The influence of Ca²⁺ on icilin-induced currents was studied by adding 5 mM BAPTA to the standard intracellular solution or increasing the extracellular Ca²⁺ concentration to 5 mM CaCl₂.

For excised-patch recordings pipette and bath solutions were symmetric (in mM): 140 NaCl, 10 HEPES, 2 EGTA. Solutions with nano- or micromolar concentrations of free Ca²⁺ were obtained by adding CaCl₂ to this EGTA-based buffer as follows: 1.012 mM CaCl₂ for 100 nM free Ca²⁺, 1.509 mM CaCl₂ for 300 nM free Ca²⁺, 1.823 mM CaCl₂ for 1 µM free Ca²⁺ and 1.940 mM CaCl₂ for 3 µM free Ca²⁺.

Chemicals were prepared as concentrated stock solutions in either distilled water or Me₂SO and diluted to the final concentration using standard extracellular solution or standard pipette solution as indicated in the text. AITC, carvacrol, icilin, and BAPTA were obtained from Sigma; ruthenium red (RR), U73122 [GenBank] , and calmidazolium (CMZ) were purchased from Calbiochem; CALP2 was obtained from Tocris bioscience; and cinnamaldehyde was from Henkel.

Electrophysiological Recordings—All recordings were performed with an EPC7 amplifier (List-Medical Electronic, Darmstadt, Germany). Data were acquired using Pulse software (HEKA, Lambrecht, Germany). Excised patches were sampled at 2 kHz and filtered at 1 kHz. Patch pipettes were pulled from borosilicate glass (GC150TF-10, Harvard Apparatus Ltd.) and fire polished to 3–5 M tip resistance using a horizontal pipette puller (Zeitz Instruments, Munich, Germany). Solution exchange was achieved by placing cells in front of a theta-capillary and moving manually from one side of the outlet to the other. Excised patches were placed in front of a microperfusion pipette and solution exchange was achieved by switching from one solution to another under computer control.

Data Analysis—Electrophysiological data were analyzed using the software Pulse (HEKA), IgorPro (Wavemetrics), SigmaPlot (SPSS Science), OriginPro (Origin Lab Corp.), TAC (Bruxton), and Microsoft Excel. Significance was tested using Student's independent t test (p < 0.05 is marked by an asterisk). The dose-response curve was fitted with a Hill equation of the form y = base + (max-base)/[1 + (x_half/x)ⁿ]. Data are presented as mean ± S.E.

Western Blotting—HEK293 cells were transfected with equal amounts of cDNA for wild-type TRPA1 and EF-hand mutants. Whole cell lysates were prepared 24 h after transfection, mixed with Laemmli buffer (30% glycerol, 3% SDS, 125 mM Tris-HCl, pH 6.8) and heated at 95 °C for 5 min. Equal amounts of protein were loaded and resolved by 8% SDS-PAGE and transferred to nitrocellulose membrane (Protran; Schleicher & Schuell). The nitrocellulose membranes were stained with Ponceau S (Sigma) and blocked with TBST (150 mM NaCl, 50 mM Tris-HCl, Tween 20, pH 7.4) containing 2% ECL Advance Blocking Agent (Amersham Biosciences). TRPA1 was detected using two reported antibodies directed either against the C terminus of mouse TRPA1 (1:500) or the N terminus of mouse TRPA1 (1:1000) (10, 15). The primary antibodies were diluted in 2% ECL Advance Blocking Agent in TBST. After washing and incubation with horseradish peroxidase-coupled secondary antibody, detection was performed with ECL Advance (Amersham Biosciences) on Hyperfilm ECL (Amersham Biosciences).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Icilin Requires Ca²⁺ for Its Agonist Efficacy—Ca²⁺ is known to modulate agonist-induced responses of various TRP channels (16–18). Voltage-clamp recordings from TRPA1-expressing Xenopus oocytes or HEK293 cells have shown that AITC-induced responses are potentiated by external Ca²⁺ ions (4, 10). We were interested to examine the effect of external Ca²⁺ ions on agonist efficacy of various TRPA1 agonists. Therefore, we performed whole-cell patch clamp recordings from HEK293 cells transiently transfected with cDNA of hTRPA1 and applied AITC, cinnamaldehyde, carvacrol, and icilin in the presence and absence of external Ca²⁺ ions at a holding potential of V_h =–60 mV (Fig. 1). As expected, AITC (25 µM) induced a slowly developing current in the absence of external Ca²⁺ ions. Addition of 2 mM CaCl₂ to the bath solution evoked a strong potentiation of the inward current (Fig. 1A). The same was true for cinnamaldehyde (500 µM) and carvacrol (500 µM). The currents developed slowly in the absence of external Ca²⁺ ions and were boosted when Ca²⁺ was replenished in the extracellular recording solution (Fig. 1, B and C).

View larger version (21K): [in this window] [in a new window]   FIGURE 1. Icilin requires Ca2+ for its agonist efficacy. A–C, 25 µM AITC (A, n = 7), 500 µM cinnamaldehyde (B, n = 10), and 500 µM carvacrol (C, n = 7) activated TRPA1 in the absence of external Ca2+ ions. Addition of Ca2+ to the bath solution potentiated the induced responses. D and E, icilin efficacy was greatly reduced or even absent in Ca2+-free recording solution. Replenishment of Ca2+ to the extracellular solution induced a recovery of icilin efficacy (100 µM, n = 6; 500 µM n = 2). F, icilin agonist efficacy shows a strong Ca2+ dependence. Icilin (100 µM) displayed little agonist efficacy in the absence of external Ca2+ ions (n = 7). Addition of BAPTA (5 mM) to the pipette significantly reduced the agonist efficacy of icilin (n = 12, p = 0.048) compared with standard conditions (n = 23). Increase of extracellular Ca2+ (5 mM) tends to result in larger current amplitudes (n = 6).

View larger version (14K): [in this window] [in a new window]   FIGURE 2. Ca2+ influx is sufficient to activate TRPA1. A, in the absence of agonist, TRPA1 overexpressing HEK293 cells developed inward currents in standard extracellular solution in 12 out of 15 recorded cells (n = 12/15, Vh =–60 mV). B, both the slowly developing initial current (inset) and the sharp increase in current were blocked by 1 µM RR (block initial current: n = 7/7, block later current: n = 6/6). C, spontaneous currents did not occur during a period of 8 min at Vh =+ 60 mV in standard extracellular solution (n = 4/4). Exposure to AITC (25 µM) evoked outward currents. D, increasing the extracellular Ca2+ concentration to 10 mM CaCl2 shortened the time to activation at Vh =–60 mV (n = 10/10). E, the current was absent in untransfected HEK293 cells (n = 4/4). Dashed line indicates zero current level.

These data let us suggest that Ca²⁺ serves as co-agonist with icilin by interacting directly with TRPA1, in a manner resembling the effect of Ca²⁺ on icilin efficacy at TRPM8 (16). Raising the extracellular Ca²⁺ concentration from 2 to 5 mM did not significantly increase icilin-induced currents (1815 ± 302 pA, Fig. 1F). To test for the hypothesis that intracellular Ca²⁺ is required for icilin efficacy, we added BAPTA (5 mM) to the pipette solution while recording in standard extracellular solution containing 2 mM CaCl₂. Interestingly, icilin-evoked currents were significantly reduced (863 ± 235 pA, p = 0.048) compared to control conditions with standard intracellular solution (1586 ± 222 pA), indicating a role of intracellular Ca²⁺ for icilin agonist efficacy (Fig. 1F).

Taken together, our results argue for a distinct mechanism of activation by icilin as compared with other TRPA1 agonists.

Ca²⁺ Influx Is Sufficient to Activate TRPA1—In light of the clear dependence of agonist activity on Ca²⁺, we asked whether Ca²⁺ itself is sufficient to activate TRPA1. Whole-cell voltage-clamp recordings in standard extracellular solution for extended periods of time revealed the activation of an inward current that developed after on average 331 ± 58 s in the absence of any agonist in 12 out of 15 recorded cells (Fig. 2A). The current first showed a slow activation kinetic, which was boosted when the initial current reached on average 26.3 ± 3.3% of the total current. Both the initial current and the sudden sharp increase in current were blocked by 1 µM RR, indicating that both components of the biphasic response are mediated through TRPA1 activation (Fig. 2B). Ca²⁺ may enter through spontaneously active TRPA1 channels, thereby triggering further channel opening until the intracellular Ca²⁺ concentration reaches a certain threshold level responsible for the sudden sharp increase in current.

To clarify whether the leak influx of extracellular Ca²⁺ activates TRPA1, we recorded under the same conditions at a positive holding potential of V_h =+60 mV. The driving force for Ca²⁺ is reduced at depolarized membrane potentials resulting in less Ca²⁺ entry. Therefore, we expected the biphasic response to be abolished or delayed at V_h =+60 mV. Indeed, no sudden sharp increase in current developed within the given time frame of 8 min in which currents developed at –60 mV (Fig. 2C). Application of AITC (10 s, 25 µM) elicited currents, confirming the expression of TRPA1 in the recorded cells. The hypothesis that Ca²⁺ leak influx activates TRPA1 is further supported by the finding that the biphasic current activation is induced faster when extracellular Ca²⁺ is increased to 10 mM (59 ± 6 s, Fig. 2D). Again, this current was completely blocked by 1 µM RR (data not shown) and was absent in untransfected HEK293 cells (Fig. 2E). Taken together, these results indicate that influx of extracellular Ca²⁺ into the cell is sufficient to activate TRPA1.

Increase in Intracellular Ca²⁺ Elicits TRPA1 Currents—To investigate the impact of intracellular Ca²⁺ on activation of TRPA1, we directly increased the intracellular Ca²⁺ concentration to 5 mM resulting in a free Ca²⁺ concentration of 23 µM. A prominent inward current developed almost instantaneously after establishing the whole-cell configuration in cells recorded either in standard extracellular solution (219 ± 38 pA) or Ca²⁺-free solution (214 ± 68 pA) (Fig. 3A and B, V_h =–60 mV). This current was blocked by 1–5 µM RR (Fig. 3A) and was absent or only exiguous in untransfected HEK293 cells (35 ± 10 pA, Fig. 3C), supporting the finding that intracellular Ca²⁺ triggers TRPA1 activation.

Next, we quantified the sensitivity of TRPA1 channels to intracellular Ca²⁺ concentrations ranging from 100 nM to 30 µM. We chose a holding potential of V_h = –80 mV to increase the driving force for Na⁺ ions, which should elicit larger inward currents. Ca²⁺ was added to an EGTA-buffered pipette solution to define various Ca²⁺ concentrations. The dose-response relationship was fitted with a Hill equation determining an EC₅₀ of 905 ± 249 nM and a Hill-Coefficient of 0.9 ± 0.2 (Fig. 3D).

Ca²⁺ Activates TRPA1 in Excised Inside-out Patches—In whole-cell recordings many receptors or ion channel proteins might be modulated by intracellular processes or factors like enzymatic activity or cytosolic signaling molecules. To reduce a possible influence of cytosolic factors that might control the behavior of channels, we examined the effect of Ca²⁺ on excised patches from transfected HEK293 cells in the insideout configuration. Interestingly, application of Ca²⁺ in nanomolar concentrations to the intracellular side of the membrane was sufficient to elicit TRPA1 single-channel currents with amplitudes of on average –9.5 pA at a membrane potential (V_m) of –80 mV resulting in a single-channel conductance of 119 ± 6.3 pS (Fig. 4, A and B). Application of higher Ca²⁺ concentrations (1–3 µM) led to activation of more channels or even induced macroscopic currents in some patches (Fig. 4A). Furthermore, we observed desensitization of Ca²⁺-induced currents (see Fig. 4A).

View larger version (27K): [in this window] [in a new window]   FIGURE 3. Increase in intracellular Ca2+ elicits TRPA1 currents. A and B, increasing the free intracellular Ca2+ concentration to 23 µM elicited inward currents in the presence (A) or absence (B) of external Ca2+ ions immediately after establishing the whole-cell configuration (indicated by the arrow; n = 19/22 (A), n = 7/9 (B)). The currents were blocked by 1–5 µM RR (n = 11/11). C, no or only exiguous currents were observed in untransfected HEK293 cells (n = 10/10). D, dose-response behavior of expressed TRPA1 to various Ca2+ concentrations. Data points indicate average maximal inward currents at Vh =–80 mV (n = 6 for each concentration). Dashed line indicates zero current level.

In untransfected control cells we observed an endogenous Ca²⁺-sensitive ion channel with a single-channel conductance of 40 pS at V_m =–80 mV, which interferes with the overexpressed TRPA1 in transfected cells (Fig. 4D). Further analysis of single-channel currents in transfected cells during voltage ramp-protocols showed that currents evoked by Ca²⁺ (3 µM) or AITC (25 µM) have identical reversal potentials and rectification properties arguing that Ca²⁺-activated currents are due to TRPA1 activation (Fig. 4E).

Ca²⁺ Activates TRPA1 in a PLC-independent Fashion—In light of the clear activation of TRPA1 by intracellular Ca²⁺ we asked whether Ca²⁺ directly gates TRPA1 or via a PLC-dependent signaling pathway. Since endogenous PLC activity remains preserved in inside-out patches (19) we stimulated inside-out patches with 3 µM Ca²⁺ after 30 s preincubation with the PLC-inhibitor U73122 [GenBank] (10 µM). Ca²⁺ was still able to induce TRPA1-mediated currents (Fig. 4F), indicating that Ca²⁺ may directly gate TRPA1 probably by binding to a high affinity Ca²⁺-binding site at the channels cytosolic side.

TRPA1 Exhibits a Putative EF-hand CBD—While screening for Ca²⁺-binding domains, we identified a putative EF-hand motif at the N terminus of TRPA1 (Asp-468-Leu-480). To test for the hypothesis that Ca²⁺ activates TRPA1 by binding through the EF-hand CBD, we used a 12-mer Ca²⁺ like peptide, CALP2, known to function as antagonist at the EF-hands of calmodulin and troponin C (20, 21). We examined the effect of CALP2 on Ca²⁺-induced TRPA1 single-channel currents in excised inside-out patches at V_m =–80 mV. Interestingly, Ca²⁺-induced (1 µM) activity was strongly reduced in the presence of CALP2 (50 µM). The open probability decreased by 90%, whereas the single-channel amplitude was unaffected (8.3 ± 0.5 pA before CALP2; 7.7 ± 1.7 pA during CALP2) (Fig. 5A). The inhibitory effect of CALP2 was reversed by removal of the peptide and channel activity reverted back to the prior level (Fig. 5A). To exclude that CALP2 blocks the channel pore, we evaluated the effect of CALP2 on AITC-induced currents (Fig. 5B). Co-application of CALP2 (50 µM) had no influence on AITC-induced (25 µM) open probability nor on single-channel currents (13.1 ± 4.3 pA before CALP2; 14.5 ± 2.8 pA during CALP2). It should be noted that AITC-induced current amplitudes varied extremely (Fig. 5B) and reached on average larger amplitudes as compared with Ca²⁺-induced currents (Fig. 5A).

View larger version (33K): [in this window] [in a new window]   FIGURE 4. Ca2+ activates TRPA1 in excised inside-out patches. A, application of Ca2+ to the intracellular side of the membrane patch directly activated single-channel or macroscopic TRPA1 currents (Vm =–80 mV). Channel events are shown for application of 300 nM, 1 and 3 µM Ca2+ to the same patch. TRPA1 activity decreased in the presence of Ca2+. B, amplitude distribution of single-channel openings for TRPA1 (amplitude –9.5 pA). A time frame of 5 s is shown on top (C = closed, O = open). C, the percentage of responding patches increased in a dose-dependent manner (n = 10 for each concentration). D, untransfected HEK293 cells express Ca2+-sensitive channels (Vm =–80 mV) (n = 8). E, voltage dependence of Ca2+-activated (left) or AITC-activated (right) single-channel currents. A voltage ramp (slope 12.5 ms/mV, duration 2000 ms) was applied in the absence and the presence of each agonist. The zero-current level was subtracted in both the average traces and exemplary traces (inset). The average traces indicate that the current-voltage relationship of 3 µM Ca2+-evoked single-channel currents (n = 6) is similar to that evoked by 25 µM AITC (n = 4). F, preincubation of the patch with 10 µM U73122 did not prevent Ca2+-induced activation of TRPA1 (n = 4). Here, a macroscopic TRPA1-mediated current was induced. Dashed line indicates zero current level.

A Single Mutation within the EF-hand CBD Impairs Ca²⁺ Sensitivity—Based on the effect of CALP2 on Ca²⁺-induced single-channel currents, we were interested to see whether sensitivity of TRPA1 to Ca²⁺ could be limited to a single residue within the EF-hand CBD. The EF-hand motif of TRPA1 appears to be highly conserved within different species (Fig. 6A). To identify the site(s) responsible for Ca²⁺ binding, we performed alanine scanning mutagenesis for the residues proposed to be involved in Ca²⁺ binding (Fig. 6B) (12). The resulting mutants (D468A, S470A, T472A, L474A, N476A, and D479A) were expressed in HEK293 cells and expression was first confirmed by Western blot analysis (Fig. 6C). Mouse TRPA1 antibodies recognized an expected band of 128 kDa for wild-type TRPA1 and EF-hand mutants, indicating effective expression of all mutants. It should be noted that although the antibodies only recognized one band for the mutant T472A, this was of lower molecular weight than predicted. No band was detected in the whole cell extract from untransfected cells (Fig. 6C).

View larger version (34K): [in this window] [in a new window]   FIGURE 5. TRPA1 exhibits a putative EF-hand CBD. A, CALP2 (50 µM) strongly reduced Ca2+-induced (1 µM) TRPA1 channel activity (n = 12, Vm =–80 mV). The inhibitory effect was reversed by removal of the peptide. Amplitude histograms from the inside-out patch shown above indicate that single-channel current amplitudes are unaltered in the presence of CALP2 (8.3 ± 0.5 pA before CALP2; 7.7 ± 1.7 pA during CALP2), whereas the open probability is decreased by 90%. B, CALP2 (50 µM) did not affect AITC-induced (25 µM) open probability and single-channel amplitudes (n = 8; 13.1 ± 4.3 pA before CALP2; 14.5 ± 2.8 pA during CALP2). The inset shows the same plot with extended y scaling. C, preincubation (20 s) with 10 µM CMZ did not alter Ca2+-induced (1 µM) activity of TRPA1 (n = 6). The amplitude histogram shows that single-channel currents retain unaltered amplitudes (8.9 ± 3 pA) as compared with currents elicited in the absence of CMZ. Dashed line indicates zero current level.

To examine the Ca²⁺ sensitivity of the EF-hand mutants D468A, S470A, and L474A, we compared mean current amplitudes elicited with a saturating Ca²⁺ concentration (10 µM, see Fig. 3D) in the pipette solution while recording in Ca²⁺-free extracellular solution at V_h =–80 mV.

A prominent inward current with on average 999 ± 140 pA developed almost instantaneously after establishing the whole-cell configuration in cells expressing wild-type TRPA1 (Fig. 6, F and J). Mutations at positions Asp-468 and Ser-470 were found to retain Ca²⁺ sensitivity analogue to wild-type TRPA1 (Fig. 6, G and H). Currents reached on average 1057 ± 130 pA (D468A) and 1259 ± 186 pA (S470A) (Fig. 6J). Interestingly, substitution of leucine in position 474 with alanine resulted in an almost Ca²⁺-insensitive channel (69 ± 23 pA), indicating that the leucine in position 474 is likely to be involved in Ca²⁺-dependent activation (Fig. 6, I and J). The expression of the L474A mutant was confirmed by application of AITC (25 µM, 40 s) and recording of strong inward currents (Fig. 6I).

Taken together, these results highlight the importance of a single residue within the EF-hand CBD in mediating sensitivity of TRPA1 to Ca²⁺.

Agonist Activity Is Diminished in Cells Expressing the L474A Mutant—In the first section we showed that Ca²⁺ potentiates agonist induced responses in TRPA1 expressing cells. In light of the finding that a single mutation of the residue Leu-474 results in a Ca²⁺-insensitive channel, we next verified the sensitivity of this mutant to AITC in the presence and absence of extracellular Ca²⁺. In Ca²⁺-free solution currents elicited by AITC (25 µM) were about the same for wild-type TRPA1 and the L474A mutant (Fig. 7, A–C, wild-type 1856 ± 345 pA, L474A 1928 ± 479 pA). As expected, addition of 2 mM CaCl₂ to the bath solution resulted in a strong potentiation of the wild-type response (Fig. 7, A and C, 3066 ± 430 pA). Interestingly, the L474A mutant showed no potentiation of AITC-induced responses by Ca²⁺ (Fig. 7B). Addition of 2 mM CaCl₂ to the bath solution resulted in a reduction of current amplitudes (Fig. 7, B and C, 1423 ± 281 pA), presumably reflecting the reported transition of the channel to a state with lower conductance (10).

View larger version (36K): [in this window] [in a new window]   FIGURE 6. A single mutation in the EF-hand CBD impairs Ca2+ sensitivity. A, sequence alignment of the EF-hand CBD of TRPA1. The motif is highly conserved. The six residues presumably involved in Ca2+ binding are indicated by gray shading. B, display of the various EF-hand mutants. Mutated residues are characterized with gray shading. C, expression of wild-type TRPA1 and EF-hand mutants was assessed by Western blotting after transient transfection of each clone into HEK293 cells. Mouse TRPA1 antibodies recognized an expected band of 128 kDa. The molecular weight of the T472A mutant was lower than predicted. No band was detected in the whole-cell extract of untransfected control cells (untransf.). D, whole-cell recordings in HEK293 cells overexpressing: wild-type (trace a), mutant D468A (trace b), mutant S470A (trace c), mutant T472A (trace d), mutant L474A (trace e), mutant N476A (trace f), and mutant D479A (trace g). Current-voltage relationship of representative cells obtained after 10 s (traces a–c and e) or 60 s (traces d, f, and g) application of AITC (25 µM), respectively. Zero current was subtracted for each trace. E, average inward and outward currents carried by wild-type TRPA1 or EF-hand mutants D468A, S470A, and L474A at –80 and +80 mV (n = 5–7). F, whole-cell recording in Ca2+-free solution at Vh =–80 mV from a representative cell overexpressing wild-type TRPA1 perfused with a solution in which Ca2+ was buffered to 10 µM. The current was blocked by 1 µM RR. The arrow indicates the time of break-in. G and H, same as in F but showing a representative cell overexpressing the D468A mutant (G) or the S470A mutant (H). I, same as in F but showing a representative cell overexpressing the L474A mutant. 10 µM Ca2+ failed to induce a current. For control purposes 25 µM AITC (40 s) was applied. J, average inward currents evoked by 10 µM Ca2+ at Vh =–80 mV carried by wild-type TRPA1 (n = 12), mutant D468A (n = 9), mutant S470A (n = 10), and mutant L474A (n = 11). The L474A mutant showed significantly reduced responses to 10 µM Ca2+. Dashed line indicates zero current level.

Taken together, the results indicate that the residue in position Leu-474 participates in Ca²⁺-mediated potentiation of agonist (AITC)-induced responses and also contributes to icilin agonist efficacy on TRPA1.

View larger version (21K): [in this window] [in a new window]   FIGURE 7. Agonist activity is diminished in cells expressing the L474A mutant. A, whole-cell recording from a representative cell overexpressing wild-type TRPA1. AITC-induced (25 µM) currents are potentiated upon addition of CaCl2 (2 mM)(n = 9, Vh =–60 mV). B, same as in A but from a representative cell overexpressing the L474A mutant. AITC-induced (25 µM) currents are no longer potentiated by CaCl2 (n = 8). C, average of maximal current amplitudes elicited by AITC (25 µM) in the absence and presence of external Ca2+ ions. Compared with the wild-type channel the L474A mutant showed similar activation by AITC in Ca2+-free solution, whereas a reduction in the response was apparent in presence of CaCl2. D, whole-cell recording in standard extracellular solution containing 2 mM CaCl2 from a representative cell overexpressing the L474A mutant (Vh =–60 mV). Substitution of the leucine in position 474 with an alanine resulted in an icilin (100 µM)-insensitive channel exhibiting wild-type responses to AITC (25 µM)(n = 7). E, same as in D but from a representative cell overexpressing the S470A mutant. Analogue to the wild-type, the S470A mutant retained sensitivity to icilin (n = 5). F, average inward currents evoked by 100 µM icilin for wild-type TRPA1 in standard extracellular solution containing 2 mM CaCl2 (n = 7) or Ca2+-free solution (n = 7), for mutant L474A (n = 7) in standard extracellular solution, for mutant D468A (n = 5) in standard extracellular solution, and for mutant S470A (n = 5) in standard extracellular solution. Icilin-evoked responses are significantly reduced in cells overexpressing the L474A mutant.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Several TRP channels are reported to be regulated or modulated by Ca²⁺. For example, gating of TRPV4 depends on both extra- and intracellular Ca²⁺ (18), and TRPM2 activation requires Ca²⁺ (24). Here, we show that agonist efficacy of some TRPA1 agonists is modulated by Ca²⁺. As reported for AITC (4, 10), we found that cinnamaldehyde and carvacrol responses are potentiated by Ca²⁺, suggesting a common mechanism for these agonists. In contrast, we observed icilin to require Ca²⁺ for its agonist efficacy, arguing for a distinct mechanism of activation. Whereas concomitant exposure of AITC and Ca²⁺ displays synergy, the necessity of simultaneous exposure of icilin and Ca²⁺ points toward a mechanism of co-dependence. Our data obtained by mutagenesis support the hypothesis for distinct mechanisms of activation by AITC and icilin. We describe a single residue within the N-terminal EF-hand CBD to participate in Ca²⁺-mediated modulation of agonist-induced responses. Ca²⁺ binding to leucine in position 474 appears to be involved in potentiation of AITC-induced responses and seems to play a major role for icilin agonist efficacy on TRPA1. The ineffectiveness of icilin on the Ca²⁺-insensitive L474A mutant argues for a more complex mechanism in icilin-dependent activation of TRPA1 different from that previously reported for TRPM8 (16). Possibly Ca²⁺ primarily induces activation of TRPA1 and icilin acts modulatory on the Ca²⁺-induced responses. Since icilin activates TRPA1 currents with variable delay of onset in the presence of Ca²⁺ (data not shown) resembling the activation kinetics of Ca²⁺-influx induced currents (see Fig. 2), an appropriate scenario is conceivable. However, it remains to be determined whether icilin modulates the response thereby facilitating Ca²⁺-mediated activation of the channel rather than directly provoking TRPA1 channel opening.

Activation of TRP channels by Ca²⁺ ions has been reported previously for the monovalent-selective channels TRPM4 and TRPM5 (25, 26). Although a prior study suggested that TRPA1 can be activated by store depletion (4), the finding is still disputed as a second study failed to reproduce activation of TRPA1 by store depletion (7). Other studies showed that TRPA1 currents can be activated downstream of G protein-coupled receptors (4, 7), arguing for a role of second messengers in TRPA1 activation. Importantly, neither previous study tested whether Ca²⁺ directly activates TRPA1 channel.

Evidence for Ca²⁺-dependent activation of TRPA1 is obtained from our excised-patch and whole-cell recordings. The data show that Ca²⁺ influx through spontaneously active TRPA1 channels is sufficient to initiate further channel opening. Intracellular Ca²⁺ activates the channel with an apparent EC₅₀ of 905 nM in whole-cell recordings. The exposure of excised inside-out patches to Ca²⁺ elicits TRPA1 single-channel currents and the number of Ca²⁺-activated channels increased with higher Ca²⁺ concentrations.

In general, Ca²⁺ can bind and activate proteins either by itself or by binding through adaptor proteins. A direct interaction of TRPA1 with Ca²⁺ was analyzed using pharmacological approaches and site-directed mutagenesis. Our data suggest that Ca²⁺ activates TRPA1 in a PLC- and calmodulin-independent fashion. CALP2 effectively reduces Ca²⁺-induced channel activity and a mutation of a single residue within the N-terminal EF-hand CBD induces loss of Ca²⁺-dependent activation, favoring the N-terminal EF-hand domain as a putative Ca²⁺-binding site.

Within the EF-hand motif six residues are described to be involved in binding of the Ca²⁺ ion (12). Accordingly, we introduced point mutations at these sites and screened the channel mutants by examining their functionality and Ca²⁺ sensitivity. Of the six potentially involved residues, we observed that a single mutation at position Leu-474 altered Ca²⁺ sensitivity of TRPA1. We find that Ca²⁺-dependent activation is strongly impaired for the L474A mutant, assuming that the leucine contributes to Ca²⁺ sensitivity of TRPA1. The D468A and S470A mutants remain functional and exhibit wild-type responses to a saturating Ca²⁺ concentration, suggesting that mutations at these sites may be accommodated without affecting Ca²⁺ activation. Reports describe a considerable variability in length and amino acid sequence of the N-terminal part of the Ca²⁺-binding loop in EF-hand proteins (27). In natural EF-hand loops the planar position 3 is one of the most variable positions. Depending on the type of mutation the effect can vary over a wide range from nearly no effect up to virtually preventing Ca²⁺ binding (28). The residue in the last coordinating position is reported to be required for the pentagonal bipyramidal coordination geometry and provides commonly two oxygen atoms for liganding Ca²⁺ (27). Point mutations at this site are postulated to decrease the Ca²⁺ binding affinity of EF-hand proteins (29). Whether the same is true for TRPA1 is not clear, as the D479A mutant displayed no activity upon application of AITC or cinnamaldehyde. Similar findings are observed for the T472A and N476A mutants. Whether this site(s) is essential to the basic opening and closing of the channel pore or whether the level of expressed protein at the membrane is to low to elicit any reliable currents remains an open question.

Although our experiments identify the residue Leu-474 within the EF-hand motif as involved in Ca²⁺-dependent activation of TRPA1 and although CALP2 reduces Ca²⁺-induced channel activity, further analysis comprising Ca²⁺ binding studies are needed to determine the N-terminal EF-hand CBD as Ca²⁺-binding site in TRPA1.

In any event, the observation that Ca²⁺ modulates agonist-induced responses and directly activates TRPA1 channels with high sensitivity has important functional consequences for the physiology and pathophysiology of TRPA1 expressing cells. TRPA1 has recently been shown to mediate the inflammatory actions of proalgesic agents (9) that commonly act via stimulation of G protein-coupled receptors linked to a PLC. The resulting increase in intracellular Ca²⁺ would be sufficient to activate TRPA1 currents. In general, all processes that lead to an increase in intracellular Ca²⁺ might directly stimulate TRPA1 or alternatively sensitize the channel and amplify agonist provoked responses. Environmental irritants that directly stimulate either TRPA1 or other Ca²⁺-permeable ion channels will increase intracellular Ca²⁺ levels, which in turn would enhance TRPA1 activity. Since TRPA1 co-expresses with the Ca²⁺-permeable channel TRPV1 in native tissues (2, 4), a modulation of TRPA1 activity downstream of TRPV1 activation is likely. Stimulation of TRPV1 along with the accompanying Ca²⁺-influx could affect TRPA1 activity thereby modulating the initial excitatory response. Since TRPA1 conducts Ca²⁺ ions with P_Ca/P_Na = 0.84 (2), activation and modulation by Ca²⁺ represents a regenerating and self-amplifying positive feedback loop that augments the initial Ca²⁺ and voltage signal. This positive feedback mechanism requires tight control to avoid danger of cellular Ca²⁺ overload. As for other receptors, the activity of TRPA1 is likely to be controlled by a Ca²⁺-dependent negative feedback mechanism (17). The excessive Ca²⁺ influx is supposably shut down by a Ca²⁺-dependent desensitization process (10) that minimizes the Ca²⁺ conductivity of TRPA1 in a self-limiting process.

	FOOTNOTES

 
^* This work was supported by the Max-Planck Research School in Chemical Biology (IMPRS-CB). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ To whom correspondence should be addressed. Tel.: 49-234-322-4597; Fax: 49-234-321-4129; E-mail: Christian.Wetzel{at}rub.de.

² The abbreviations used are: TRPA1, transient receptor potential channel A1; AITC, allyl isothiocyanate; PLC, phospholipase C; EF-hand CBD, EF-hand calcium-binding domain; HEK293, human embryonic kidney 293 cells; BAPTA, 1,2-bis(o-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid; RR, ruthenium red; CMZ, calmidazolium.

	ACKNOWLEDGMENTS

 
We are grateful to D. P. Corey and J. Garcia-Anoveros for providing mouse TRPA1 antibodies. We thank D. E. Clapham and I. S. Ramsey for comments on the manuscript and helpful suggestions. We are also grateful to E. M. Neuhaus, N. Damann, and J. Spehr for discussions and J. Gerkrath, F. Salami, A. Stoeck, H. Bartel, and W. Grabowski for technical assistance.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Clapham, D. E. (2003) Nature 426, 517–524[CrossRef][Medline] [Order article via Infotrieve]
2. Story, G. M., Peier, A. M., Reeve, A. J., Eid, S. R., Mosbacher, J., Hricik, T. R., Earley, T. J., Hergarden, A. C., Andersson, D. A., Hwang, S. W., McIntyre, P., Jegla, T., Bevan, S., and Patapoutian, A. (2003) Cell 112, 819–829[CrossRef][Medline] [Order article via Infotrieve]
3. Ramsey, I. S., Delling, M., and Clapham, D. E. (2006) Annu. Rev. Physiol. 68, 619–647[CrossRef][Medline] [Order article via Infotrieve]
4. Jordt, S. E., Bautista, D. M., Chuang, H. H., McKemy, D. D., Zygmunt, P. M., Hogestatt, E. D., Meng, I. D., and Julius, D. (2004) Nature 427, 260–265[CrossRef][Medline] [Order article via Infotrieve]
5. Macpherson, L. J., Geierstanger, B. H., Viswanath, V., Bandell, M., Eid, S. R., Hwang, S., and Patapoutian, A. (2005) Curr. Biol. 15, 929–934[CrossRef][Medline] [Order article via Infotrieve]
6. Bautista, D. M., Movahed, P., Hinman, A., Axelsson, H. E., Sterner, O., Hogestatt, E. D., Julius, D., Jordt, S. E., and Zygmunt, P. M. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 12248–12252[Abstract/Free Full Text]
7. Bandell, M., Story, G. M., Hwang, S. W., Viswanath, V., Eid, S. R., Petrus, M. J., Earley, T. J., and Patapoutian, A. (2004) Neuron 41, 849–857[CrossRef][Medline] [Order article via Infotrieve]
8. Kwan, K. Y., Allchorne, A. J., Vollrath, M. A., Christensen, A. P., Zhang, D. S., Woolf, C. J., and Corey, D. P. (2006) Neuron 50, 277–289[CrossRef][Medline] [Order article via Infotrieve]
9. Bautista, D. M., Jordt, S. E., Nikai, T., Tsuruda, P. R., Read, A. J., Poblete, J., Yamoah, E. N., Basbaum, A. I., and Julius, D. (2006) Cell 124, 1269–1282[CrossRef][Medline] [Order article via Infotrieve]
10. Nagata, K., Duggan, A., Kumar, G., and Garcia-Anoveros, J. (2005) J. Neurosci. 25, 4052–4061[Abstract/Free Full Text]
11. Hinman, A., Chuang, H. H., Bautista, D. M., and Julius, D. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 19564–19568[Abstract/Free Full Text]
12. Lewit-Bentley, A., and Rety, S. (2000) Curr. Opin. Struct. Biol. 10, 637–643[CrossRef][Medline] [Order article via Infotrieve]
13. Zufall, F., Hatt, H., and Firestein, S. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 9335–9339[Abstract/Free Full Text]
14. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Gene (Amst.) 77, 51–59[CrossRef][Medline] [Order article via Infotrieve]
15. Corey, D. P., Garcia-Anoveros, J., Holt, J. R., Kwan, K. Y., Lin, S. Y., Vollrath, M. A., Amalfitano, A., Cheung, E. L., Derfler, B. H., Duggan, A., Geleoc, G. S., Gray, P. A., Hoffman, M. P., Rehm, H. L., Tamasauskas, D., and Zhang, D. S. (2004) Nature 432, 723–730[CrossRef][Medline] [Order article via Infotrieve]
16. Chuang, H. H., Neuhausser, W. M., and Julius, D. (2004) Neuron 43, 859–869[CrossRef][Medline] [Order article via Infotrieve]
17. Strotmann, R., Schultz, G., and Plant, T. D. (2003) J. Biol. Chem. 278, 26541–26549[Abstract/Free Full Text]
18. Watanabe, H., Vriens, J., Janssens, A., Wondergem, R., Droogmans, G., and Nilius, B. (2003) Cell Calcium 33, 489–495[CrossRef][Medline] [Order article via Infotrieve]
19. Nilius, B., Mahieu, F., Prenen, J., Janssens, A., Owsianik, G., Vennekens, R., and Voets, T. (2006) EMBO J. 25, 467–478[CrossRef][Medline] [Order article via Infotrieve]
20. Villain, M., Jackson, P. L., Manion, M. K., Dong, W. J., Su, Z., Fassina, G., Johnson, T. M., Sakai, T. T., Krishna, N. R., and Blalock, J. E. (2000) J. Biol. Chem. 275, 2676–2685[Abstract/Free Full Text]
21. Houtman, R., Ten, B. R., Blalock, J. E., Villain, M., Koster, A. S., and Nijkamp, F. P. (2001) J. Immunol. 166, 861–867[Abstract/Free Full Text]
22. Zhang, Z., Tang, J., Tikunova, S., Johnson, J. D., Chen, Z., Qin, N., Dietrich, A., Stefani, E., Birnbaumer, L., and Zhu, M. X. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 3168–3173[Abstract/Free Full Text]
23. Lupinsky, D. A., and Magoski, N. S. (2006) J. Physiol. (Lond.) 575, 491–506[Abstract/Free Full Text]
24. McHugh, D., Flemming, R., Xu, S. Z., Perraud, A. L., and Beech, D. J. (2003) J. Biol. Chem. 278, 11002–11006[Abstract/Free Full Text]
25. Launay, P., Fleig, A., Perraud, A. L., Scharenberg, A. M., Penner, R., and Kinet, J. P. (2002) Cell 109, 397–407[CrossRef][Medline] [Order article via Infotrieve]
26. Hofmann, T., Chubanov, V., Gudermann, T., and Montell, C. (2003) Curr. Biol. 13, 1153–1158[CrossRef][Medline] [Order article via Infotrieve]
27. Grabarek, Z. (2006) J. Mol. Biol. 359, 509–525[CrossRef][Medline] [Order article via Infotrieve]
28. Drake, S. K., Zimmer, M. A., Kundrot, C., and Falke, J. J. (1997) J. Gen. Physiol 110, 173–184[Abstract/Free Full Text]
29. Linse, S., and Forsen, S. (1995) Adv. Second Messenger Phosphoprotein Res. 30, 89–151[Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				O. Fajardo, V. Meseguer, C. Belmonte, and F. Viana TRPA1 Channels Mediate Cold Temperature Sensing in Mammalian Vagal Sensory Neurons: Pharmacological and Genetic Evidence J. Neurosci., July 30, 2008; 28(31): 7863 - 7875. [Abstract] [Full Text] [PDF]

				D. Kim, E. J. Cavanaugh, and D. Simkin Inhibition of transient receptor potential A1 channel by phosphatidylinositol-4,5-bisphosphate Am J Physiol Cell Physiol, July 1, 2008; 295(1): C92 - C99. [Abstract] [Full Text] [PDF]

				L. De Petrocellis, V. Vellani, A. Schiano-Moriello, P. Marini, P. C. Magherini, P. Orlando, and V. Di Marzo Plant-Derived Cannabinoids Modulate the Activity of Transient Receptor Potential Channels of Ankyrin Type-1 and Melastatin Type-8 J. Pharmacol. Exp. Ther., June 1, 2008; 325(3): 1007 - 1015. [Abstract] [Full Text] [PDF]

				M. Maher, H. Ao, T. Banke, N. Nasser, N.-T. Wu, J. G. Breitenbucher, S. R. Chaplan, and A. D. Wickenden Activation of TRPA1 by Farnesyl Thiosalicylic Acid Mol. Pharmacol., April 1, 2008; 73(4): 1225 - 1234. [Abstract] [Full Text] [PDF]

				C. Nassenstein, K. Kwong, T. Taylor-Clark, M. Kollarik, D. M. MacGlashan, A. Braun, and B. J. Undem Expression and function of the ion channel TRPA1 in vagal afferent nerves innervating mouse lungs J. Physiol., March 15, 2008; 586(6): 1595 - 1604. [Abstract] [Full Text] [PDF]

D. A. Andersson, C. Gentry, S. Moss, and S. Bevan Transient Receptor Potential A1 Is a Sensory Receptor for Multiple Products of Oxidative Stress J. Neurosci., March 5,&nbs