JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M606772200 on November 13, 2006

J. Biol. Chem., Vol. 282, Issue 2, 1098-1108, January 12, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/2/1098    most recent
M606772200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nossal, N. G.
Right arrow Articles by Griffith, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nossal, N. G.
Right arrow Articles by Griffith, J. D.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Architecture of the Bacteriophage T4 Replication Complex Revealed with Nanoscale Biopointers*

Nancy G. Nossal{ddagger}, Alexander M. Makhov§, Paul D. Chastain, II§, Charles E. Jones{ddagger}, and Jack D. Griffith§1

From the {ddagger}Laboratory of Molecular and Cellular Biology, NIDDK, National Institutes of Health, Bethesda, Maryland 20892-0830 and the §Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-7295

Received for publication, July 17, 2006 , and in revised form, November 13, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Our previous electron microscopy of DNA replicated by the bacteriophage T4 proteins showed a single complex at the fork, thought to contain the leading and lagging strand proteins, as well as the protein-covered single-stranded DNA on the lagging strand folded into a compact structure. "Trombone" loops formed from nascent lagging strand fragments were present on a majority of the replicating molecules (Chastain, P., Makhov, A. M., Nossal, N. G., and Griffith, J. D. (2003) J. Biol. Chem. 278, 21276–21285). Here we probe the composition of this replication complex using nanoscale DNA biopointers to show the location of biotin-tagged replication proteins. We find that a large fraction of the molecules with a trombone loop had two pointers to polymerase, providing strong evidence that the leading and lagging strand polymerases are together in the replication complex. 6% of the molecules had two loops, and 31% of these had three pointers to biotin-tagged polymerase, suggesting that the two loops result from two fragments that are being extended simultaneously. Under fixation conditions that extend the lagging strand, occasional molecules show two nascent lagging strand fragments, each being elongated by a biotin-tagged polymerase. T4 41 helicase is present in the complex on a large fraction of actively replicating molecules but on a smaller fraction of molecules with a stalled polymerase. Unexpectedly, we found that 59 helicase-loading protein remains on the fork after loading the helicase and is present on molecules with extensive replication.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
DNA replication is catalyzed by complexes of replication proteins that work together to catalyze the continuous synthesis of the new leading strand and the priming, discontinuous synthesis, and joining of short fragments on the new lagging strand. The coordinated interaction of these replication proteins with each other, and with DNA, is responsible for the accurate and timely duplication of the genome. Because the two strands of the duplex have opposite polarity, the leading and lagging strand polymerases move in opposite directions relative to the fork. Bruce Alberts (1) proposed that leading and lagging strand synthesis could be coordinated if the nascent lagging strand fragment and the single-stranded DNA behind it were folded into what has been called a "trombone loop" to bring the two polymerases together (see Fig. 1).

Our previous electron microscopic studies of the bacteriophage T4 replication complex confirmed this trombone model (2). We found a single complex of the leading and lagging strand proteins at the fork, with a single loop present on 43% of the molecules. Another 43% of the molecules did not have a loop, as expected for molecules stopped at the stage when the previous fragment has finished, but the next fragment had not started. Unexpectedly, and not anticipated by the Alberts model, 8% of the molecules had two loops near the fork, and 5% contained more than two, consistent with molecules in which a new lagging strand fragment has been initiated before the previous fragment was completed. In contrast to the original model (see Fig. 1A), the DNA in the loops was completely double-stranded, with no visible extended single-stranded DNA. Instead, the protein-covered single-stranded DNA segments on the lagging strand were folded into highly compact structures ("bobbins"), which constitute the major portion of the mass of the replication complex (Fig. 1B). This compact structure forms as a result of lagging strand synthesis. It was not observed in the absence of primase. Similar compact structures were found on molecules replicated with phage T7 proteins (3-5). Although the size of the complex at the fork was large enough to contain all the proteins needed for leading and lagging strand synthesis, as well as ~800 b2 of protein-covered single-stranded DNA, the proteins actually present in these complexes could not be determined by this technique.

The T4 replication proteins provide an attractive model system for determining the architecture of the replication fork and the mechanisms responsible for controlling and coordinating DNA synthesis on the two strands. This relatively simple multienzyme replication system composed of highly purified bacteriophage T4-encoded proteins is organized into the same functional enzyme groups as those in more complex eukaryotic replication systems (reviewed in Refs. 6 and 7). T4 DNA polymerase, which catalyzes DNA synthesis on both leading and lagging strands, is attached to a sliding clamp protein (gene 45), loaded by the complex of the gene 44 and 62 proteins (Fig. 1) (8, 9). Gene 41 helicase moves 5' to 3' on the lagging strand template (10), opening the duplex ahead of the leading strand polymerase and interacting with the primase to allow it to make the RNA primers that initiate lagging strand synthesis (11-14). Although the helicase can load on nicked and forked DNA by itself, its loading is greatly accelerated by the 59 helicase-loading protein (15-19). There is recent evidence that 59 helicase loader, a fork-binding protein, plays a role in coordinating leading and lagging strand synthesis by blocking leading strand synthesis in the absence of helicase or 32 protein (20-24). The RNA primers and adjacent DNA are ultimately removed by a T4 encoded 5' to 3' nuclease (T4 RNase H), and the adjacent fragments joined by T4 DNA ligase (25-27). T4 gene 32 single-stranded DNA-binding protein coats the single-stranded DNA on the lagging strand (28) and binds and modulates the activities of the polymerase, primase, helicase loader, and RNase H.


Figure 1
View larger version (33K):
[in this window]
[in a new window]

  		FIGURE 1.
Diagram of bacteriophage T4 proteins and DNA at the replication fork. A, the loop at the fork is formed from 32 protein-covered single-stranded DNA and duplex DNA with the nascent lagging strand fragment, as suggested by the original trombone model (1). B, the loop is duplex DNA. The protein-covered single-stranded DNA on the lagging strand is folded into a compact structure, as shown by electron microscopy (2).

 
We have now further developed a powerful technique first applied to yeast Orc complexes (29) to use DNA "pointers" to biotin-tagged replication proteins to determine which proteins are present in the replication complexes visualized by electron microscopy at different stages of replication. We show that many of the protein complexes at the fork contain two polymer-ases, as expected if the leading and lagging strand polymerases are coordinated. Under fixation conditions that extend the lagging strand, occasional molecules show two nascent lagging strand fragments, each being elongated by a biotin-tagged polymerase, consistent with our previous finding of molecules with more than one lagging strand loop (2). We find that the 59 helicase-loading protein remains on the fork after loading the helicase and is present on molecules with extensive replication. Biotin-tagged helicase is present on a large fraction of actively replicating molecules but on a smaller fraction of molecules with a stalled polymerase.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cloning and Expression of Biotin-tagged T4 Replication Proteins—A 16-residue peptide (SGLNDIFEAQKIEWHE) that is biotinylated on the lysine in vivo by the Escherichia coli biotin ligase (BirA) enzyme (30), followed by a Gly4 or a Pro4Gly linker, was inserted after the N-terminal methionine of T4 gene 41 helicase (p41Nbiogly and p41Nbiopro), and T4 gene 59 heli-case-loading protein (p59Nbiogly). This was accomplished by inserting the following oligonucleotides into the NdeI site at the beginning of these genes in T7 expression plasmids as follows: Glytop, 5'-tatgtccggtctgaacgacatcttcgaagctcagaaaatcgaatggcacgaaggtggtggtgg; Glybot, 3'-acaggccagacttgctgtagaagcttcgagtcttttagcttaccgtgcttccaccaccaccat; Protop, 5'-tatgtccggtctgaacgacatcttcgaagctcagaaaatcgaatggcacgaaccgccgccgccggg; and Probot, 3'-acaggccagacttgctgtagaagcttcgagtcttttagcttaccgtgcttggcggcggcggcccat.

For T4 41 helicase, an NdeI site was added to pNN4101 (31) by removing the small BsaXI fragment and replacing it with oligonucleotides that changed the agtgtg at the beginning of gene 41 to the NdeI sequence catatg. The internal NdeI site in the gene 59 expression plasmid pNN2859 (18) was removed by site-directed mutagenesis. Because the N terminus of the gene 59 helicase-loading protein is in a beta sheet in the crystal structure (32), we also made 59 protein with its biotin tag at the C terminus by adding oligonucleotides encoding the Gly4 linker followed by SGLNDIFEAQKIEWHE at the end of gene 59 in pNN2859 (p59Cbiogly).

To introduce the same sequences at the N terminus of T4 DNA polymerase, a BsgI site was first introduced just after the BamHI site in pPST4pol (33), by amplifying the region between the BamHI and XhoI sites using the primers 5'-GCAGGATCCGTGCAGACTAAGGAATATCTATG (43 PCR TOP) and 5'-CGCTTCATCCAATCTCGAGCATCTTTCATTG (43 PCR BOT). The BamHI to XhoI region of the PCR fragment was then used to replace the same region in pPST4pol (pRB405). Finally the BsgI to PstI fragment of pRB405, the Pst to NdeI fragment of the T7 expression vector pVex11, and oligonucleotides encoding SGLNDIFEAQKIEWHE followed by a Gly4 or a Pro4Gly linker were ligated together (p43Nbiogly and p43Nbiopro).

For expression, we first isolated pBirAcm, a pACYC184 plasmid with an isopropyl 1-thio-beta-D-galactopyranoside-inducible birA gene to overexpress biotin-protein ligase, from E. coli AVB99, purchased from Avidity (www.avidity.com). The pBirAcm plasmid was then transformed into E. coli BL21(DE3), with chloramphenicol at 10 µg/ml. Finally we moved each of the plasmids encoding T4 biotin fusion proteins into E. coli BL21(DE3) (pBirAcm). Cultures were grown to an A600 of 0.4 at 37 °C in LB medium supplemented with 100 µM final concentration biotin, 10 µg/ml chloramphenicol, and 50 µg/ml carbenicillin. Addition of isopropyl 1-thio-beta-D-galactopyranoside to a final concentration of 1 mM induces both biotin-protein ligase and T7 RNA polymerase, and this gave good expression of each of the T4 fusion proteins after 2 h.

Purification of Biotin-tagged T4 Replication Proteins—Proteins were purified by modifications of the methods previously described for the unmodified proteins, followed by affinity chromatography on monovalent avidin (Softlink from Promega, Madison, WI) for the helicase and polymerase, or the higher capacity Streptavidin Mutein Matrix (Roche Applied Science) for 59 protein. Biotin in the proteins was measured using streptavidin horseradish peroxidase and the Protein Detector LumiGLO Western blot Kit from KPL, Inc.

The N- and C-terminally tagged biotin-59 proteins with Gly4 linkers from 2-liter cultures were partially purified through the high salt supernatant step (34). The affinity purification on the Streptavidin Mutein Matrix, by the following modification of the manufacturer's protocol, was carried out at 4 °C. A 4-ml column (stated capacity is 2.5 mg of biotinylated protein per ml), was washed with 40 ml of wash buffer (100 mM potassium phosphate, pH 7.2, 150 mM NaCl), and then with 16 ml of equilibration buffer (100 mM potassium phosphate, pH 7.2, 150 mM NaCl, and 400 mM ammonium sulfate). Half of the high salt supernatant (2 ml) was mixed with 1.25 ml of 3x equilibration buffer and then applied to this column. The column was closed for 40 min to allow protein to bind, and then washed with 40 ml of the wash buffer. 4 ml of elution buffer (wash buffer with 2 mM D-biotin) was allowed to run into the column, the column was closed for 30 min, and the biotin-tagged protein was then eluted with 20 ml more of the elution buffer, collecting 0.5-ml fractions. Most of the biotin-tagged 59 protein was in the first 2 ml. The matrix was regenerated following the manufacturer's protocol and then used to purify the remainder of the 59 protein. Peak fractions were pooled, dialyzed against 50 mM Tris-HCl, pH 7.5, 10% glycerol, 1 mM EDTA, 0.5 mM TCEP, and 100 mM KCl, and stored at -85 °C.

The N-terminal biotin-tagged T4 DNA polymerases from p43Nbiogly and p43Nbiopro were purified from 2-liter cultures by the rapid batch phosphocellulose method described previously (35) and then on a Softlink monovalent biotin resin from Promega. To saturate nonspecific binding sites for biotin and regenerate the resin, 1-ml columns were washed sequentially with 5 ml of 0.1 M sodium phosphate buffer (pH 7.0); 5 ml of the same buffer containing 10 mM biotin; 10 ml of 10% acetic acid; and then with 10 ml of 0.1 M sodium phosphate buffer (pH 7.0) to bring the pH of the effluent to 6.8. The column was closed for 1 h at room temperature to allow the avidin to refold, moved to 4 °C, and equilibrated with 43SL buffer (50 mM Tris-Cl, pH 7.5, 1 mM EDTA, 10% glycerol, 0.1 M KCl, and 1 mM dithiothreitol). Polymerase (2 mg) was loaded in 0.5-ml aliquots, closing the column for 15 min after each addition. The column was then washed with 8 ml of 43SL buffer, and the biotin-tagged protein was eluted with 43SL buffer containing 10 mM biotin, closing the column for 15 min after each 0.5-ml addition. Most of the protein (40% recovery) was in the second and third 0.5-ml fractions. Polymerase was dialyzed against 43SL buffer and stored at -85 °C.

The N-terminal biotin-tagged T4 41 helicase from a 5-liter culture of p41biopro or p41biogly was purified through the Q-Sepharose chromatography step as described previously (31). A 1-ml column of Softlink monovalent avidin was treated as described above and then equilibrated with AT buffer (10% glycerol, 50 mM Na-TAPS, pH 8.5, 0.5 mM TCEP-HCl (Pierce)). A peak fraction of helicase from the Q-Sepharose column (~1.5 mg) was loaded on this Softlink column, the column was washed with 1 ml of AT buffer, and biotin-helicase was eluted with AT buffer containing 5 mM biotin, dialyzed against AT buffer, and stored at -85 °C.

Nicked DNA Templates—Plasmid pUCNICK (2716 bp) with a single recognition site for the N.BbvCIA nicking enzyme (New England Biolabs) was constructed, purified, and nicked as described previously (34). pNNBSGless, which has a recognition sequence for the N.BbvCIA nicking enzyme followed by a 396-bp cassette with no C in the top strand, has the sequence GAATTTTAAGTAGGTTAAGGGGTTAAGC|TGAGG (N.BbvC1A recognition sequence underlined, and nicked site indicated by |) inserted between the EcoRI and SmaI sites of pBSGLess (36). The construction of the 452-bp minicircle, which contains a recognition site for the NBstN1B nicking enzyme (New England Biolabs) followed by 6 copies of a 70-bp sequence with all the glycines on one strand, will be described elsewhere.

Replication Reactions, Fixation, and Addition of the Biotin Pointers—T4 DNA ligase was obtained from USB Biochemicals. The purification of T4 32 protein (20) and all other unmodified T4 replication proteins (35) has been described previously. Replication reaction mixtures (40 µl) contained 2 nM of the nicked DNA templates; 2 mM ATP; 250 µM of each dNTP; 250 µM CTP, GTP, and UTP; 25 mM potassium Hepes (pH 7.6); 60 mM potassium acetate; 6 mM magnesium acetate; 10 mM beta-mercaptoethanol; and 20 µg/ml bovine serum albumin. Enzymes were diluted in a solution containing 50 mM potassium Hepes (pH 7.6), 100 mM KCl, 5 mM MgCl2, 1 mM EDTA, 10 mM beta-mercaptoethanol, 100 µg/ml bovine serum albumin, and 25% glycerol. Unless otherwise noted, the protein concentrations were 2 µM gene 32 single-stranded DNA-binding protein, 328 nM gene 41 helicase, 30 nM DNA polymerase, 242 nM genes 44/62 clamp-loader, 162 nM gene 45 clamp, 100 nM gene 59 helicase-loading protein, 64 nM gene 61 primase, 195 nM RNase H, and DNA ligase at 75 Weiss units/ml. Reaction mixtures without proteins were incubated for 2 min at 37 °C, and the reaction was begun by adding a mixture of all the proteins except T4 RNaseH and ligase, which were added 30 s later to prevent ligation of the nicked templates before replication began. Biotin-tagged replication proteins replaced wild-type proteins as indicated. Unless otherwise noted, reactions were stopped by adding 20 µl of 45 mM EDTA, and 1.8% glut-araldehyde in 1x replication salts without MgCl, giving a final concentration of 0.6% glutaraldehyde. After 5 min at room temperature, the glutaraldehyde fixation was quenched by adding 20 µl of 400 mM Tris-Cl, pH 7.5, and 20 mM EDTA, followed 10 min later by 20 µlof2.4 µM streptavidin (Molecular Probes) in 10 mM Tris-Cl, pH 7.5, 100 mM NaCl, and 1 mM EDTA to bind the biotin-tagged protein. The samples were placed on a rotator for 30 min at room temperature, and then filtered on 2-ml columns of 50- to 150-µm 2% agarose beads (Agarose Bead Technologies) in 10 mM Tris-Cl, pH 7.5, and 0.1 mM EDTA to remove unbound streptavidin and replication proteins. A 96-µl aliquot of the fraction containing the DNA-protein complexes was mixed with a 5' biotinylated 300- or 179-bp DNA, amplified from Bluescript plasmid, to give a final concentration of 2 µg/ml (9.6 µM). The 179-bp DNA was used in Fig. 3F. The 300-bp DNA, which is more clearly visible on the micrographs, was used in all other figures. The samples were mixed on a rotator for 18–20 h at 4 °C to allow binding of the biotinylated DNA, and then filtered on 2-ml columns of the 2% agarose in 10 mM Tris-Cl, pH 7.5, and 0.1 mM EDTA to remove unbound biotinylated "DNA pointers."


Figure 2
View larger version (72K):
[in this window]
[in a new window]

  		FIGURE 2.
Replication activity of the biotin-tagged T4 replication proteins. The template was nicked pUC-nick DNA (2.7 kb). A, polymerase; B, helicase; C, N-terminally tagged 59 helicase-loading protein. The products were analyzed by 0.6% alkaline agarose gel electrophoresis, and dCTP incorporation was determined by trichloroacetic acid precipitation.

 
Replication reactions for analysis on gels were carried out as described above for electron microscopy, except that RNase H and ligase were omitted so that the lagging strand fragments were not joined together. At the times indicated in the figures, aliquots of the reaction mixtures were mixed with an equal volume of 0.2 M EDTA to stop the synthesis, and the products were analyzed by 0.6% alkaline agarose gel electrophoresis and trichloroacetic acid precipitation (35).

Electron Microscopy—Samples were adsorbed to thin carbon foils, washed, air-dried, and rotary shadowcast with tungsten at high vacuum (37). Samples were examined in an FEI Tecnai 12 instrument at 40 kV. Length measurements were made by capturing the images with a Gatan 4K charge-coupled device camera attached to the Tecnai 12 and using Digital Micrograph software (Gatan Inc., Pleasanton, CA). Images for publication were captured on the Gatan charge-coupled device or on sheet film and then scanned with an Imacon 848 film scanner, and the contrast was optimized and panels were arranged using Adobe Photo-shop software. We only analyzed molecules with a circle the same size as the starting template.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Molecular Pointers to Proteins within the T4 Replication Complex— We have used biotinylated DNA as a molecular pointer to identify proteins within the T4 replication complex. A 16-residue peptide (SGLNDIFEAQKIEWHE) that is biotinylated on the lysine in vivo by the E. coli biotin ligase (BirA) enzyme (30), followed by a Gly4 or a Pro4Gly linker, was inserted after the N-terminal methionine in T4 DNA polymerase, 41 helicase, and 59 helicase-loading protein, as described under "Experimental Procedures." The purification methods for each protein included an affinity column (Softlink (Promega) or the higher capacity Streptavidin Mutein Matrix (Roche Applied Science)) to remove proteins without the biotin tag. The degree of biotinylation of the helicase and polymerase was higher with the Pro4Gly than the Gly4 linker, suggesting that the more rigid linker made the peptide more accessible to the biotin ligase.

The biotin-tagged polymerase and 59 helicase loader had activity equivalent to the wild-type proteins (Fig. 2, A and C). The template is the 2.7-kb pUCNICK plasmid, nicked at the single recognition site for the N-BbvCIA nicking enzyme (34). Reactions contained T4 DNA polymerase, 45 clamp, 44/62 clamp loader, primase, 41 helicase, 59 helicase loader, and 32 single-stranded DNA-binding protein. The lagging strand fragments were not joined, because no T4 RNase H or DNA ligase was added to these reactions. 59 helicase loader with the same tag at its C terminus retained ~50% of the wild-type activity (data not shown). T4 41 helicase is required for both increasing the rate of leading strand synthesis by unwinding the duplex ahead of the polymerase and allowing the primase to make the pentamer primers that initiate the lagging strand fragments. The biotin-tagged helicase retains both these activities and is nearly as active as the wild-type helicase (Fig. 2B).

We needed a DNA pointer that was long enough to extend beyond the large T4 replication complex (2) and be clearly visible on electron microscopy images. In our early experiments we used a pointer composed of a purified complex of a 179-bp biotinylated DNA duplex bound to a streptavidin tetramer (29). However, we have found that it is easier and just as efficient to add streptavidin to the fixed replicating molecules, remove unbound replication proteins and streptavidin by gel filtration, and then add a 179- or 300-bp biotinylated DNA (see "Experimental Procedures"). In the replication reactions for electron microscopy, the lagging strand fragments were joined by T4 RNaseH and DNA ligase. These were added 30 s after the other enzymes to prevent ligation of the nicked templates before replication began.


Figure 3
View larger version (103K):
[in this window]
[in a new window]

  		FIGURE 3.
Replication with biotin-tagged T4 DNA polymerase. Replication products from nicked pUCnick DNA (2.7 kb) are shown in A, B, D, E, and F. Products of the nicked 452-bp minicircle are shown in C. Arrows indicate the biotin DNA pointers showing the location of the tagged polymerase. The pointers were 300 bp in A–E and 179 bp in F. Note that in D–F the leading and lagging strand polymerases have become separated. In F there are two lagging strand polymerases simultaneously elongating fragments, as well as the leading strand polymerase at the fork. The blobs in B and D not associated with pointers are likely single-stranded DNA segments bound by g32p. G, number of pointers to biotin-tagged polymerase on different types of replicating molecules, with the pUCnick DNA template. Diagrams depicting molecule type indicate replication products without a rolling circle tail, with a single-stranded tail (not shown in the micrographs), with a double-stranded tail (not shown), or with one loop (Fig. 3, A–E)ortwo loops (Fig. 3F) with a double-stranded tail. Scale bar = 100 nm.

 
T4 Replication Complexes Contain Both Leading and Lagging Strand Polymerases—Our previous electron microscopy analysis of T4-replicating molecules showed a single complex at the replication fork that was large enough to contain the clamped leading and lagging strand polymerases, the heli-case, primase, and helicase loader, and ~800 b of single-stranded DNA covered with 32 protein folded into a compact structure (2). There was frequently a double-stranded trom-bone loop, formed from the nascent lagging strand fragment, attached to the complex. The 300-bp biotinylated pointer clearly shows the presence of two polymerases in this complex on the 2.7-kb circular pUCNICK template (Fig. 3, A, B, and D) and on a 452-bp nicked minicircle (see "Experimental Procedures") (Fig. 3C). The minicircle was designed to be large enough to be visible on the micrographs. In a series of six experiments with the biotin-tagged polymerase, 27–70% of the molecules scored had one or more pointers on the complex, and 10–43% had two or more pointers. Control reactions with all wild-type proteins had a single pointer on 3–7% of the complexes, consistent with a low level of nonspecific binding.

Although streptavidin is multiva-lent, the very strong correlation between the number of loops on the replicating molecules and the number of pointers to biotin-tagged polymerase makes it highly unlikely that many of the molecules had two pointers to the same streptavidin. As shown in Fig. 3G, 29% of the molecules with one loop, where the leading and lagging strand polymer-ases should be together in the complex, had two pointers to polymerase. In contrast, only 3% of the molecules without a loop had two pointers. Molecules with two loops, which we interpret as having two lagging strand fragments elongating simultaneously, were rare (13 of 221 molecules scored). 31% of these had three pointers to polymerase, whereas there were no molecules that had one loop, or no loop, that had three pointers. We frequently saw molecules where the complex had spilt into two parts, with a pointer to polymerase on each part (Fig. 3, D and E). The complex at the junction between the circular template and the tailed product likely contains the leading strand proteins. The distal complex is separated from the fork by duplex DNA, which is the nascent lagging strand fragment. There were also rare molecules (Fig. 3F) where the protein-covered single-stranded DNA on the lagging strand was extended, and there were pointers to polymerases on two adjacent lagging strand fragments, at the expected location for polym-erase molecules completing an Okazaki fragment.


Figure 4
View larger version (90K):
[in this window]
[in a new window]

  		FIGURE 4.
Replication with biotin-tagged T4 41 helicase. A and B, replication products from nicked pUCnick DNA (2.7 kb). C and D, replication products from the 452-bp minicircle. Arrows indicate the 300-bp biotin DNA pointers showing the location of the tagged hexameric helicase. Scale bar = 100 nm. E, number of pointers to biotin-tagged helicase on pUCnick DNA-replicating molecules.

 
Helicase in the Replication Complex—T4 41 helicase is a hexamer of identical subunits. In experiments with the biotin-tagged heli-case, we occasionally saw six pointers to the hexameric helicase (Fig. 4A), but most molecules had fewer pointers (Fig. 4, B–D). In the experiment analyzed in Fig. 4E, 91 of the 108 molecules from the reaction with the pUCNICK template had a double-stranded tail indicating there had been both leading and lagging strand synthesis. There were one or more pointers to the helicase on 55 (60%) of the molecules with double-stranded tails. The pointers were at the fork on 52 of these molecules, with the remaining 3 on the tail. In a series of three experiments with the tagged helicase, 60–70% of the molecules with double-stranded tails had at least one pointer; 24–28% had two or more pointers, including 1–3% with six pointers. Two factors may contribute to the small proportion of molecules with six pointers. It is likely that most of the tagged heli-case had some subunits that lacked biotin, because not all the helicase with the peptide tag is actually biotinylated in vivo (data not shown), and only one biotinylated subunit was necessary for the helicase to be bound to the affinity column used in the purification of the protein. In the absence of ATP, the heli-case is a dimer in solution, so that a minimum of three biotinylated subunits would be expected in the active hexamer (38). Thus our finding that only 11% of the molecules had three or more pointers suggests that the location of the helicase within the replication complex, or the added streptavidin, shields some of the subunits from the pointers. Conversely, on molecules where two pointers end at the same place in complex, they may both be pointing to same subunit, because streptavidin is multivalent.


Figure 5
View larger version (89K):
[in this window]
[in a new window]

  		FIGURE 5.
Replication with biotin-tagged T4 41 helicase and polymerase on stalled and actively replicating molecules. Helicase is present on a smaller fraction of the stalled molecules. The template was nicked pNNGless on which leading strand synthesis stops after 396 b in the absence of dCTP. A, biotin-tagged 41 helicase. B, biotin-tagged polymerase. Arrows indicate 300-bp biotin DNA pointers to the tagged helicase or polymerase. Scale bar = 100 nm. C, number of pointers to biotin-tagged helicase and biotin-tagged polymer-ase on stalled and actively replicating molecules.

 
Less Helicase Is Present on Stalled Replicating Molecules— The processivity of T4 41 helicase is greatly increased when it is present with a rapidly moving polymerase (reviewed in Refs. 39 and 40). We used a nicked plasmid (pNNGless) on which leading strand synthesis stalls after 396 b in the absence of dCTP to compare biotin-tagged helicase and polymerase on stalled and rapidly replicating molecules. With all four dNTPs there is rapid synthesis, and pointers show that both biotin-helicase (Fig. 5A) and polymerase (Fig. 5B) are present. In the absence of dCTP, the stalled replicating molecules have a 396-b single-stranded tail, because there are no T4 primase recognition sequences on the displaced strand. The pointers showed that both heli-case and polymerase were present in these stalled complexes. Multiple tagging approaches would be required to formally demonstrate that both are present on the same complex. However, analysis of a large number of molecules from each reaction (Fig. 5C) revealed that helicase was present on only 24% of the stalled molecules, compared with 53% of the molecules replicated with all four dNTPs. There was less of a difference with the tagged polymerase, which was present on 49% of the stalled molecules and 65% of the replicating molecules. In the future it will be important to obtain direct biochemical confirmation of this observation, because it is a central issue in understanding the nature of the stalled replication fork.

59 Helicase-loading Protein Remains on the DNA after Extensive Replication—T4 gene 59 helicase-loading protein accelerates the loading of the gene 41 helicase at the replication fork. Our experiments with pointers to biotin-tagged 59 loader show that it remains on the fork on molecules where there has been extensive replication (Fig. 6). In the experiment analyzed in Fig. 6G, 96 molecules had a double-stranded tail, the product of leading and lagging strand synthesis, and of these 50 (52%) had one or more pointers to N-terminally tagged biotin 59 loader at the fork. Thus the percentage of replication complexes with a pointer to biotin-tagged 59 loader was similar to that we observed with the biotin-tagged polymerase and helicase (Figs. 3, 4, 5). Forty-three percent of these molecules had a single pointer to the loading protein (Fig. 6A), 8% had two pointers (Fig. 6B), and only 1% had three or more pointers (Fig. 6C). For comparison, in a parallel experiment 30% of the molecules with a double-stranded tail had a single pointer to biotin-tagged helicase, 16% had two pointers, and 11% had three or more pointers (Fig. 4E).

Under our conditions, most of the protein-covered single-stranded DNA that had been unwound by the helicase on the lagging strand at the fork was folded into a compact structure, as shown in Fig. 6 (A–C) (see also Ref. 2). There were occasional molecules in which this single-stranded DNA was open (Fig. 6, D and E). Pointers on these molecules showed that 59 helicase loader was located at or near the fork, as well as near the distal end of this single-stranded region, close to the point where the last lagging strand fragment had been initiated. There were also molecules where 59 loader was on a protein-covered single stranded gap separated from the fork by duplex DNA (Fig. 6F).


Figure 6
View larger version (83K):
[in this window]
[in a new window]

  		FIGURE 6.
Replication with N-terminal biotin-tagged T4 59 helicase-loading protein. The template was nicked pUCnick DNA. Arrows indicate the 300-bp biotin DNA pointers to tagged helicase loader. A–C, molecules with a compact replication complex at the fork. D–F, molecules on which the complex has opened to show the protein-covered single-stranded DNA on the lagging strand. Scale bar = 72 nm for A–D and 100 nm for E and F. G, number of pointers to biotin-tagged 59 helicase-loading protein on different types of replicating molecules. The diagrams depicting molecule type indicate replication products without a rolling circle tail, with a single-stranded tail, or with a double-stranded tail, either with or without a loop.

 
The number of molecules with multiple pointers to 59 helicase loader at the fork increased with increasing 59 loader concentration, but this did not correlate with increased DNA synthesis. Molecules with two or more pointers were 4, 8–9, and 32% of the total at 50, 100, and 200 nM 59 loader, respectively, whereas molecules with a single pointer were 36, 39–42, and 32% in the same reactions. However, DNA synthesis was highest at 100 nM (Fig. 2C), consistent with previous reports of inhibition with higher 59 loader concentrations (34).

Because 59 loader is known to bind to single-stranded DNA, we carried out control reactions to measure its binding to 7200-b single-stranded M13 DNA under our replication conditions (Fig. 7). We wanted to be sure that 59 protein with pointers in the replication reactions did not result from 59 protein simply binding to single-stranded regions on the lagging strand template. These control reactions had all of the proteins present in our replication reactions except primase, with 59 protein at 100 nM. The protein-covered circular molecules had an open "beads on a string" appearance, similar to what we have observed with the same DNA and only 32 and 59 proteins under the same conditions (not shown), rather than the compact single-stranded DNA characteristic of the replicating molecules. Most of the visible protein is 32 protein. Only 36% of the molecules had a pointer to 59 protein, with most molecules (28%) having a single pointer. Because the available single-stranded DNA on the M13 molecules is ~seven times that of 1 kb on the replicating molecules (2), the density of 59 protein is much higher at or near the fork during replication (Compare Figs. 6 and 7).


Figure 7
View larger version (51K):
[in this window]
[in a new window]

  		FIGURE 7.
Limited binding of biotin-tagged T4 59 helicase-loading protein to M13 single-stranded DNA in the absence of replication. Reactions contained M13 viral circular single-stranded DNA (7.2 kb) and all the T4 replication proteins except primase. Arrows show 300-bp pointers to the helicase loader. Scale bar = 100 nm.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
We have used electron microscopy combined with biotinylated linear DNA as a molecular pointer to show that biotin-tagged T4 DNA polymerase, gene 41 helicase, and gene 59 heli-case-loading protein remain in the protein-DNA complex at the replication fork during DNA synthesis in vitro. The presence of a pointer to a specific biotinylated protein provides unambiguous evidence that the protein is there. However, the number of subunits of each protein in the complex cannot be determined, because the attachment of the pointers is not 100% efficient, and streptavidin has four biotin-binding sites. The T4 replication complex at the fork contains protein-coated single-stranded DNA folded into a compact structure, in addition to the polymerase holoenzyme and primosome proteins directly responsible for new DNA synthesis. We have not been able to use the pointers to determine the relative positions of specific tagged proteins within this highly dynamic complex, whose size and shape change at different stages of the lagging strand cycle. In contrast, the pointers were used successfully to show the location of proteins within the static complex of yeast Orc proteins, bound at a replication origin (29).

Both Leading and Lagging Strand Polymerases Are Present in the Replication Complex—We previously established that a large fraction of the T4 replication complexes contained a double-stranded loop and that the distribution of lengths of these loops matched the size distribution of lagging strand fragments on deproteinized molecules (2). This strongly suggested that the loops were formed from the nascent lagging strand fragments and should contain the lagging strand polymerase at the elongating end of the loop, in addition to the leading strand polymerase that should be present at the junction of the circular template and the linear rolling circle product. The studies presented here provide the strongest evidence that the replication complexes with a loop do contain two polymerases. The two polymerases are within a tight complex on most of the looped molecules. However, there were several molecules in which the complex had opened showing two separated complexes, each with a pointer to polymerase, one at the fork junction, and the other separated from the fork by a duplex with a nascent lagging strand fragment, consistent with their assignment as the leading and lagging strand polymerases.

Molecules without a loop are at a stage in the lagging strand cycle where a lagging strand fragment has been completed, but polymerase has not begun the extension of the next primer, or the extended chain is too short to form a visible loop. We found that 44% of the molecules with a long duplex product tail, but no loop, had a single pointer to polymerase, and only 3% had two pointers. This was surprising because it has been shown that T4 lagging strand synthesis can continue after dilution into a solution without polymerase (41), implying that the lagging strand polymerase can be recycled to the next fragment. It is possible that when a polymerase is in transit to the next primer, or in the initial stage of primer extension, it is more easily lost from the complex under our fixation conditions. The association of both the leading and lagging strand polymerases with the replicating DNA is dynamic, in the sense that they can be replaced by a mutant polymerase present in the reaction solution (42). It has recently been proposed that the presence of a clamp on a primer serves as a signal for the lagging strand polymerase to leave an unfinished fragment to begin elongation of the clamped primer (43). It is clear that the size of lagging strand fragments increases with limiting concentrations of the clamp (43),3 as expected if a primer must be clamped before it can be extended. If polymerase normally leaves an unfinished fragment when the clamp is not limiting, the binding of a second polymerase to complete the fragment must be very efficient. Very few gaps are observed on replicating molecules made under these conditions in the presence of T4 DNA ligase and the T4 5' nuclease (RNaseH) that removes the primers (Ref. 2 and this report), and almost all the adjacent fragments are separated only by nicks that can be sealed by T4 DNA ligase.3

In our original analysis of molecules replicated by the T4 proteins, we unexpectedly found a small percentage of molecules that appeared to have more than one loop (2). When the same reaction products were examined after removal of the T4 proteins by proteolysis, there was a similar percentage of molecules with two duplex regions surrounded by single-stranded DNA near the fork, consistent with molecules on which there were two incomplete lagging strand fragments. These molecules with two loops, or two lagging strand fragments, were not predicted by the original Albert trombone replication model. In the present study, 6% of the molecules had two loops, and 31% of these had three pointers to biotin-tagged polymerase, providing strong evidence that the two loops in fact result from two fragments that are being extended simultaneously. There were no molecules with a single loop or no loop that had three pointers to polymerase.

More Helicase Is Present on Rapidly Replicating Molecules— We found one or more pointers to biotin-tagged gene 41 heli-case on 60% of the molecules with double-stranded tails on the circular templates, and almost all of these were at the fork, rather than on unwound single-stranded DNA ahead of the polymerase. Molecules with six pointers to this hexameric heli-case of identical subunits were rare for reasons discussed under "Results." The T4 gene 41 and T7 gene 4 replicative helicases each have been shown to unwind at a much higher rate at a replication fork ahead of the leading strand polymerase, than on model fork helicase substrates (reviewed in Ref. 44). The important factor appears to be having duplex DNA behind the heli-case to keep it in position, rather than a specific interaction with the polymerase. The processive T7 polymerase-thioredoxin complex can replace T4 DNA polymerase with the T4 helicase (39, 41), and T4 DNA polymerase can replace the T7 DNA polymerase complex with T7 helicase (45). We found significantly less helicase on molecules where replication was stalled after 396 b by the absence of a required dNTP, than on rapidly replicating molecules in a complete reaction with the same template.

T4 59 Helicase-loading Protein Remains on the DNA after Loading the Helicase—59 helicase loader is present on the majority (70%) of the molecules with a long double-stranded tail replicated in reactions with biotin-tagged 59 helicase loader. Most of the pointers (52%) were at the fork, and the 18% scored on the tail were bound predominantly to the single-stranded DNA adjacent to the fork. Because 59 protein binds single-stranded DNA, it was important to establish that the binding we observed on the replication products was greater than that for 59 protein on any single-stranded DNA under the same conditions. With M13 circular single-stranded DNA at the same concentration as the nicked templates, and primase omitted to prevent synthesis, we found pointers to 59 protein on only 36% of the molecules, and only 8% had more than one pointer. Because the single-stranded region on the replicating molecules averages 1000 bases, rather than the 7200 bases on each M13 circle, the density of 59 protein bound to single-stranded DNA is clearly much greater during replication. Thus 59 protein remains on the DNA during replication, after loading the helicase.

The function of 59 protein beyond increasing the rate of heli-case loading is a subject of active investigation. This small (26 kDa) protein binds preferentially to fork DNA and interacts directly with T4 41 helicase, 32 protein, and polymerase (17, 20, 23, 24, 46). T4 phage begins replication from one or more replication origins, but most of its replication is accomplished at forks established by recombination. Early studies showed that T4 phage mutants in gene 59 had a DNA arrest phenotype, suggesting a role in recombination-directed replication (reviewed in Ref. 47). At the second fork established for bidirectional replication in vivo at a T4 replication origin, leading strand synthesis continued in the absence of lagging strand synthesis with a gene 59 mutant, whereas synthesis on the two strands began simultaneously with the wild-type phage. This led to the hypothesis that 59 protein functions as a gatekeeper, blocking the leading strand polymerase until the primase-heli-case is loaded (22). In vitro, the presence of 59 protein has been shown to block leading strand synthesis until the helicase and 32 protein, which are each necessary for lagging strand synthesis, are loaded (20, 21, 23, 24). Cross-linking and fluorescence transfer (fluorescence resonance energy transfer) experiments show a close interaction of 59 helicase loader and polymerase (23, 24). Single molecule fluorescence resonance energy transfer experiments on a short primed fork (longest strand, 62 b) indicated that 59 and 32 proteins remained on the fork with helicase in the presence of ATP{gamma}S, but both 59 and 32 proteins left when ATP, required for the assembly of the helicase hexamer and DNA unwinding, was added (19). Similar results with the helicase and 59 protein were obtained with gel mobility shift experiments, using antibody to identify complexes containing the helicase loader (31). These studies all show that 59 protein and active helicase are not present simultaneously on the short fork DNA. It is unclear whether there is simply not enough room on the short DNA, or if 59 protein is actively ejected as part of the helicase-loading mechanism. If it is ejected, it must bind efficiently to the single-stranded DNA produced as heli-case unwinds the duplex at the replication fork, because we found pointers to 59 protein at or near the fork on a majority of the replicating molecules. The role of this bound 59 protein is still unclear. Both 59 protein and 32 protein increase the rate of synthesis of pentamer primers by the primase-helicase (14). The 32 protein-covered single-stranded DNA on molecules replicated with the T4 proteins appeared less compact in reactions without 59 protein (2). The possibility that the 59 and 32 proteins have roles in regulating primer synthesis or utilization on the lagging strand needs to be examined.


   FOOTNOTES
 
The co-authors all wish to dedicate this work to our first author, Dr. Nancy Nossal, who sadly passed away following the completion of this work. In the finest tradition of first authorship she carried out the greatest share of the experimental work in this report, including crafting the final product.

* This work was supported by the Intramural Research Program of NIDDK, National Institutes of Health (NIH) (to N. G. N.) and by NIH Grant GM31819 (to J. D. G.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Lineberger Comprehensive Cancer Center, University of North Carolina, Mason Farm Road, Chapel Hill, NC 27599-7295. Tel.: 919-966-2151; Fax: 919-66-3015; E-mail: jdg{at}med.unc.edu.

2 The abbreviations used are: b, base; TAPS, [tris(hydroxymethyl)methyl]-aminopropanesulfonic acid); TCEP, tris(2-carboxyethyl)phosphine hydro-chloride; ATP{gamma}S, adenosine 5'-O-(thiotriphosphate). Back

3 N. G. Nossal, unpublished experiments. Back


   ACKNOWLEDGMENTS
 
We thank Erin Green for cloning and purifying the C-terminally tagged 59 helicase loader.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Alberts, B. M. (1985) Trends Genet. 1, 26-30[Medline] [Order article via Infotrieve]
  2. Chastain, P., Makhov, A. M., Nossal, N. G., and Griffith, J. D. (2003) J. Biol. Chem. 278, 21276-21285[Abstract/Free Full Text]
  3. Lee, J., Chastain, P. D., Griffith, J. D., and Richardson, C. C. (2002) J. Mol. Biol. 316, 19-34[CrossRef][Medline] [Order article via Infotrieve]
  4. Lee, J., Chastain, P. D., 2nd, Kusakabe, T., Griffith, J. D., and Richardson, C. C. (1998) Mol. Cell 1, 1001-1010[CrossRef][Medline] [Order article via Infotrieve]
  5. Park, K., Debyser, Z., Tabor, S., Richardson, C. C., and Griffith, J. D. (1998) J. Biol. Chem. 273, 5260-5270[Abstract/Free Full Text]
  6. Nossal, N. G. (1994) in Molecular Biology of Bacteriophage T4 (Karem, J., ed) pp. 43-53, American Society for Microbiology, Washington, D. C.
  7. Benkovic, S. J., Valentine, A. M., and Salinas, F. (2001) Annu. Rev. Biochem. 70, 181-208[CrossRef][Medline] [Order article via Infotrieve]
  8. Alley, S. C., Trakselis, M. A., Mayer, M. U., Ishmael, F. T., Jones, A. D., and Benkovic, S. J. (2001) J. Biol. Chem. 276, 39340-39349[Abstract/Free Full Text]
  9. Pietroni, P., Young, M. C., Latham, G. J., and von Hippel, P. H. (2001) J. Mol. Biol. 309, 869-891[CrossRef][Medline] [Order article via Infotrieve]
  10. Venkatesan, M., Silver, L. L., and Nossal, N. G. (1982) J. Biol. Chem. 257, 12426-12434[Abstract/Free Full Text]
  11. Cha, T.-A., and Alberts, B. M. (1990) Biochemistry 29, 1791-1798[CrossRef][Medline] [Order article via Infotrieve]
  12. Hinton, D. M., and Nossal, N. G. (1987) J. Biol. Chem. 262, 10873-10878[Abstract/Free Full Text]
  13. Jing, D. H., Dong, F., Latham, G. J., and von Hippel, P. H. (1999) J. Biol. Chem. 274, 27287-27298[Abstract/Free Full Text]
  14. Valentine, A. M., Ishmael, F. T., Shier, V. K., and Benkovic, S. J. (2001) Biochemistry 40, 15074-15085[CrossRef][Medline] [Order article via Infotrieve]
  15. Barry, J., and Alberts, B. M. (1994) J. Biol. Chem. 9, 33049-33062
  16. Delagoutte, E., and von Hippel, P. H. (2005) J. Mol. Biol. 347, 257-275[CrossRef][Medline] [Order article via Infotrieve]
  17. Jones, C. E., Mueser, T. C., Dudas, K. C., Kreuzer, K. N., and Nossal, N. G. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 8312-8318[Abstract/Free Full Text]
  18. Spacciapoli, P., and Nossal, N. G. (1994) J. Biol. Chem. 269, 447-455[Abstract/Free Full Text]
  19. Zhang, Z., Spiering, M. M., Trakselis, M. A., Ishmael, F. T., Xi, J., Benkovic, S. J., and Hammes, G. G. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 3254-3259[Abstract/Free Full Text]
  20. Jones, C. E., Mueser, T. C., and Nossal, N. G. (2004) J. Biol. Chem. 279, 12067-12075[Abstract/Free Full Text]
  21. Nossal, N. G., Dudas, K. C., and Kreuzer, K. N. (2001) Mol. Cell 7, 31-41[CrossRef][Medline] [Order article via Infotrieve]
  22. Dudas, K. C., and Kreuzer, K. N. (2005) J. Biol. Chem. 280, 21561-21569[Abstract/Free Full Text]
  23. Xi, J., Zhang, Z., Zhuang, Z., Yang, J., Spiering, M. M., Hammes, G. G., and Benkovic, S. J. (2005) Biochemistry 44, 7747-7756[CrossRef][Medline] [Order article via Infotrieve]
  24. Xi, J., Zhuang, Z., Zhang, Z., Selzer, T., Spiering, M. M., Hammes, G. G., and Benkovic, S. J. (2005) Biochemistry 44, 12264[CrossRef]
  25. Bhagwat, M., and Nossal, N. G. (2001) J. Biol. Chem. 276, 28516-28524[Abstract/Free Full Text]
  26. Gangisetty, O., Jones, C. E., Bhagwat, M., and Nossal, N. G. (2005) J. Biol. Chem. 280, 12876-12887[Abstract/Free Full Text]
  27. Hollingsworth, H. C., and Nossal, N. G. (1991) J. Biol. Chem. 266, 1888-1897[Abstract/Free Full Text]
  28. Alberts, B. M., and Frey, L. (1970) Nature 227, 1313-1318[CrossRef][Medline] [Order article via Infotrieve]
  29. Chastain, P. D., II, Bowers, J. L., Lee, D. G., Bell, S. P., and Griffith, J. D. (2004) J. Biol. Chem. 279, 36354-36362[Abstract/Free Full Text]
  30. Schatz, P. J. (1993) Biotechnology (N. Y.) 11, 1138-1143[Medline] [Order article via Infotrieve]
  31. Jones, C. E., Mueser, T. C., and Nossal, N. G. (2000) J. Biol. Chem. 275, 27145-27154[Abstract/Free Full Text]
  32. Mueser, T. C., Jones, C. E., Nossal, N. G., and Hyde, C. C. (2000) J. Mol. Biol. 296, 597-612[CrossRef][Medline] [Order article via Infotrieve]
  33. Spacciapoli, P., and Nossal, N. G. (1994) J. Biol. Chem. 269, 438-446[Abstract/Free Full Text]
  34. Jones, C. E., Green, E. M., Stephens, J. A., Mueser, T. C., and Nossal, N. G. (2004) J. Biol. Chem. 279, 25721-25728[Abstract/Free Full Text]
  35. Nossal, N. G., Hinton, D. M., Hobbs, L. J., and Spacciapoli, P. (1995) Methods Enzymol. 262, 560-584[Medline] [Order article via Infotrieve]
  36. Subramanian, D., and Griffith, J. D. (2005) J. Biol. Chem. 280, 42568-42572[Abstract/Free Full Text]
  37. Griffith, J. D., and Christiansen, G. (1978) Annu. Rev. Biophys. Bioeng. 7, 19-35[CrossRef][Medline] [Order article via Infotrieve]
  38. Dong, F., Gogol, E. P., and von Hippel, P. H. (1995) J. Biol. Chem. 270, 7462-7473[Abstract/Free Full Text]
  39. Delagoutte, E., and von Hippel, P. H. (2001) Biochemistry 40, 4459-4477[CrossRef][Medline] [Order article via Infotrieve]
  40. von Hippel, P. H., and Delagoutte, E. (2001) Cell 104, 177-190[CrossRef][Medline] [Order article via Infotrieve]
  41. Kadyrov, F. A., and Drake, J. W. (2001) J. Biol. Chem. 276, 29559-29566[Abstract/Free Full Text]
  42. Yang, J., Zhuang, Z., Roccasecca, R. M., Trakselis, M. A., and Benkovic, S. J. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 8289-8294[Abstract/Free Full Text]
  43. Yang, J., Nelson, S. W., and Benkovic, S. J. (2006) Mol. Cell 21, 153-164[CrossRef][Medline] [Order article via Infotrieve]
  44. Patel, S. S., and Picha, K. M. (2000) Annu. Rev. Biochem. 69, 651-697[CrossRef][Medline] [Order article via Infotrieve]
  45. Stano, N. M., Jeong, Y.-J., Donmez, I., Tummalapalli, P., Levin, M. K., and Patel, S. S. (2005) Nature 435, 370-373[CrossRef][Medline] [Order article via Infotrieve]
  46. Lefebvre, S. D., Wong, M. L., and Morrical, S. W. (1999) J. Biol. Chem. 274, 22830-22838[Abstract/Free Full Text]
  47. Kreuzer, K. N., and Morrical, S. W. (1994) in Molecular Biology of Bacteriophage T4 (Karem, J., ed) pp. 28-42, American Society for Microbiology, Washington, D. C.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/2/1098    most recent
M606772200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar