Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M700271200 on March 26, 2007

J. Biol. Chem., Vol. 282, Issue 20, 14729-14740, May 18, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/20/14729    most recent
M700271200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seidel, M.
Right arrow Articles by Besra, G. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seidel, M.
Right arrow Articles by Besra, G. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Identification of a Novel Arabinofuranosyltransferase AftB Involved in a Terminal Step of Cell Wall Arabinan Biosynthesis in Corynebacterianeae, such as Corynebacterium glutamicum and Mycobacterium tuberculosis*

Mathias Seidel{ddagger}1, Luke J. Alderwick§12, Helen L. Birch§, Hermann Sahm{ddagger}, Lothar Eggeling{ddagger}, and Gurdyal S. Besra§3

From the {ddagger}Institute for Biotechnology 1, Research Centre Juelich, D-52425 Juelich, Germany, and §School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, United Kingdom

Received for publication, January 10, 2007 , and in revised form, February 16, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Arabinofuranosyltransferase enzymes, such as EmbA, EmbB, and AftA, play pivotal roles in the biosynthesis of arabinogalactan, and the anti-tuberculosis agent ethambutol (EMB) targets arabinogalactan biosynthesis through inhibition of Mt-EmbA and Mt-EmbB. Herein, we describe the identification and characterization of a novel arabinofuranosyltransferase, now termed AftB (Rv3805c), which is essential in Mycobacterium tuberculosis. Deletion of its orthologue NCgl2780 in the closely related species Corynebacterium glutamicum resulted in a viable mutant. Analysis of the cell wall-associated lipids from the deletion mutant revealed a decreased abundance of cell wall-bound mycolic acids, consistent with a partial loss of mycolylation sites. Subsequent glycosyl linkage analysis of arabinogalactan also revealed the complete absence of terminal beta(1 -> 2)-linked arabinofuranosyl residues. The deletion mutant biochemical phenotype was fully complemented by either Mt-AftB or Cg-AftB, but not with muteins of Mt-AftB, where the two adjacent aspartic acid residues, which have been suggested to be involved in glycosyltransferase activity, were replaced by alanine. In addition, the use of C. glutamicum and C. glutamicum{Delta}aftB in an in vitro assay utilizing the sugar donor beta-D-arabinofuranosyl-1-monophosphoryl-decaprenol together with the neoglycolipid acceptor {alpha}-D-Araf-(1 -> 5)-{alpha}-D-Araf-O-C8 as a substrate confirmed AftB as a terminal beta(1 -> 2) arabinofuranosyltransferase, which was also insensitive to EMB. Altogether, these studies have shed further light on the complexities of Corynebacterianeae cell wall biosynthesis, and Mt-AftB represents a potential new drug target.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Mycobacterial diseases such as tuberculosis and leprosy still represent a severe public health problem (1). For instance, the recent emergence of multidrug-resistant tuberculosis strains and, more recently, extensively drug-resistant tuberculosis clinical isolates (2, 3) has prompted the need for new drugs and drug targets. The causative agent of these diseases, Mycobacterium tuberculosis and Mycobacterium leprae, respectively, are characterized by an intricate cell envelope (4–6). This characteristic mycobacterial cell envelope is composed of four macromolecules, lipoarabinomannan, mycolic acids, arabinogalactan (AG),4 and peptidoglycan (4–7). The galactan domain of AG is linked to peptidoglycan via a specialized "linker unit," L-Rhap-(1 -> 4)-{alpha}-D-GlcNAc, and its distal arabinan domain to mycolic acids, forming the mycolyl-arabinogalactan-peptidoglycan (mAGP) complex (4–6). The arabinan domain contains {alpha}(1 -> 5), {alpha}(1 -> 3), and beta(1 -> 2) arabinofuranosyl (Araf) linkages, arranged in several distinct structural motifs (5, 8, 9). The nonreducing arabinan termini of AG consists of t-Araf, 2-Araf, 5-Araf, and 3,5-Araf residues arranged into a characteristic terminal Ara6 motif, with the 5-OH of the t-Araf and 2-Araf residues representing sites of mycolylation (6). The packing and ordering of mycolic acids within the mAGP and additional lipids within the outer envelope results in a highly impermeable barrier (10). It is interesting to note that several frontline anti-tubercular drugs, such as ethambutol (EMB) (11–13) and isoniazid (14, 15), target aspects of the biosynthesis of the mAGP complex.

Corynebacterium glutamicum has proven useful in the study of orthologous M. tuberculosis genes essential for viability (16, 17). This bacterium together with Corynebacterium diphtheriae and Corynebacterium jeikeium as well as M. tuberculosis and M. leprae and a number of other closely related species form the well defined taxon Corynebacterianeae. The bacteria within this taxon share many characteristic cell wall features, such as AG and mycolic acids. In addition, the use of C. glutamicum together with its low number of paralogous genes (18) has proven useful in the study of the mAGP complex within this peculiar group of organisms (9). For instance, we recently identified a novel mycobacterial arabinofuranosyltransferase AftA using C. glutamicum due to the fact that it is largely tolerable with respect to the deletion of Cg-emb (9) and Cg-aftA (19), which are otherwise essential in M. tuberculosis.5

The structural basis of AG is now well defined (4, 5, 8); conversely, aspects of its biogenesis remained poorly resolved. The biosynthesis of AG involves the formation of a linear galactan chain with alternating beta(1 -> 5) and beta(1 -> 6)-D-galactofuranosyl (Galf) residues of ~30 residues in length from the specialized "linker unit," L-Rhap-(1 -> 4)-{alpha}-D-GlcNAc (20, 21). MALDI-TOF mass spectrometry (MS) analyzes of per-O-methylated AG of C. glutamicum deleted of its single arabinofuranosyltransferase, Cg-emb, revealed that the 8th, 10th, and 12th Galf residue possessed singular Araf residues (9). These specific Araf residues were recently shown to be transferred by a specialized arabinofuranosyltransferase AftA, whose gene in all Corynebacterianeae analyzed to date is adjacent to the emb cluster (19). These initial Araf residues "prime" the galactan backbone for further attachment of {alpha}(1 -> 5)-linked Araf residues. These reactions require the arabinofuranosyltransferase activities of Mt-EmbA and Mt-EmbB or Cg-Emb, which are also targets of EMB (9, 13, 22), to eventually result in mature AG. The Emb and AftA proteins utilize the specialized sugar donor, beta-D-arabinofuranosyl-1-monophosphoryl-decaprenol (DPA) (23–25), and is a characteristic feature found only in Corynebacterianeae (26–28). In addition, these proteins also belong to the GT-C superfamily of integral membrane glycosyltransferases (29). A recent topological analysis of Cg-Emb (30) together with a mutational study of Mt-EmbC (31) revealed for the first time a clear domain organization of these proteins, with the glycosyltransferase DDX signature evident in the extracellular loop that connects helixes III-IV and the chain elongation "Pro-motif" in the extracellular loop connecting helixes XIII-XIV (31).

It is interesting to note that the arabinan domain of AG utilizes several different Araf linkages, which suggests that additional arabinofuranosyltransferases must be required to form a fully matured AG. Moreover, initial Araf residues at branching sites could require specialized arabinofuranosyltransferases as already observed for AftA (19), and it has to be considered that even further specialized arabinofuranosyltransferases might exist to incorporate Araf into lipoarabinomannan. Clearly additional arabinofuranosyltransferases still remain to be identified in Corynebacterianeae. Indeed, Liu and Mushegian (29) identified 15 members of the GT-C superfamily, representing candidates involved in the biosynthesis of cell wall related glycans and lipoglycans in M. tuberculosis. We have continued our earlier studies (9, 16, 19) to identify genes required for the biosynthesis of the core structural elements of the mAGP complex in Corynebacterianeae by studying mutants of C. glutamicum and the orthologous genes and enzymes of M. tuberculosis. Herein we present Rv3805c as a new arabinofuranosyltransferase of the GT-C superfamily that is responsible for the transfer of Araf residues from DPA to the arabinan domain to form terminal beta(1 -> 2)-linked Araf residues, which marks the "end point" for AG arabinan biosynthesis before decoration with mycolic acids.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Strains and Culture Conditions—M. tuberculosis H37Rv DNA was obtained from the Tuberculosis Research Material Contract (National Institutes of Health) at Colorado State University. C. glutamicum ATCC 13032 (the wild type strain, and referred for the remainder of the text as C. glutamicum) and Escherichia coli DH5{alpha} were grown in Luria-Bertani broth (LB, Difco) at 30 and 37 °C, respectively. The mutants generated in this study were grown on complex brain heart infusion medium (32). Kanamycin and ampicillin were used at a concentration of 50 µg/ml. Samples for lipid analyzes were prepared by harvesting cells at an optical density of 10–15 followed by a saline wash and freeze drying.

Construction of Plasmids and Strains—The vectors made were pMSX-Cg-aftB (NCgl2780), pMSX-Mt-aftB (Rv3805c), and pK19mobsacB{Delta}aftB, with the gene number of the M. tuberculosis and C. glutamicum aftB orthologue added in parentheses.

To express M. tuberculosis aftB in C. glutamicum, the primer pair GTATGAGCATATGGTCCGGGTCAGCTTGTGG (all primers in 5'-3'direction) and ATTGCCCCTCACTCGAGCTCCCGCGGTGGCGGG was used, with the restriction sites NdeI and XhoI underlined, using M. tuberculosis H37Rv chromosomal DNA as a template. The purified PCR fragment was ligated with accordingly digested pMSX to give pMSX-Mt-aftB. pMSX was prepared from pEKEx2 (33) to generate a derivative providing an appropriate ribosome binding site together with a C-terminal His tag. It was created by the individual cleavage of pEKEx2 with NdeI and XhoI, each followed by Klenow treatment and religation. The intermediate construct was SalI/DraI-cleaved, treated with mung bean nuclease, and ligated with the XbaI/MroI fragment from pET22b (Novagen), which before use was treated with the Klenow fragment to eventually yield pMSX. To overexpress Cg-aftB, the primer pair ATGTGGCCATATGACGTTTAGCCCCCAGCGTC and TGTTTACTCGAGCTGAGAGCTATATAAAGGTTCTCCGC was used to amplify C. glutamicum aftB, which was ligated with NdeI- and XhoI-cleaved pMSX to generate pMSX-Cg-aftB.

To construct the deletion vector pK19mobsacB{Delta}aftB crossover PCR was applied with primer pairs AB (A, ACGCCAAGCTTTGCTAGTCGCTGCGTTTGGTTC; B, CCCATCCACTAAACACTGGGGGCTAAACGTCATGAG) and CD (C, TGTTTAAGTTTAGTGGATGGGGAACCTCGCGGAGAACCTTTATATA; D, GCCAGTGAATTCGGCGCGCAGCGTTGGTATC) and C. glutamicum genomic DNA as template. Both amplified products were used in a second PCR with primer pairs AD to generate a fragment consisting of sequences adjacent to Cg-aftB, which was blunt end-ligated with SmaI-cleaved pK19mobsacB. All plasmids were confirmed by sequencing. The chromosomal deletion of Cg-aftB was performed as described previously using two rounds of positive selection (34), and its successful deletion was verified by use of different primer pairs. Plasmid pMSX-Mt-aftB and pMSX-Cg-aftB were introduced into C. glutamicum{Delta}aftB by electroporation with selection to kanamycin resistance (25 µg/ml).

Site-specific mutations were introduced in Mt-aftB using appropriate mutagenic primers and pMSX-Mt-aftB as the double-stranded template (QuikChange kit, Stratagene). After linear amplification of the newly synthesized strands and DpnI digestion of parental strands, plasmids pMSX-Mt-aftB-D29A and pMSX-Mt-aftB-D30A were generated carrying the mutations as indicated. All plasmids were verified by sequencing.

Protein Analysis—Recombinant C. glutamicum strains deleted of the chromosomal Cg-aftB copy but carrying either pMSX, pMSX-Mt-aftB, pMSX-Mt-aftB-D29A, or pMSX-Mt-aftB-D30A were each grown in LB up to an optical density of 4. Cells were harvested by centrifugation, washed, and resuspended in 30 ml of 50 mM Tris-HCl (pH 7.4) buffer, containing 200 mM NaCl and 50 mM imidazole and disrupted by probe sonication. Centrifugation at 27,000 x g resulted in a clear supernatant, which was applied to a 1-ml HiTrapTM chelating high performance column (GE Healthcare) using an ÅTKA chromatography system. The column was initially washed with 10 ml of the aforementioned buffer, and bound proteins were subsequently eluted with 2 ml of the same buffer but containing 500 mM imidazole. Eluted proteins were precipitated, dried, and resuspended in 10 µl of loading buffer, and SDS-PAGE was carried out on a 10% polyacrylamide gel, which was subsequently stained using 0.05% Coomassie G250 in 10% acetic acid and 25% isopropanol. Bands of interest were excised and subjected to in-gel digestion with trypsin before peptide mass fingerprinting. Peptides were extracted by the sequential addition of water (12 µl) and 0.1% (v/v) trifluoroacetic acid in 30% (v/v) acetonitrile (10 µl) and analyzed manually using an Applied Biosystems Voyager STR MALDI-TOF mass spectrometer (Weiterstadt, Germany).

Extraction and Analysis of Cell Wall-associated and Cell Wall-bound Lipids—Cells (100 mg) were extracted by two consecutive extractions using 2 ml of CHCl3/CH3OH/H2O (10: 10:3, v/v/v) for 3 h at 50°C, and the resulting delipidated cells were stored for further use (as described below). Organic extracts were combined with 1.75 ml of CHCl3 and 0.75 ml H2O, mixed, and centrifuged. The lower organic phase was recovered, washed twice with 2 ml of CHCl3/CH3OH/H2O (3:47:48, v/v/v), dried, and resuspended in 200 µl of CHCl3/CH3OH/H2O (10:10:3, v/v/v). An aliquot (20 µl) was analyzed by thin layer chromatography (TLC) using silica gel plates (5735 silica gel 60F254, Merck) developed in CHCl3/CH3OH/H2O (60:16:2, v/v/v). TLCs were visualized by charring with 5% molybdophosphoric acid in ethanol at 100 °C to reveal cell wall-associated lipids.

The bound corynomycolic acids from delipidated extracts or purified cell walls (see below) were released by the addition of a 5% aqueous solution of tetra-butyl ammonium hydroxide followed by overnight incubation at 100 °C and methylated as described previously (9). Corynomycolic acid methyl esters (CMAMEs) were analyzed by TLC using silica gel plates (5735 silica gel 60F254, Merck) developed in petroleum ether/acetone (95:5, v/v). TLCs were visualized by charring with 5% molybdophosphoric acid in ethanol at 100 °C to reveal CMAMEs.

Alternatively, 14C labeling of cell wall-associated lipids and cell wall-bound corynomycolic acids was performed by growing cultures initially at 30 °C in 5 ml of brain heart infusion media supplemented with antibiotic where appropriate. Once the optical density reached ~0.5, cultures were labeled with 5 µCi of [14C]acetic acid (50–62 µCi/mmol, Amersham Biosciences) and further incubated for 8 h. Cells were harvested by centrifugation, and the cell wall-associated lipids were extracted as described above. The cell wall-associated 14C-labeled lipids were resuspended in 200 µl of CHCl3/CH3OH/H2O (10:10:3, v/v/v), and an aliquot (5 µl) was dried in a scintillation vial and then mixed with 10 ml of EcoScintA scintillation fluid (National Diagnostics, Atlanta, GA) and counted. Equal counts (25,000 cpm) of each sample were analyzed by TLC using silica gel plates (5735 silica gel 60F254, Merck) developed in CHCl3/CH3OH/H2O (60:16:2, v/v/v) and quantified using phosphorimaging after exposure to Kodak X-Omat film for 24 h. The bound [14C]corynomycolic acids from the delipidated extracts were released by base treatment and methylated as described above to afford [14C]CMAMEs. The [14C]CMAMEs were resuspended in 100 µl of CH2Cl2, and an aliquot (5 µl) was dried in a scintillation vial and then mixed with 10 ml of EcoScintA scintillation fluid (National Diagnostics) and counted to quantify cell wall-bound [14C]corynomycolic acids. A 5-µl aliquot of [14C]CMAMEs was also analyzed by TLC using silica gel plates (5735 silica gel 60F254, Merck) developed in petroleum ether/acetone (95:5, v/v). TLC autoradiograms were obtained by exposing TLCs to Kodak X-Omat film for 24 h.

Isolation of the mAGP Complex—The thawed cells were resuspended in phosphate-buffered saline containing 2% Triton X-100 (pH 7.2), disrupted by sonication, and centrifuged at 27,000 x g (5, 8, 9). The pelleted material was extracted 3 times with 2% SDS in phosphate-buffered saline at 95 °C for 1 h to remove associated proteins, successively washed with water, 80% (v/v) acetone in water, and acetone, and finally lyophilized to yield a highly purified cell wall preparation (5, 8, 9).

Glycosyl Composition and Linkage Analysis of Cell Walls by Alditol Acetates—Cell wall preparations were hydrolyzed using 2 M trifluoroacetic acid and reduced with NaB2H4, and the resultant alditols per-O-acetylated were examined by gas chromatography (GC) (5, 8, 9). Cell wall preparations were per-O-methylated using dimethyl sulfinyl carbanion (5, 8, 9). The per-O-methylated cell walls were hydrolyzed using 2 M trifluoroacetic acid, reduced with NaB2H4, per-O-acetylated, and examined by GC/MS (5, 8, 9). Analysis of alditol acetate sugar derivatives was performed on a CE Instruments ThermoQuest Trace GC 2000. Samples were injected in the splitless mode. The column used was a DB225 (Supelco). The oven was programmed to hold at an isothermal temperature of 275 °C for a run time of 15 min (9). GC/MS was carried out on a Finnigan Polaris/GCQ PlusTM (9). The column used was a BPX5 (Supelco).

Arabinofuranosyltransferase Activity with Membrane Preparations of C. glutamicum, C. glutamicum{Delta}aftB, and C. glutamicum{Delta}aftB pMSX-Mt-aftB—Membranes were prepared as described previously (19, 24) and resuspended in 50 mM MOPS (pH 7.9) containing 5 mM beta-mercaptoethanol and 10 mM MgCl2 (buffer A) to a final concentration of 15-10 mg/ml. The neoglycolipid acceptors {alpha}-D-Araf-(1 -> 5)-{alpha}-D-Araf-O-C8 (24, 35) (stored in C2H5OH) and DP[14C]A (25, 35) (stored in CHCl3/CH3OH, 2:1, v/v) were separated into aliquots into 1.5-ml Eppendorf tube to a final concentration of 2 mM and 200,000 cpm (90 µM), respectively, and dried under nitrogen. The basic arabinofuranosyltransferase assay was carried out as described previously (24) with modifications. IgePalTM (Sigma-Aldrich) was added (0.1%, v/v) with the appropriate amounts of buffer A (final volume 80 µl). Tubes were sonicated for 15 min to resuspend lipid-linked substrates and then mixed with the remaining assay components, which included membrane protein (1 mg) from either C. glutamicum, C. glutamicum{Delta}aftB, or C. glutamicum{Delta}aftB pMSX-Mt-aftB, 1 mM ATP, 1 mM NADP, and in some cases EMB (0–1 mg/ml). Assays were incubated for 1 h at 37°C and quenched by the addition of 533 µl of CHCl3/CH3OH (1:1, v/v). After mixing and centrifugation at 27,000 x g for 15 min at 4 °C, the supernatant was removed and dried under nitrogen. The residue was then resuspended in 700 µl of CH3CH2OH/H2O (1:1, v/v) and loaded onto a 1-ml Sep-Pak strong anion exchange cartridge (Supelco) preequilibrated with CH3CH2OH/H2O (1:1, v/v). The column was washed with 2 ml of CH3CH2OH, and the eluate was collected, dried, and partitioned between the two phases arising from a mixture of n-butanol (3 ml) and water (3 ml). The resulting organic phase was recovered after centrifugation at 3500 x g, and the aqueous phase was again extracted twice with 3 ml of water-saturated n-butanol. The pooled extracts were back-washed twice with n-butanol-saturated water (3 ml). The n-butanol fraction was dried and resuspended in 200 µl of butanol. The extracted radiolabeled material was quantified by liquid scintillation counting using 10% of the labeled material and 5 ml of EcoScintA (National Diagnostics, Atlanta, GA). The incorporation of [14C]Araf was determined by subtracting counts present in control assays (incubations in the absence of acceptor). The remaining labeled material was subjected to TLC using silica gel plates (5735 silica gel 60F254, Merck) developed in CHCl3:CH2OH:H2O:NH4OH (65:25:3.6:0.5, v/v/v/v). TLC autoradiograms were obtained by exposing TLCs to Kodak X-Omat film for 3 days.

Characterization of Arabinofuranosyltransferase Products A and B Formed with Membranes Prepared from C. glutamicum and C. glutamicum{Delta}aftB—Large-scale reaction mixtures containing cold DPA (200 µg, 0.75 mM) (24) and 50 mM concentrations of the acceptor {alpha}-D-Araf-(1 -> 5)-{alpha}-D-Araf-O-C8 were mixed and given an initial incubation at 37 °C with membranes prepared from either C. glutamicum (EMB was also added to reaction mixtures at a concentration of 100 µg/ml) or C. glutamicum{Delta}aftB for 1 h. The assays were replenished with fresh membranes (1 mg) and re-incubated for 1 h at 37°C with the entire process repeated three times. Products were extracted from reaction mixtures by n-butanol/water phase separation as described earlier to extract products. Products were applied to preparative TLC plates, developed in CHCl3: CH3OH:H2O:NH4OH (65:25:3.6:0.5, v/v/v/v), and sprayed with 0.01% 1,6-diphenylhexatriene in petroleum ether:acetone (9:1, v/v), and the products were localized under long wave (366 nm) UV light (24). The plate was then re-developed in toluene to remove the reagent, and the bands were recovered from the plates by extraction with n-butanol. The butanol phases were washed with water saturated with n-butanol, and the dried products were subjected to 1H NMR, ES-MS and GC/MS as previously described (24).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Genome Comparison of the Rv3805c Locus—We recently identified AftA as a novel arabinofuranosyltransferase present in Corynebacterianeae (19). Based on the fact that AftA is present in a highly conserved cell wall locus (19), we concentrated our studies to identify other cell wall related genes and subsequently identified Rv3805c (Fig. 1A), which is located in close proximity to the antigen 85 complex-encoding genes fbpA and fbpD (36). Furthermore, Rv3805c is likely to form an operon together with ubiA, which is required for prenyl transfer to 5-phosphoribose pyrophosphate to form decaprenylphosphoryl-5-phosphoribose before conversion to DPA (27, 28) and glfT, which is responsible for establishing the galactan backbone of AG (20, 21). The apparent fundamental function of aftB is indicated by the fact that the genome organization of this particular region is syntenic in Corynebacterianeae, including all Mycobacterium and Corynebacterium species analyzed to date (see Fig. 1A), and also in Nocardia farcinica IFM 10152 and Rhodococcus sp. RHA1.

The gene product of Rv3805c, termed AftB, is predicted to form nine transmembrane (TM)-spanning helixes in its N-terminal part, whereas a 237-amino acid C-terminal part is directed toward the periplasm (see Fig. 1C). Interestingly, AftB shows no obvious sequence similarity to the previously identified arabinofuranosyltransferases, such as Emb (9) and AftA (19), although the topology, with the C terminus directed toward the periplasmic side, is to some degree comparable. However, the similarity of the AftB proteins among each other is very high, even for the most distant pairs, M. tuberculosis and C. diphtheriae, exhibiting 33% identity over the entire length of the proteins. Even stronger conservation is found in the first periplasmic loop region (Fig. 1B), exhibiting a modified motif of the GT-C superfamily of glycosyltransferases consisting of two adjacent aspartic acid residues (29). Also, the periplasmic loop regions after helix V and VII are strongly conserved, which may play a role in presenting the nascent arabinose domain to the catalytic glycosyltransferase site. Taken together, the features of AftB and the locus where the gene is localized suggests that it represents a glycosyltransferase involved in AG biosynthesis.

Construction and Growth of C. glutamicum{Delta}aftB—In an attempt to delete aftB in C. glutamicum, the non-replicative plasmid pK19mobsacB{Delta}aftB was constructed carrying sequences adjacent to Cg-aftB. The vector was introduced into C. glutamicum, and in several electroporation assays kanamycin-resistant clones were obtained, indicating integration of pK19mobsacB{Delta}aftB into the genome by homologous recombination (Fig. 2A). The sacB gene enables for positive selection of a second homologous recombination event, which can result either in the original wild type genomic organization or in clones deleted of aftB (34). Forty-eight clones exhibiting the desired phenotype of vector-loss (KanS, SucR) were analyzed by PCR, and 21 of them were found to have Cg-aftB excised. These numbers indicate that the loss of Cg-aftB is apparently not a serious disadvantage for viability, in contrast with Cg-aftA, where deletion was rather difficult to obtain (19). As a result, one clone was subsequently termed C. glutamicum{Delta}aftB and confirmed by PCR to have Cg-aftB deleted, whereas controls with C. glutamicum wild type and genes adjacent to Cg-aftB resulted in the expected amplification products (Fig. 2A).


Figure 1
View larger version (38K):
[in this window]
[in a new window]

  		FIGURE 1.
Comparison of the aftB locus within Corynebacterianeae. A, the locus consists in M. tuberculosis (M. tub.) of aftB with the upstream-located ubiA gene product catalyzing prenylation of 5-phosphoribose pyrophosphate (26, 27) and the known galactofuranosyltransferase glfT (20, 21) and UDP-Galp mutase enzyme glf (45). Downstream of aftB the genes fbpA and fbpD are located which encode mycolyltransferases for decoration of the terminal arabinose residues with mycolic acids (6, 36). The organization of these genes is largely retained in a number of Corynebacterianeae indicative for a basic functional unit. In N. farcinica (N. far.), a third paralogous mycolyltransferase is present, and in C. glutamicum (C. glu.) a transposon is inserted between the two mycolyltransferases. Orthologous genes are shaded accordingly. The M. tuberculosis region derived from NC_000962 extends from nucleotide 4,262,896 to 4,272,896. M. bov., Mycobacterium bovis; M. av. p., Mycobacterium avium paratuberculosis; M. lep., Mycobacterium leprae; R. spe., Rhodococcus sp. RHA1; C. eff., Corynebacterium efficiens; C. dip., Corynebacterium diphtheriae. B, partial sequence comparison of the first loop region of AftB. The conserved charged residues possibly involved in glycosyltransferase activity are shaded in gray, and the adjacent aspartate residues possibly directly involved in glycosyl transfer are in white on a black background (29). On top are the predicted structural properties of the peptide, with E indicating the beta-sheet and H indicating the {alpha}-helix structure. The abbreviations are as above. C, topology of Mt-AftB based on dense alignment surface analysis (46). The membrane spanning helixes are given in roman numbers, and their aminoacyl residues are in arabic.

 


Figure 2
View larger version (59K):
[in this window]
[in a new window]

  		FIGURE 2.
Construction and characteristics of C. glutamicum{Delta}aftB. A, genomic illustration of Cg-aftB with its adjacent genes ubiA and cmt2, which is the orthologue of mycobacterial fbpA (Fig. 1A), and the strategy to delete Cg-aftB using the deletion vector pK19mobsacB{Delta}aftB. This vector carries 18 nucleotides of the 5'-end of Cg-aftB and 36 nucleotides of its 3'-end thereby enabling the in-frame deletion of almost the entire Cg-aftB gene. The arrows marked P2 locate the primers used for the PCR analysis to confirm the absence of Cg-aftB. Primers P1 were used to detect ubiA and P3 to detect cmt2. Distances are not drawn to scale. The results of the PCR analysis are shown on the right, where the results obtained with the corresponding primer pairs are marked accordingly. Samples were applied pairwise with the amplification products obtained from the wild type (WT) applied in the left lane and that of the deletion mutant in the right lane. St marks the standard, where the arrowheads are located at 10, 3, 2, 1, and 0.5 kilobases. B, phenotype of C. glutamicum{Delta}aftB cells spread on brain heart infusion medium and incubated for 3 days. On the left is shown wild type C. glutamicum (Cg-WT), and on the right is the deletion mutant C. glutamicum{Delta}aftB (Cg-{Delta}aftB). The picture shows an area of about 1.5 cm2.

 
Growth of wild type C. glutamicum and C. glutamicum{Delta}aftB were compared in brain heart infusion medium as well as salt medium CGXII (32). Both strains exhibited comparable growth rates, and the final cell densities reached were comparable (data not shown). Single colonies of the deletion mutant appeared less glossy. In streak-outs on brain heart infusion plates the surface of the deletion mutant appeared rough with a coarsely granular surface, as compared with wild type C. glutamicum (Fig. 2B). Taken together C. glutamicum{Delta}aftB possesses only a slight growth defect under the conditions assayed, indicating a degree of tolerance to the deletion of Cg-aftB. Complementation of C. glutamicum{Delta}aftB with either pMSX-Cg-aftB or pMSX-Mt-aftB restored the mutant to a wild type phenotype. For the purpose of significance, C. glutamicum{Delta}aftB complemented with Mt-aftB was used throughout this investigation to study the corresponding mutant phenotype; however, similar results were also obtained with C. glutamicum{Delta}aftB complemented with Cg-aftB (data not shown).


Figure 3
View larger version (50K):
[in this window]
[in a new window]

  		FIGURE 3.
Quantitative analysis of extractable [14C]lipids from C. glutamicum, C. glutamicum{Delta}aftB, and C. glutamicum{Delta}aftB pMSX-Mt-aftB. Lipids were extracted from cells by a series of organic washes as described under "Experimental Procedures." An aliquot (25,000 cpm) from each strain was subjected to TLC using silica gel plates (5735 silica gel 60F254, Merck) developed in CHCl3/CH3OH/H2O (60:16:2, v/v/v) and either charred using 5% molybdophosphoric acid in ethanol at 100 °C to reveal the extracted lipids and compared with known standards (9, 16) or quantified using phosphorimaging after exposure to Kodak X-Omat film for 24 h. The TLC-autoradiogram is representative of three independent experiments. Lane 1, C. glutamicum; lane 2, C. glutamicum{Delta}aftB; lane 3, C. glutamicum{Delta}aftB pMSX-Mt-aftB.

 
Cell Wall-associated and Bound Corynomycolic Acid Analysis—Our initial qualitative investigations involved the analysis of cell wall-associated lipids and bound CMAMEs TLC analysis. Analysis of free lipids from other previously identified cell wall mutants, such as C. glutamicum{Delta}emb (9) and C. glutamicum{Delta}aftA (19), highlighted an apparent increase in trehalose monocorynomycolate (TMCM), indicating a defect in cell wall biosynthesis. This phenotype was also consistently observed for the aftB deletion mutant in several independent experiments (data not shown). In addition, we also compared quantitatively through [14C]acetate labeling of cultures and equal loading of radioactivity the extractable free lipids from C. glutamicum, C. glutamicum{Delta}aftB, and the complemented C. glutamicum{Delta}aftB pMSX-Mt-aftB strains. Typically, C. glutamicum exhibited the known free lipid profile for wild type C. glutamicum, including phospholipids (3945 cpm), TMCM (3217 cpm), trehalose dicorynomycolate (TDCM) (8619 cpm), and non-polar lipids migrating at the solvent front (8753 cpm) (Fig. 3, lane 1). In contrast, after equivalent loading of radioactivity and quantitative analysis by phosphorimaging analyzes, C. glutamicum{Delta}aftB possessed an approximate significant 3-fold increase in TMCM (10185 cpm) and a decrease in TDCM (6539 cpm), phospholipids (1275 cpm), and nonpolar lipids (5439 cpm) (Fig. 3, lane 2). Complementation of C. glutamicum{Delta}aftB with pMSX-Mt-aftB reverted the deletion mutant back to a phenotype similar to the wild type, TMCM (3331 cpm), TDCM (9123 cpm), phospholipids (4011 cpm), and non-polar lipids (8901 cpm) (Fig. 3, lane 3). To relate the above growth phenotypic changes of C. glutamicum{Delta}aftB to its cellular composition, C. glutamicum{Delta}aftB and C. glutamicum{Delta}aftB pMSX-Mt-aftB along with wild type C. glutamicum were analyzed for arabinogalactan-esterified corynomycolic acids released from the above 14C-delipidated cells. As expected, the wild type exhibited a typical profile of CMAMEs (Fig. 4, lane 1, 28,562 cpm), whereas these products were significantly reduced in C. glutamicum{Delta}aftB (Fig. 4, lane 2, 8,947 cpm). In addition, complementation of C. glutamicum{Delta}aftB with pMSX-Mt-aftB (Fig. 4, lane 3, 27,523 cpm) led to the restoration of normal "levels" of cell wall-bound corynomycolic acids. These results suggested that Mt-aftB was involved in a key aspect of arabinan biosynthesis whereby deletion perturbs tethering of corynomycolic acids to AG but not as severely as in C. glutamicum{Delta}emb and C. glutamicum{Delta}aftA mutants (9, 19).


Figure 4
View larger version (60K):
[in this window]
[in a new window]

  		FIGURE 4.
Quantitative analysis [14C]CMAMEs from C. glutamicum, C. glutamicum{Delta}aftB, and C. glutamicum{Delta}aftB pMSX-Mt-aftB. The bound [14C]corynomycolic acids from 14C-delipidated extracts were released by the addition of tetra-butyl ammonium hydroxide at 100 °C overnight and methylated as described under "Experimental Procedures." A 5% aliquot from each strain was subjected to TLC using silica gel plates (5735 silica gel 60F254, Merck) developed in petroleum ether/acetone (95:5, v/v) and either charred using 5% molybdophosphoric acid in ethanol at 100 °C to reveal [14C]CMAMEs and compared with known standards (9, 16) or quantified using phosphorimaging after exposure to Kodak X-Omat film for 24 h. The TLC autoradiogram is representative of three independent experiments. Lane 1, C. glutamicum; lane 2, C. glutamicum{Delta}aftB; lane 3, C. glutamicum{Delta}aftB pMSX-Mt-aftB.

 
Cell Wall Glycosyl Compositional and Linkage Analysis of Cell Walls—Alditol acetate derivatives of highly purified mAGP from C. glutamicum, C. glutamicum{Delta}aftB, and C. glutamicum{Delta}aftB pMSX-Mt-aftB were prepared for glycosyl compositional analysis. All strains exhibited a similar Ara:Gal ratio of 3.7:1. However, glycosyl linkage analysis of per-O-methylated alditol acetate derivatives of mAGP extracted from these strains highlighted an obvious difference in linkage profiles (Fig. 5). All glycosyl linkages could be accounted for in wild type C. glutamicum (Fig. 5A) as described previously (9, 19); however, mAGP from C. glutamicum{Delta}aftB was devoid of beta(1 -> 2) Araf linkages (Fig. 5B). Complementation of C. glutamicum{Delta}aftB with pMSX-Mt-aftB restored the beta(1 -> 2) Araf linkage, thus reverting the deletion mutant to a wild type phenotype (Fig. 5C). Further to this, we analyzed the cell wall glycosyl composition of C. glutamicum{Delta}aftB complemented with either pMSX-Mt-aftB-D29A or pMSX-Mt-aftB-D30A. Each of these complemented stains exhibited a phenotype identical to that of C. glutamicum{Delta}aftB, with a complete loss of 2-Araf linkages (data not shown). As confirmed in Fig. 6 the Mt-AftB muteins are synthesized in vivo, and the failure to establish the beta(1 -> 2) Araf linkage is, therefore, most likely due to a catalytically inactive AftB, thus highlighting the importance of these particular aspartic acid residues in enzyme function.


Figure 5
View larger version (14K):
[in this window]
[in a new window]

  		FIGURE 5.
Glycosyl linkage analysis of cell walls of C. glutamicum (A), C. glutamicum{Delta}aftB (B), C. glutamicum{Delta}aftB pMSX-Mt-aftB (C). Cell walls were per-O-methylated, hydrolyzed using 2 M trifluoroacetic acid, reduced, and per-O-acetylated. The resulting partially per-O-methylated, per-O-acetylated glycosyl derivatives were analyzed by GC/MS as described previously (5, 8, 9). Rha, rhamnose.

 


Figure 6
View larger version (97K):
[in this window]
[in a new window]

  		FIGURE 6.
Formation of Mt-AftB in C. glutamicum. Extracts of C. glutamicum{Delta}aftB expressing His-tagged M. tuberculosis AftB and AftB muteins were subjected to Ni2+-nitrilotriacetic acid chromatography and analyzed by SDS-PAGE. Lane 1, 20 µg of clarified extract of C. glutamicum{Delta}aftB pMSX-Mt-aftB before chromatography. Lanes 2–5 received the entire protein isolated from a 2-liter culture of the respective recombinant strain via Ni2+-nitrilotriacetic acid chromatography, which was ~20µg in each case. Lane 2, C. glutamicum{Delta}aftB pMSX-Mt-aftB; lane 3, C. glutamicum{Delta}aftB pMSX-Mt-aftB-D29A; lane 4, C. glutamicum{Delta}aftB pMSX-Mt-aftB-D30A; lane 5, C. glutamicum{Delta}aftB pMSX (control). Standards (Std) along with their molecular masses in kDa are shown. The expected molecular mass for Mt-AftB is 72 kDa, and the faint band at this location in lanes 2–4 is shown by an arrow and was verified by peptide mass fingerprinting as M. tuberculosis AftB (data not shown).

 
In Vitro Arabinofuranosyltransferase Activity of C. glutamicum, C. glutamicum{Delta}aftB, and C. glutamicum{Delta}aftB pMSX-Mt-aftB—Initial attempts to develop an in vitro assay using either purified recombinant expressed Mt-AftB or E. coli membranes expressing Mt-aftB have thus far proved unsuccessful. As an alternative approach, we assessed the capacity of membrane preparations from C. glutamicum, C. glutamicum{Delta}aftB, and C. glutamicum{Delta}aftB complemented with pMSX-Mt-aftB to catalyze arabinofuranosyltransferase activity in the presence of an exogenous synthetic {alpha}-D-Araf-(1 -> 5)-{alpha}-D-Araf-O-C8, neoglycolipid acceptor (24), and DP[14C]A (35). TLC analysis of the products, when assayed with wild type C. glutamicum membranes, resulted in the formation of two products (A and B) (Fig. 7A) when analyzed by TLC (Fig. 7B). The enzymatic synthesis of products A and B are consistent with our previous studies (24) using mycobacterial membrane preparations resulting in trisaccharide products as a result of the addition of {alpha}(1 -> 5)- and beta(1 -> 2)-linked Araf residues to the disaccharide acceptor (Fig. 7A) (24). The addition of EMB in several experiments, even at high concentrations of up to 1 mg/ml to the reaction mixture, resulted in the complete loss of only product A. However, when assays were performed using membranes prepared from C. glutamicum{Delta}aftB, only a single band migrating to a position akin to that of product A could be observed, and no product formation could be identified upon the addition of 100 µg/ml of EMB (Fig. 7B). Membranes prepared from C. glutamicum{Delta}aftB complemented with pMSX-Mt-aftB restored product A and B formation back to that of the wild type (Fig. 7B), and only product B was synthesized when EMB (up to 1 mg/ml) was added to the reaction mixtures.


Figure 7
View larger version (31K):
[in this window]
[in a new window]

  		FIGURE 7.
Arabinofuranosyltransferase activity in membranes prepared from C. glutamicum, C. glutamicum{Delta}aftB, and C. glutamicum{Delta}aftB pMSX-Mt-aftB. A, biosynthetic reaction scheme of products formed in arabinofuranosyltransferase assays using {alpha}-D-Araf-(1 -> 5)-{alpha}-D-Araf-O-C8. B, arabinofuranosyltransferase activity was determined using the synthetic {alpha}-D-Araf-(1 -> 5)-{alpha}-D-Araf-O-C8 acceptor in a cell-free assay as described previously (24). The products of the assay were resuspended before scintillation counting and subjected to TLC using silica gel plates (5735 silica gel 60F254, Merck) in CHCl3:CH3OH:H2O:NH4OH (65/25/3.6/0.5, v/v/v/v) with the reaction products visualized by autoradiography. DP, decaprenol phosphate.

 
ES-MS and GC/MS Analysis of Product A and B—Newly synthesized products A and B prepared using C. glutamicum treated with EMB and C. glutamicum{Delta}aftB membranes, as described above, were further characterized. ES-MS analysis of the reaction products A (data not shown) and B extracted through preparative TLC (Fig. 8A) revealed a strong molecular ion m/z 549.3 (M + Na+) which corresponds to a trisaccharide product Araf-(1 ->?)-Araf-(1 -> 5)-{alpha}-D-Araf-O-C8. GC/MS analysis of the partially per-O-methylated, per-O-acetylated alditol acetate derivative of product A, synthesized in assays with C. glutamicum{Delta}aftB membranes, revealed the addition of only an {alpha}(1 -> 5)-linked Araf residue (Figs. 8B and 7A) (24). However, GC/MS analysis of the partially per-O-methylated, per-O-acetylated alditol acetate derivative of product B, synthesized in enzyme assays utilizing membranes from C. glutamicum and EMB, identified the new glycosyl linkage as a beta(1 -> 2)-linked Araf residue (Figs. 8C and 7A). By analogy, this new glycosidic linkage corresponds to a terminal beta(1 -> 2)-linked Araf residue (24). These analyses were further confirmed by 1H NMR studies (data not shown) by the assignment of {alpha}(1 -> 5) and beta(1 -> 2) Araf anomeric protons in comparison to the acceptor Araf-(1 -> 5)-{alpha}-D-Araf-O-C8 and are consistent with our previous studies (24). Finally, the results clearly establish both from in vivo and in vitro experiments that Mt-AftB catalyzes the addition of a beta(1 -> 2) Araf unit and that this enzyme is resistant to EMB (Fig. 7B).


Figure 8
View larger version (9K):
[in this window]
[in a new window]

  		FIGURE 8.
ES-MS and GC/MS characterization of products A and B. A, ES-MS analysis of products from assays containing membranes prepared from C. glutamicum treated with EMB and C. glutamicum{Delta}aftB (data not shown). B, GC/MS analysis of the partially per-O-methylated, per-O-acetylated alditol acetate derivative of product A obtained from assays containing membranes prepared from C. glutamicum{Delta}aftB. C, GC/MS analysis of the partially per-O-methylated, per-O-acetylated alditol acetate derivative of product B obtained from assays containing membranes and EMB prepared from C. glutamicum.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The biosynthesis of AG in M. tuberculosis has been the subject of intense research over the past decade (5, 9, 12, 19, 21, 37, 38). Because cell wall biosynthesis is the target for several anti-tubercular agents, such as EMB, the requirement for a complete understanding of the enzymes involved is imperative. We recently identified a unique DPA-dependent {alpha}-D-arabinofuranosyltransferase (AftA) that is responsible for the deposition of the first Araf residue onto the galactan moiety of AG, thus "priming" the polysaccharide for further extension by the Emb proteins (19). However, our current understanding of further downstream arabinan biosynthesis of AG is limited to that of the Emb proteins and is poorly defined (9, 39). M. tuberculosis possesses three Emb proteins encoded within the embCAB operon, of which EmbA and EmbB have been implicated in cell wall arabinan biosynthesis (39), whereas EmbC is involved in lipoarabinomannan biosynthesis (31, 40, 41). The catalytic mechanism of how these enzymes are able to synthesize the array of arabinan glycosidic linkages {alpha}(1 -> 5), {alpha}(1 -> 3), and beta(1 -> 2), present in both M. tuberculosis and C. glutamicum, remains to be elucidated. This catalytic conundrum is further questioned by the fact that members belonging to the Corynebacteria, such as C. glutamicum and C. diphtheriae, contain only a single emb gene (18). Therefore, one might assume that other arabinofuranosyltransferases could be involved in concert with the Emb proteins to build the arabinan domain of AG.

In this study we have identified Rv3805c, which we have termed AftB, as a novel retaining arabinofuranosyltransferase which is likely to form a new family that is distinct from the inverting arabinofuranosyltransferase enzymes (EmbA, -B, -C, and AftA) in GT-83/85 families (42). More precisely, AftB adds to the nonreducing end of the arabinan domain of AG beta(1 -> 2) Araf residues as shown through both in vivo and in vitro experiments. For instance, incubation of membranes prepared from C. glutamicum with DP[14C]A and the disaccharide neoglycolipid acceptor resulted in the appearance of two trisaccharide products (A and B), which equate to the transfer of both {alpha}(1 -> 5) and beta(1 -> 2)Araf residues, respectively. Through further chemical characterization of the products by TLC, ES-MS, and glycosyl linkage analyses, an {alpha}(1 -> 5)-linked trisaccharide product could only be identified in assays conducted with membranes prepared from C. glutamicum{Delta}aftB. This clear loss of beta(1 -> 2)Araf activity corroborates the cell wall analysis of the C. glutamicum{Delta}aftB mutant, where the loss of beta(1 -> 2)-linked Araf residues could also be observed. We also attempted to inhibit AftB activity by incubation of the assay components in the presence of high concentrations of EMB (up to 1 mg/ml), a known inhibitor of the Emb proteins in M. tuberculosis and C. glutamicum. In doing so, analysis of the corresponding products synthesized from C. glutamicum membranes after EMB treatment clearly show evidence of an EMB-resistant beta(1 -> 2) arabinofuranosyltransferase activity and an EMB-sensitive {alpha}(1 -> 5) arabinofuranosyltransferase activity. In addition, since we have previously established that the EMB-resistant AftA introduces the priming Araf residue at the 8th, 10th, and 12th Galf residue of the galactan backbone, it can be concluded that the bulk {alpha}(1 -> 5)Araf stems of AG represent the primary target of EMB. It is interesting to note that EMB resistance is simply not due to AftB being a retaining arabinofuranosyltransferase, in contrast to the inverting arabinofuranosyltransferase Mt-EmbA and Mt-EmbB, since AftA, which is also an inverting arabinofuranosyltransferase, is also EMB resistant (19).


Figure 9
View larger version (19K):
[in this window]
[in a new window]

  		FIGURE 9.
Proposed biosynthetic pathway leading to arabinan formation in M. tuberculosis AG. For reasons of simplicity, it is shown that one of the beta(1 -> 2)-linked Araf residues is added by AftB, whereas the second beta(1 -> 2)-linked Araf residue may be catalyzed by AftB or via an unknown GT-C arabinofuranosyltransferase, presumably closely related to AftB. Mycolylation is shown to occur after the final step of introducing both terminal beta(1 -> 2)-linked Araf residues of AG. However, mycolylation at the {alpha}(1 -> 5)-linked Araf residue may occur before completion or simultaneously during establishment of the unique Ara6 motif of AG in M. tuberculosis. In addition, mycolylation of the penultimate Araf residue may also occur before thebeta(1 -> 2)-linked Araf residue is attached. DP, decaprenol phosphate.

 
A modified scheme for terminal cell wall arabinan biosynthesis in Corynebacterianeae is presented in Fig. 9. It is possible that the AftB protein is responsible for the successive addition of two beta(1 -> 2) Araf residues at a 3,5-Araf-branched residue. Although this may be a reasonable inference from the in vivo structural work with the aftB deletion strain, it has not been completely verified by our in vitro assay. Therefore, it is formally possible that the AftB-dependent addition of one beta(1 -> 2) Araf residue is required before a second GT-C-related arabinofuranosyltransferase adds the second terminal beta(1 -> 2) Araf residue as shown in Fig. 9.

The arabinofuranosyltransferases of the Emb family (EmbC, EmbA, and EmbB) (12, 13, 31, 39) and AftA (19) and AftB possess some sequence similarity. This relates to a modified glycosyltransferase motif, which is defined in the GT-C glycosyltransferase superfamily as either DXD, EXD, DDX, or DEX (29). The most distant is probably AftA with only one negatively charged D residue, however, possessing an adjacent polar Gln residue (19). In AftB there are two adjacent Asp residues (Fig. 1B), which due to our mutational study are likely to be directly involved in glycosyl hydrolysis and transfer. Also, the high number of charged aminoacyl residues of the strongly conserved loop region after the first TM helix might contribute to the proper orientation of substrates at the catalytic center. The glycosyltransferase motif of arabinofuranosyltransferases so far identified is always located in a periplasmic loop region, which connects TM III-IV in EmbC, TM III-IV in AftA, and TM I-II in AftB (Fig. 1B). A further feature common of the Emb, AftA, and AftB proteins is that they consist of an N-terminal region, which has a number of hydrophobic segments spanning the TM, and a large C-terminal domain, which in Emb has been demonstrated to be located toward the periplasmic side (30). The number of TMs is different among these proteins, but the involvement of these TMs could be considered as important for the translocation of DPA, the lipid-linked substrate of these glycosyltransferases. The weak structural identities of the membrane-embedded part of the arabinofuranosyltransferases indicate that transport and presentation of DPA to the catalytic site might be different for these enzymes. A Pro-motif, as identified in the Emb proteins (31), is not present in AftB and AftA. This motif is typical for polysaccharide co-polymerases and is assumed to control the chain length in polysaccharide biosynthesis. Its absence in AftA and AftB seems plausible, since these enzymes add only singular Araf residues, but the Emb proteins presumably add a number of {alpha}((1 -> 5)-linked Araf residues to form the inner chain of the AG domain.

It is noteworthy that deletion of aftB in C. glutamicum results in only a weak phenotype (Fig. 2B). In M. tuberculosis mycolic acids are attached to the terminal beta(1 -> 2)Araf and penultimate {alpha}(1 -> 5)Araf residue of the Ara6 motif of AG (6). This appears to be similar in C. glutamicum, since in the absence of terminal beta(1 -> 2) Araf residues mycolic acids are still bound to AG, thus emphasizing in this respect the cell wall similarity of these bacteria. However, in C. glutamicum a maximal 5% of the mycolic acids are covalently attached to AG (43), whereas this value is about 10% in M. tuberculosis (6). The fact that the aftB deletion mutant of C. glutamicum possesses less AG-bound mycolic acids also results in an increased abundance of TMCM. This situation can be entirely different in M. tuberculosis due to the essentiality of aftB in M. tuberculosis (44) and requires further investigation.

We conclude that AftB represents a novel arabinofuranosyltransferase in Corynebacterianeae, such as M. tuberculosis, which is responsible for the addition of the terminal beta(1 -> 2)-linked Araf residues. In doing so, we now propose a contemporary revision of cell wall arabinan biosynthesis (Fig. 9), which may aid in a more detailed understanding of the pathogenicity and persistence of M. tuberculosis.


   FOOTNOTES
 
* This work was supported by the Medical Research Council (UK), the Wellcome Trust, and by the Fonds der Chemischen Industrie for support (to H. S.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 These authors contributed equally to this work. Back

2 A Biotechnology and Biological Sciences Research Council Quota student. Back

3 To whom correspondence should be addressed. Tel.: 121-415-8125; Fax: 121-414-5925; E-mail: g.besra{at}bham.ac.uk.

4 The abbreviations used are: AG, arabinogalactan; Ara, arabinose; CMAME, corynomycolic acid methyl ester; DPA, decaprenol phosphoarabinose; EMB, ethambutol; Gal, galactose; GC, gas chromatography; MS, mass spectrometry; mAGP, mycolyl-arabinogalactan-peptidoglycan; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; TM, transmembrane; MOPS, 4-morpholinepropanesulfonic acid; ES, electrospray; TMCM, trehalose monocorynomycolate; TDCM, trehalose dicorynomycolate. Back

5 G. S. Besra, unpublished results. Back


   ACKNOWLEDGMENTS
 
M. tuberculosis H37Rv DNA was obtained from the Tuberculosis Research Materials Contract (National Institutes of Health) at Colorado State University. We thank Graham Burns for technical assistance. Support is acknowledged in the form of a Personal Research Chair from James Bardrick, a former Lister Institute-Jenner Research Fellow.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gupta, R., Kim, J. Y., Espinal, M. A., Caudron, J. M., Pecoul, B., Farmer, P. E., and Raviglione, M. C. (2001) Science 293, 1049–1051[Free Full Text]
  2. Zignol, M., Hosseini, M. S., Wright, A., Weezenbeek, C. L., Nunn, P., Watt, C. J., Williams, B. G., and Dye, C. (2006) J. Infect. Dis. 194, 479–485[CrossRef][Medline] [Order article via Infotrieve]
  3. Singh, J. A., Upshur, R., and Padayatchi, N. (2007) PLoS Med. 4, e50[CrossRef][Medline] [Order article via Infotrieve]
  4. McNeil, M., Daffe, M., and Brennan, P. J. (1990) J. Biol. Chem. 265, 18200–18206[Abstract/Free Full Text]
  5. Besra, G. S., Khoo, K. H., McNeil, M. R., Dell, A., Morris, H. R., and Brennan, P. J. (1995) Biochemistry 34, 4257–4266[CrossRef][Medline] [Order article via Infotrieve]
  6. McNeil, M., Daffe, M., and Brennan, P. J. (1991) J. Biol. Chem. 266, 13217–13223[Abstract/Free Full Text]
  7. Chatterjee, D., Bozic, C. M., McNeil, M., and Brennan, P. J. (1991) J. Biol. Chem. 266, 9652–9660[Abstract/Free Full Text]
  8. Daffe, M., Brennan, P. J., and McNeil, M. (1990) J. Biol. Chem. 265, 6734–6743[Abstract/Free Full Text]
  9. Alderwick, L. J., Radmacher, E., Seidel, M., Gande, R., Hitchen, P. G., Morris, H. R., Dell, A., Sahm, H., Eggeling, L., and Besra, G. S. (2005) J. Biol. Chem. 280, 32362–32371[Abstract/Free Full Text]
  10. Minnikin, D. E., Kremer, L., Dover, L. G., and Besra, G. S. (2002) Chem. Biol. 9, 545–553[CrossRef][Medline] [Order article via Infotrieve]
  11. Takayama, K., and Kilburn, J. O. (1989) Antimicrob. Agents Chemother. 33, 1493–1499[Abstract/Free Full Text]
  12. Belanger, A. E., Besra, G. S., Ford, M. E., Mikusova, K., Belisle, J. T., Brennan, P. J., and Inamine, J. M. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 11919–11924[Abstract/Free Full Text]
  13. Telenti, A., Philipp, W. J., Sreevatsan, S., Bernasconi, C., Stockbauer, K. E., Wieles, B., Musser, J. M., and Jacobs, W. R., Jr. (1997) Nat. Med. 3, 567–570[CrossRef][Medline] [Order article via Infotrieve]
  14. Winder, F. G., and Collins, P. B. (1970) J. Gen. Microbiol. 63, 41–48[Abstract/Free Full Text]
  15. Banerjee, A., Dubnau, E., Quemard, A., Balasubramanian, V., Um, K. S., Wilson, T., Collins, D., de Lisle, G., and Jacobs, W. R., Jr. (1994) Science 263, 227–230[Abstract/Free Full Text]
  16. Gande, R., Gibson, K. J., Brown, A. K., Krumbach, K., Dover, L. G., Sahm, H., Shioyama, S., Oikawa, T., Besra, G. S., and Eggeling, L. (2004) J. Biol. Chem. 279, 44847–44857[Abstract/Free Full Text]
  17. Portevin, D., De Sousa-D'Auria, C., Houssin, C., Grimaldi, C., Chami, M., Daffe, M., and Guilhot, C. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 314–319[Abstract/Free Full Text]
  18. Kalinowski, J., Bathe, B., Bartels, D., Bischoff, N., Bott, M., Burkovski, A., Dusch, N., Eggeling, L., Eikmanns, B. J., Gaigalat, L., Goesmann, A., Hartmann, M., Huthmacher, K., Kramer, R., Linke, B., McHardy, A. C., Meyer, F., Mockel, B., Pfefferle, W., Puhler, A., Rey, D. A., Ruckert, C., Rupp, O., Sahm, H., Wendisch, V. F., Wiegrabe, I., and Tauch, A. (2003) J. Biotechnol. 104, 5–25[CrossRef][Medline] [Order article via Infotrieve]
  19. Alderwick, L. J., Seidel, M., Sahm, H., Besra, G. S., and Eggeling, L. (2006) J. Biol. Chem. 281, 15653–15661[Abstract/Free Full Text]
  20. Mikusova, K., Yagi, T., Stern, R., McNeil, M. R., Besra, G. S., Crick, D. C., and Brennan, P. J. (2000) J. Biol. Chem. 275, 33890–33897[Abstract/Free Full Text]
  21. Kremer, L., Dover, L. G., Morehouse, C., Hitchin, P., Everett, M., Morris, H. R., Dell, A., Brennan, P. J., McNeil, M. R., Flaherty, C., Duncan, K., and Besra, G. S. (2001) J. Biol. Chem. 276, 26430–26440[Abstract/Free Full Text]
  22. Radmacher, E., Stansen, K. C., Besra, G. S., Alderwick, L. J., Maughan, W. N., Hollweg, G., Sahm, H., Wendisch, V. F., and Eggeling, L. (2005) Microbiology 151, 1359–1368[Abstract/Free Full Text]
  23. Wolucka, B. A., McNeil, M. R., de Hoffmann, E., Chojnacki, T., and Brennan, P. J. (1994) J. Biol. Chem. 269, 23328–23335[Abstract/Free Full Text]
  24. Lee, R. E., Brennan, P. J., and Besra, G. S. (1997) Glycobiology 7, 1121–1128[Abstract/Free Full Text]
  25. Lee, R. E., Mikusova, K., Brennan, P. J., and Besra, G. S. (1995) J. Am. Chem. Soc. 117, 11829–11832[CrossRef]
  26. Alderwick, L. J., Dover, L. G., Seidel, M., Gande, R., Sahm, H., Eggeling, L., and Besra, G. S. (2006) Glycobiology 16, 1073–1081[Abstract/Free Full Text]
  27. Huang, H., Scherman, M. S., D'Haeze, W., Vereecke, D., Holsters, M., Crick, D. C., and McNeil, M. R. (2005) J. Biol. Chem. 280, 24539–24543[Abstract/Free Full Text]
  28. Mikusova, K., Huang, H., Yagi, T., Holsters, M., Vereecke, D., D'Haeze, W., Scherman, M. S., Brennan, P. J., McNeil, M. R., and Crick, D. C. (2005) J. Bacteriol. 187, 8020–8025[Abstract/Free Full Text]
  29. Liu, J., and Mushegian, A. (2003) Protein Sci. 12, 1418–1431[CrossRef][Medline] [Order article via Infotrieve]
  30. Seidel, M., Alderwick, L. J., Sahm, H., Besra, G. S., and Eggeling, L. (2007) Glycobiology 17, 210–219[Abstract/Free Full Text]
  31. Berg, S., Starbuck, J., Torrelles, J. B., Vissa, V. D., Crick, D. C., Chatterjee, D., and Brennan, P. J. (2005) J. Biol. Chem. 280, 5651–5663[Abstract/Free Full Text]
  32. Eggeling, L., and Reyes, O. (2005) Handbook of Corynebacterium glutamicum (Eggeling, L., and Bott, M., eds) pp. 535–566, CRC Press, Inc., Boca Raton, FL
  33. Eikmanns, B. J., Kleinertz, E., Liebl, W., and Sahm, H. (1991) Gene (Amst.) 102, 93–98[CrossRef][Medline] [Order article via Infotrieve]
  34. Schafer, A., Tauch, A., Jager, W., Kalinowski, J., Thierbach, G., and Puhler, A. (1994) Gene (Amst.) 145, 69–73[CrossRef][Medline] [Order article via Infotrieve]
  35. Lee, R. E., Brennan, P. J., and Besra, G. S. (1998) Bioorg. Med. Chem. Lett. 8, 951–954[CrossRef][Medline] [Order article via Infotrieve]
  36. Belisle, J. T., Vissa, V. D., Sievert, T., Takayama, K., Brennan, P. J., and Besra, G. S. (1997) Science 276, 1420–1422[Abstract/Free Full Text]
  37. Daffe, M., McNeil, M., and Brennan, P. J. (1993) Carbohydr. Res. 249, 383–398[CrossRef][Medline] [Order article via Infotrieve]
  38. Berg, S., Kaur, D., Jackson, M., and Brennan, P. J. (2007) Glycobiology Advanced Access, Jan 29, 2007
  39. Escuyer, V. E., Lety, M. A., Torrelles, J. B., Khoo, K. H., Tang, J. B., Rithner, C. D., Frehel, C., McNeil, M. R., Brennan, P. J., and Chatterjee, D. (2001) J. Biol. Chem. 276, 48854–48862[Abstract/Free Full Text]
  40. Zhang, N., Torrelles, J. B., McNeil, M. R., Escuyer, V. E., Khoo, K. H., Brennan, P. J., and Chatterjee, D. (2003) Mol. Microbiol. 50, 69–76[CrossRef][Medline] [Order article via Infotrieve]
  41. Shi, L., Berg, S., Lee, A., Spencer, J. S., Zhang, J., Vissa, V., McNeil, M. R., Khoo, K. H., and Chatterjee, D. (2006) J. Biol. Chem. 281, 19512–19526[Abstract/Free Full Text]
  42. Coutinho, P. M., and Henrissat, B. (1999) in Recent Advances in Carbohydrate Bioengineering (Gilbert, H. J., Davies, G., Henrissat, B., and Svensson, B., eds) The Royal Society of Chemistry, Cambridge, UK
  43. Puech, V., Chami, M., Lemassu, A., Laneelle, M. A., Schiffler, B., Gounon, P., Bayan, N., Benz, R., and Daffe, M. (2001) Microbiology 147, 1365–1382[Abstract/Free Full Text]
  44. Sassetti, C. M., Boyd, D. H., and Rubin, E. J. (2003) Mol. Microbiol. 48, 77–84[CrossRef][Medline] [Order article via Infotrieve]
  45. Pan, F., Jackson, M., Ma, Y., and McNeil, M. (2001) J. Bacteriol. 183, 3991–3998[Abstract/Free Full Text]
  46. Cserzo, M., Wallin, E., Simon, I., von Heijne, G., and Elofsson, A. (1997) Protein Eng. 10, 673–676[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Bacteriol.Home page
A. K. Mishra, S. Batt, K. Krumbach, L. Eggeling, and G. S. Besra
Characterization of the Corynebacterium glutamicum {Delta}pimB' {Delta}mgtA Double Deletion Mutant and the Role of Mycobacterium tuberculosis Orthologues Rv2188c and Rv0557 in Glycolipid Biosynthesis
J. Bacteriol., July 1, 2009; 191(13): 4465 - 4472.
[Abstract] [Full Text] [PDF]

Home page
 MicrobiologyHome page
X. Meniche, C. de Sousa-d'Auria, B. Van-der-Rest, S. Bhamidi, E. Huc, H. Huang, D. De Paepe, M. Tropis, M. McNeil, M. Daffe, et al.
Partial redundancy in the synthesis of the D-arabinose incorporated in the cell wall arabinan of Corynebacterineae
Microbiology, August 1, 2008; 154(8): 2315 - 2326.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Bhamidi, M. S. Scherman, C. D. Rithner, J. E. Prenni, D. Chatterjee, K.-H. Khoo, and M. R. McNeil
The Identification and Location of Succinyl Residues and the Characterization of the Interior Arabinan Region Allow for a Model of the Complete Primary Structure of Mycobacterium tuberculosis Mycolyl Arabinogalactan
J. Biol. Chem., May 9, 2008; 283(19): 12992 - 13000.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
M. Belanova, P. Dianiskova, P. J. Brennan, G. C. Completo, N. L. Rose, T. L. Lowary, and K. Mikusova
Galactosyl Transferases in Mycobacterial Cell Wall Synthesis
J. Bacteriol., February 1, 2008; 190(3): 1141 - 1145.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/20/14729    most recent
M700271200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seidel, M.
Right arrow Articles by Besra, G. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seidel, M.
Right arrow Articles by Besra, G. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement