|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 282, Issue 20, 15159-15169, May 18, 2007
A Putative Src Homology 3 Domain Binding Motif but Not the C-terminal Dystrophin WW Domain Binding Motif Is Required for Dystroglycan Function in Cellular Polarity in Drosophila*
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
When the interactions between components of the Dg·Dys complex are disrupted, the muscle degenerative disease muscular dystrophy (MD) results (3-5). In mouse models, loss of Dg in muscle cells causes mild muscular dystrophy phenotypes (6). Furthermore, several human forms of MD, such as Fukuyama MD, result from mutations in the enzymes that glycosylate Dg. In addition to its role in maintaining the structural integrity of muscle cell membranes, Dg is also required in the brain. When it is knocked out in the mouse brain, disrupted neural migration and disorganized cortical layers are observed (7, 8). This is consistent with the fact that brain malformations as well as learning and memory difficulties are often observed in MD patients (9-12). Dg is not only important in the pathogenesis of MD and the associated brain malformations, but it also has an important role in cell adhesions and anchoring the cell to the extracellular matrix. Loss of Dg protein has been associated with the progression of various epithelial cancers (2, 13). Specifically, Dg is down-regulated in breast and prostate cancers (14, 15).
In vitro studies have suggested that the interaction between Dg and Dys is mediated by the most C-terminal WW domain binding motif, PPXY, on Dg and the Dys WW and EF-hand domains (16-18). In vitro experiments have also shown that when the tyrosine of the PPXY motif is phosphorylated, the binding between Dg and Dys is abolished (19, 20). This suggests a potential mechanism to regulate the Dg and Dys interaction, in which signaling proteins containing SH2 or SH3 domains may bind to Dg in a tyrosine phosphorylation-dependent manner. In the search for a potential regulator, recent studies have revealed several proteins that interact with Dg. Both the Grb2 (growth factor receptor-bound protein 2) adaptor protein, as well as MEK1, and ERK of the Ras-Raf mitogen-activated protein kinase (MAPK) cascade have been shown to interact, in vitro and in vivo, with the C terminus of Dg (21, 22). However, Dg appears to be only an anchor for MEK1 and ERK rather than a substrate (22), and Dg might not have a direct involvement in this signaling pathway. Independently, recent work has revealed that laminin and dystroglycan-dependent phosphorylation of syntrophin affects the Grb2-SOS-Rac1-c-Jun N-terminal kinase (JNK) pathway and ultimately results in the phosphorylation of c-Jun on Ser-65 (23). Thus, although studies suggest a clear role for Dg in signaling, the regulation of Dg by signaling and the specific regions of the Dg C terminus involved in this process are unknown.
To shed light on the regulation of Dg and its role in signaling, we have analyzed the binding motifs that are required for the function of the Dg·Dys complex in cellular polarity in Drosophila. The proline-rich C terminus of Dg has several potential protein-binding motifs, which suggests that it may be involved in regulating the complex and potentially may have a signaling role. Proline-rich sequences have been shown to be the targets of several protein interaction domains involved in signal transduction. For example, SH3 domains have been shown to bind core PXXP motifs (where P is proline and X indicates any amino acid). Drosophila Dg contains two putative SH3-binding sites, consisting of the core PXXP motif. Proline-rich sequences also serve as targets for binding by WW domains (24). In particular, the class I WW domain ligand, PPXY (where Y is tyrosine), appears twice in the C-terminal region of Dg. The more C-terminal PPXY motif has been established as a binding site for the WW domain of dystrophin in humans (17, 18) and in Drosophila by in vitro binding studies (25). The role of a putative second, more N-terminal WW domain binding site or the potential SH3 domain binding sites are not yet understood.
Drosophila is an excellent system to study the Dg·Dys complex (25-29). In particular, Dg is required for cellular polarity in the oocyte and epithelial cells in Drosophila as well as in mouse mammary epithelial cells (26, 30). Furthermore, Drosophila is a model for the MD disease phenotype, as reduction of dystrophin and dystroglycan in the muscles leads to progressive muscle degeneration and loss of muscle function (25). In this study, we test which regions of the Dg C terminus are essential for Dg function in cellular polarity in vivo. Specifically, we show by a single amino acid substitution that a putative SH3 domain binding site is critical for Dg function in both loss-of-function and overexpression studies. However, the most C-terminal WW domain binding site previously shown to be essential for dystrophin binding is dispensable for cellular polarity in Drosophila.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
4-Tub > Gal4-VP16/CyO (33). For overproduction of pUASp-Dg in embryos we used Daughterless-Gal4 (34). For overproduction of pUASp-Dg in the follicle cells, we used hsFlp; act < FRT-CD2-FRT < Gal4; UAS-GFP (35). For generation of dystroglycan clones, we used FRT42D-Dg323/CyO (Dg323 is a dystroglycan loss-of-function mutant with a 3155-bp deletion between bp 32,345 and 35,669 of DS03910) (26) and hsFLP; FRT42D Ubi-GFP/CyO. For overproduction of pUASp-Dg in a dystroglycan mutant background, we used FRT42DDg323/CyO; P(w+ nos-Gal4:VP16)A4-2 III, and hsFLP; FRT42D Ubi-GFP/CyO; pUASp-Dg/TM3 or pUASp-Dg /FM7; FRT42DDg323/CyO, and hsFLP; FRT42D Ubi-GFP/CyO; P(w+ nos-Gal4: VP16)A4-2 III (pUASp-Dg refers to all dystroglycan constructs: FL, C1, C2, 4P, DC2, Pro
Ala, ALLP, AATA). Generation of pUASp-Dg Transgenic AnimalsFull-length and truncated dystroglycan PCR products that can be expressed in the germ line were synthesized from the template LD11619 using the forward primer GGGGTACCAACATGAGATTCCAGTGGTTCT in conjunction with one of the following reverse primers: FL, CTCTAGATTATGGCGACACATATGGCGGT; C1, GCTCTAGATTACTTCTCGTCCTTGAGTATGAC; C2, GCTCTAGATTAATATGGCGGTGGCTTCTCGTCCTTGAGTATAGAC; 4P, GCTCTAGATTATGGCGACACAGGTGGCGGT; DC2, GCTCTAGATTAGTCCACGTCGTTGTCAC (Invitrogen) and cloned into pUASp, a vector that allows efficient germ line expression (36).
To generate a construct with mutated SH3-binding sites (pUASp-2XSH3 knock-out, Pro
Ala), the QuickChange® XL site-directed mutagenesis kit (Stratagene) was used to introduce proline to alanine substitutions in the SH3bsI (PATP
AATA). LD11619 was used as a template with forward primer CGTGGCAAGTCGGCAGCCACGGCCTCTACCGCAAACC and reverse primer GGTTTGCGGTAGGAGGCCGTGGCTGCCGACTTGCCACG, generating the intermediate plasmid pBS-Dg AATA. pBS-Dg AATA then served as a template for PCR with the forward primer GGACGAGAAGCCGGCGCTGCTGCCACCATCCTACAATACC and the reverse primer GGTATTGTAGGATGGTGGCAGCAGCGCCGGCTTCTCGTCC, designed to substitute the first proline of the SH3bsII with an alanine (PLLP
ALLP), thus generating pBS-2XSH3 knockout. This served for the template for standard PCR performed with the forward primer GGGGTACCAACATGACATTCCAGTGGTTCT and reverse primer GCTCTAGATTATGGCGACACATATGGCGGT.
PCR products were digested with KpnI and XbaI and cloned into the pUASp vector (36). The constructs were injected into embryos to obtain at least two independent stable transformant lines.
Overproduction of Dystroglycan in the Germ Line, Follicle Cells, and EmbryosFor Dg overproduction in germ line cells, balanced pUASp-Dg/P(w+:nanosGal4:VP-16)Ab-2 or Mat-
4-Tub > Gal4-UP16/CyO animals were raised in yeasted vials at 25 °C for 3 days, dissected, and analyzed. For Dg overproduction in the follicle cells, hsFlp; UAS-GFPact < FRTCD2FRT < Gal4/pUASpDg animals were heat-shocked at 37 °C for 1 h, raised in yeasted vials at 25 °C for 3 days, dissected, and analyzed. All pUASp-Dg constructs used were crossed to these three Gal4 drivers to test for proper overproduction of protein and correct localization of protein to the membrane in the germ line and somatic cells. The following pUASp-Dg lines were used for germ line analysis: FL-1, 5; 4P-1, -2, -3, -4; DC2-1, -2; Pro
Ala-1-3; C2-1, 3; C1-1, -2; ALLP-1-3; AATA-1,2,4. For Dg overproduction in the embryo, pUASp-Dg/Daughterless-Gal4 embryos were collected and left for 20 h at 18 °C to develop to stage 13, stained, and analyzed. The following pUASp-Dg lines were used to analyze embryos: FL-1, -2, -4; 4P-1, -3; DC2-1, 3; Pro
Ala-1, -2, -3; C2-1, -5, -10; C1-1, -2. For Dg rescue experiment the following lines were used: FL-1, -2, 3, -5, -6; 4P-1, -3, -4; DC2-2, 3-; Pro
Ala-1-3; C2-1, -3; C1-1, -2; ALLP-1-3; AATA-1,2,4. Importantly, the low level of Dg constructs driven by only one copy of the nanosGal4-driver used in the rescue experiments does not generate significant overexpression phenotypes. Abnormal stage 7-8 clones (severe necrosis, no oocyte, or abnormal Orb staining) were not included in our calculations. For each construct, values for the proportion of ovaries or embryos with mislocalized polarity markers between independent insertion lines were averaged, and average deviations were calculated.
Antibody Staining ProcedureOvaries were dissected in phosphate-buffered saline (PBS) and fixed while shaking on a nutator for 10 min in PBS containing 5% formaldehyde. Embryos were collected in (0.7% NaCl, 0.3% Triton X-100), dechorionated, and fixed for 20 min in (4% formaldehyde, 0.1 M sodium phosphate buffer, pH 7.2). Embryos were transferred to a 20-ml scintillation vial containing fixture and 100% n-heptane 1:1 and fixed for 20 min at room temperature on a shaker. Next, the fixture was removed, and an equal amount of 100% methanol was added. The vial was shaken vigorously to rupture the vitelline membrane. Embryos were rinsed with methanol and dehydrated through an ethanol series and rehydrated prior to antibody staining.
Ovaries and embryos were rinsed with PBT (PBS, 0.2% Triton X-100) four times (15 min each rinse) and blocked in PBTB (PBT, 0.2% bovine serum albumin, 5% normal goat serum) for 1 h at room temperature. The tissue was incubated with primary antibodies overnight at 4 °C and then incubated in secondary antibodies overnight at 4 °C. The next day they were rinsed with PBT for 15 min, stained with DAPI (1 µg/ml in PBT) for 10 min, and rinsed with PBT and mounted onto slides in 70% glycerol, 2% n-propyl gallate, 1x PBS. To analyze slides, a two-photon laser-scanning confocal microscope (Leica TCS SP/MP) was used.
The following primary antibodies were used at the following designated dilutions: rabbit anti-dystroglycan (1:3000 (26)), mouse anti-Orb and anti-Crb (1:20; Developmental Studies Hybridoma Bank), and rabbit anti-GFP directly conjugated AF488 (1:1000; Molecular Probes). The following secondary antibodies were used at the designated dilutions: Alexa 568 anti-rabbit and Alexa 568 anti-mouse (1:500; Molecular Probes) and 488 phalloidin (1:50; Molecular Probes).
Plasmid Construction for in Vitro Analysis and Protein ExpressionThe WW-EF hand region (DBR) of Drosophila dystrophin was amplified from the template LD11292 using PCR with forward primer GGAATTCCATATGACCATTGGACCACTGCCC and reverse primer CCGCTCGAGTTACTGGTGCTTGGCCGCCTC and cloned between the NdeI and XhoI restriction sites of the His tag expression vector pET-15b (Novagen). Drosophila DBR protein was expressed in Escherichia coli strain BL21(DE3) after induction by 1 mM isopropyl 1-thio-
-D-galactopyranoside in standard LB medium (Qbio-gene/Bio 101, Inc.). Cell pellets were collected, resuspended in Binding Buffer solution (150 mM MOPS, 150 mM NaCl, 5 mM imidazole), and lysed by a French press. Protein was purified using nickel-nitrilotriacetic acid (Qiagen) affinity chromatography. Protein was concentrated using an Amicon ultracentrifugal device (Millipore), and imidazole was removed by dialysis. Purified DBR protein was stored in 50 mM MOPS, pH 6.5, 150 mM NaCl, 400 mM Na2SO4, 10 mM dithiothreitol.
The Drk (Dreadlock)-FL gene of Drosophila was amplified via PCR from the template LD12029 with forward primer CCGCTCGAGATGGAAGCGATTGCCAAACACG and reverse primer CGCGGATCCTTATGAATGATATGGCGTCACAT and then cloned into the His tag expression vector pET-15b (Novagen) using the XhoI and BamHI restriction sites. Drosophila Drk protein was expressed in E. coli strain BL21(DE3) after induction by 0.1 mM isopropyl 1-thio-
-D-galactopyranoside. Cell pellets were collected and lysed by a French press. Protein was purified using nickel-nitrilotriacetic acid (Qiagen) affinity chromatography. Protein was concentrated using an Amicon ultracentrifugal device (Millipore) and imidazole removed by dialysis. Purified Drk protein was stored in 20 mM Tris, pH 7.9, 150 mM NaCl, 150 mM Na2SO4.
The DBR of human dystrophin (18) was expressed as a glutathione S-transferase fusion protein and purified by glutathione affinity chromatography. Five hundred units of thrombin (Amersham Biosciences) were loaded onto the glutathione column with DBR bound, and the column was sealed and incubated overnight at 4 °C to cleave the glutathione S-transferase from the DBR. The DBR was washed off the column and concentrated, and the buffer was exchanged during concentration to the same storage buffer used for the Drosophila DBR.
Fluorescence Polarization ExperimentsSynthesized dystroglycan peptides (Fig. 5C) were N-terminally tagged with tetramethylrhodamine by Invitrogen Evoquest Services (sequences DmWWbsI, GKSPATPSYRKPPPYVSP; HmWWbsI, KNMPTYRSPPPYVPP; DmWWbsII, PVI-LKDEKPPLLPPSYNT; HmWWbsII, PL-ILQEEKAPLPPPEYSN). Six additional tetramethylrhodamine-labeled peptides were ordered from Genemed Synthesis Inc. (DmWWbsI-pY, GKSPATPYRKPPPpY-VSP; DmWWbsII-pY, PVILKDEKPPLL-PPSpYNT; HmWWbsI-pY, KNMPTYRSPPPpYVPP; DmWWbsI-W, GKSPATPYRKWPPYVSP; DmWWbsII-G, PVI-LKDEKPPLLLPPSGNT; and DmSH3bsII-2A, PVILKDEKPALLPPSYNT). All peptides were over 95% pure based upon high pressure liquid chromatography and mass spectrometry analysis. Fluorescence polarization experiments were performed at 25 °C using a Wallac 1420 Victor3 fluorescence plate reader (PerkinElmer Life Sciences). Dystroglycan peptide (200 nM) was incubated with increasing concentrations of dystrophin protein in storage buffer to a final volume of 250 µl. Anisotropy values were measured at an excitation wavelength of 531 nm and an emission wavelength of 595 nm. Dissociation constants (Kd) were determined by plotting millianisotropy versus the concentration of Dys and fitting the data to the equilibrium binding Equation 1,
![]() |
|
| RESULTS |
|---|
|
|
|---|
A, in which both sites (SH3bsI and SH3bsII) have been disrupted by proline to alanine substitutions (Fig. 1B). The Gal4-UAS system for protein expression was utilized to express the Dg constructs in the follicle cells, the germ line cells, and the embryos. To avoid problems because of positional effects, 2-6 independent lines were generated and analyzed for each construct. The results represent mean values for experiments done with multiple independent insertion lines. All constructs expressed Dg at elevated levels compared with wild type (Fig. 2).
|
The Region of the Dystroglycan C Terminus Containing WWbsII and SH3bsII Is Sufficient to Disrupt Oocyte PolarityBecause full-length Dg overproduction disturbs oocyte polarity, we analyzed which signaling molecule binding sites in Dg are required for this capacity, in the context of our assays. Each Dg construct (Fig. 1B) was expressed in the germ line cells using a MatTub-Gal4 driver, and the percentage of stage 3-6 egg chambers with abnormal oocyte polarity was quantified (Fig. 3G).
Expression of C1 and C2 did not result in as high frequency of Orb mislocalization as the FL construct, suggesting that the C-terminal proline-rich region (absent in C1) is important for full Dg function and the WWbsI Dys-binding site alone is not sufficient to restore the activity of C1 to the wild type level (Figs. 1B and 3G). Therefore, other sites must act in conjunction with this WW domain binding site to regulate the Dg·Dys complex in the context of oocyte polarity.
Mutation of the conserved tyrosine of WWbsI to proline reduces binding affinity in vitro by an order of magnitude (from 7.6 to 172 µM in human and from 3.7 to 47 µM in Drosophila) (25). Expression of the 4P construct in Drosophila had the same ability to disrupt oocyte polarity as FL (46 ± 3%, n = 194; Fig. 3G), suggesting that either the reduced binding observed with the 4P construct is still enough to support functionality of the complex or that WWbsII is able to function in place of WWbsI. To probe this issue further, we expressed DC2, which only contains WWbsII and SH3bsII (Fig. 1B). Interestingly, DC2 was also able to disrupt oocyte polarity to the same extent as FL (53 ± 2%, n = 122; Fig. 3G), indicating that WWbsII indeed can function and that potential SH3 domain binding sites may play a role in the regulation of the Dg complex.
To test whether the putative SH3 domain binding sites are important for Dg function, we overexpressed the P
A construct, in which both SH3bsI and SH3bsII have been disrupted by proline to alanine substitutions (Fig. 1B). Importantly, this construct, in which only the two potential SH3 domain binding sites had been mutated, has a reduced capacity to affect oocyte polarity, similar to the C1 construct, which lacks all the potential binding sites (Fig. 3G). This confirms that the putative SH3 domain binding sites are essential for the full function of the Dg protein in this assay.
|
A showed less of a capacity to disrupt Orb localization than FL, 4P, and DC2 (Fig. 3H). This indicates that presence of at least one pair of WW domain and putative SH3 domain binding sites can disrupt the oocyte polarity during early and late stages of oogenesis and is therefore important for Dg function in the context of this assay. We also considered whether the amount of disrupted oocyte polarity was simply a result of the level of Dg protein overproduction, rather than the type of Dg construct. We compared the level of Dg production with the degree of Orb mislocalization and found no correlation. For example, different insertion lines with the DC2 construct exhibited a large range in the level of Dg overproduction when induced with the MatTub-Gal4 driver (supplemental Fig. S1A); however, the range in the level of Orb mislocalization was very small (Fig. 3, G and H). This suggests that the amount of Dg overproduction in the oocyte beyond a 2-fold level is not responsible for the changes in oocyte polarity and, therefore, that the differences in disruption of oocyte polarity are the result of the presence of significant domain binding motifs.
The Region of the Dystroglycan C Terminus Containing WWbsII and SH3bsII Is Sufficient to Disrupt Salivary Gland Apical-Basal PolarityPrevious work has indicated that overproduction of Dg in the salivary gland is sufficient to disrupt epithelial cell apical-basal polarity (26). The salivary gland epithelium has a very clear cell polarity; in wild type embryos, the polarity marker Crumbs localizes to the apical side of the salivary gland (Fig. 3, D-D''). However, when Dg is overproduced in the embryo using the Daughterless-Gal4 driver, Crumbs fails to localize normally in tissue (Fig. 3, E-E'', and F) (26).
To determine which potential Dg C-terminal signaling molecule binding sites are sufficient to disrupt salivary gland epithelium polarity, we expressed each Dg construct in the embryo using the Daughterless-Gal4 driver and quantified the percentage of embryos with mislocalized Crumbs staining in the salivary gland (Fig. 3F). DC2 and 4P constructs were capable of disrupting salivary gland epithelium polarity as well as FL (Fig. 3, E-E'' and F); however, C1, C2, and P
A constructs did not disrupt polarity to the same extent as FL (Fig. 3F). Nevertheless, in all the assays described, some phenotypes above the control level were observed even with the constructs that lack most of the C-terminal domain (C1; Fig. 3, F-H), indicating that the Dg extracellular domain alone might function in some capacity to regulate cellular polarity (similar to seen in other systems (30, 39).
|
A) was also unable to rescue polarity to the FL levels (Fig. 4D, Table 1) further supporting the idea that SH3 domain binding sites in Dg play an important role in the oocyte polarity. DC2 and 4P, however, rescued oocyte polarity at the same level as the FL (Fig. 4D and Table 1), indicating that a single WW domain binding site and a single putative SH3 domain binding site on Dg C terminus are sufficient to partially rescue the establishment of oocyte polarity prior to stage 6, more specifically the anterior to posterior translocation of the microtubular organizing center during stages 1-3.
|
To determine the degree to which full-length Dg could rescue egg chamber growth using this assay, we first expressed the FL construct in Dg clones and observed that FL was partially able to rescue growth (Fig. 4, C and D; Table 1). These "rescued" clones were classified as stage 7-8 based on the size of their egg chambers. However, in many cases, the oocyte was smaller than in wild type stage 7-8 oocytes.
Similar to what has been seen with the overexpression and polarity loss-of-function experiments, C1, C2, and P
A constructs were not able to rescue the growth to the FL levels (Fig. 4, A-D; Table 1). This indicates that the other C-terminal binding sites, in addition to WwbsI, play a role in the egg chamber growth and that putative SH3 domain binding sites are essential for full Dg function in the context of this assay. Nevertheless, some rescue above the control level was observed even with the construct that lacks most of the C-terminal domain (C1, Fig. 4D; Table 1), indicating that, as discussed earlier, the Dg extracellular domain alone might function in some capacity to regulate egg chamber growth. This is similar to what is seen with skeletal myotubes (39). DC2 and 4P, however, rescued egg chamber growth at the same level as the FL (Fig. 4D; Table 1), indicating that a single WW domain binding site in addition to a single putative SH3 domain binding site are sufficient for the function of Dg proline-rich C terminus for egg chamber growth.
Again, we considered whether the ability to rescue growth and polarity was simply a result of the level of Dg protein overproduction, rather than the type of Dg construct. We compared the level of Dg production with the degree of polarity and growth rescue and found no correlation (supplemental Fig. S1, C-D). For example, FL expression varied between 2 and 4 times greater than wild type. However, the level of polarity or growth rescue did not correlate with the level of protein. This suggests that the amount of Dg overproduction in the oocyte is not responsible for differences in the degree of rescue and, therefore, that the differences in ability to rescue polarity and growth are a result of the presence of significant binding motifs.
Drosophila and Human Dystrophin Bind to Dystroglycan WWbsI and WWbsII in VitroBoth overproduction and rescue experiments indicate that DC2 is able to affect cellular polarity to a similar extent as FL. DC2 includes one putative SH3 domain binding motif (SH3bsII) and one WW domain binding motif (WWbsII). Previous work in our laboratory has established the effectiveness of using a fluorescence polarization assay to measure binding of dystrophin (WW + EF regions) to the first WW domain binding motif (WWbsI) of dystroglycan (25). To assess the ability of dystrophin to bind this second WW domain binding motif (WWbsII), a second Drosophila dystroglycan peptide (DmWWbsII) that includes both the SH3bsII and WWbsII domain binding motifs present in DC2 was used. Drosophila dystrophin binds to DmWWbsII with a Kd of 46 ± 18 µM (Fig. 5, A-C). The affinity of this interaction is lower than that of Drosophila dystrophin and WWbsI (16 ± 4 µM), but it is still well within the range of reported dissociation constants for class I WW domains (49). In contrast, mutations predicted to abolish the WW (but not the SH3) binding domain resulted in much lower affinities (DmWWbsI-W, 178 µM and DmWWbsII-G,147 µM; Fig. 5, B and C). These values are comparable with the Kd value observed with a negative control for the assay (Kd for an unrelated peptide, p53 is 248 µM; Fig. 5C).
The second WW domain binding motif is conserved in human Dg, and the unexpected result above prompted us to investigate the same interaction between human dystrophin and human dystroglycan. Again, a second human dystroglycan peptide (HsWWbsII) was assayed for binding to human dystrophin. Human dystrophin binds to HsWWbsII with a Kd of 81 ± 11 µM, demonstrating that this interaction first seen with Drosophila peptides can also be seen with the corresponding human peptides (Fig. 5, A-C).
To further examine the specificity of the interaction between dystrophin and the second WW domain of dystroglycan, we tested the ability of human dystrophin to bind Drosophila dystroglycan peptide and vice versa. Human dystrophin does not bind to DmWWbsII (Kd 282 ± 18 µM); however, Drosophila dystrophin does bind to HsWWbsII (59 ± 10 µM; Fig. 5, A-C).
The observed importance of the SH3 domain binding sites in Dg (Fig. 1B, Fig. 3, F-H, and Fig. 4D) brings up the possibility that the SH3 domain of a tyrosine kinase could dock on that site, phosphorylate the tyrosine in WW-binding sites, and thereby affect dystrophin WW domain binding to this site. To test on what level tyrosine phosphorylation affects the WW domain binding in this assay, we tested dystrophin binding to Dg peptides that are tyrosine-phosphorylated (DmWWbsI-pY, DmWWbsII-pY, and HmWWbsI-pY). In both Drosophila and humans, tyrosine phosphorylation dramatically reduced WW domain binding (86 µM compared to 16 µM, 112 µM to 46 µM and 100 µM to 7.6 µM, respectively; Fig. 5, A-C).
A Putative SH3 Domain Binding Motif Is Critical for Dg Function in Oocyte PolarityBoth overexpression and loss-of-function experiments revealed that SH3 domain binding sites in the Dg C terminus are essential for its function in cellular polarity. To further dissect which of the two SH3 domain binding sites is critical, we disrupted each site independently by proline to alanine substitutions and tested the capacity of the mutant proteins to affect oocyte polarity in both loss-of-function and overexpression analyses. Two proline to alanine substitutions in the SH3bsI caused no reduction in the activity of the wild type protein in overexpression and loss-of-function experiments (Fig. 6, B-D, AATA; Table 1). In sharp contrast, a single proline to alanine substitution in SH3bsII is functionally equivalent to deletion of the whole proline-rich region (Fig. 6, B-D, ALLP; Table 1). Thus, SH3bsII but not SH3bsI appears to be required for Dg function in oocyte polarity. Furthermore, the mutation apparently interferes specifically with SH3 domain binding and not WW domain binding because dystrophin WW domain still binds to the Dg peptide with this mutation in vitro (DmSH3bsII-A, Kd = 54 µM; Fig. 5C).
|
| DISCUSSION |
|---|
|
|
|---|
Previous studies (16-18) have indicated that dystrophin primarily binds to the first but not the second PPXY motif of dystroglycan. In contrast, here we show that dystrophin can indeed bind this second WW domain binding motif (WWbsII), and we suggest that from the C-terminal proline-rich region this site in combination with an SH3 domain binding site is sufficient for Dg C-terminal function in the establishment of cellular polarity in Drosophila. In vitro, dystrophin binds WWbsII with lower affinity than WWbsI (46 µM compared with 16 µM). It appears that WWbsII functions just as well as WWbsI in our in vivo assays, because the DC2 phenotype is similar to the FL phenotype in both overproduction and loss-of-function experiments.
The in vitro interaction between dystrophin and the Dg WWbsII is conserved in humans. This is interesting in light of the fact that mutations in Dg are not observed clinically in patients with MD; instead, mutations in Dys, Dg-modifying enzymes, or extracellular matrix proteins result in MD (1). Because Dg knockouts die during embryonic development in mice and as an oocyte in Drosophila, it was assumed that the lack of MD patients with any mutations in Dg could be explained by its lethality. However, the results presented suggest a potentially new explanation; perhaps WWbsI and WWbsII are redundant. Perhaps humans with a mutation in WWbsI exist, but they do not show any MD phenotypes because WWbsII can substitute in place of the mutant WW domain binding site.
|
The evidence thus far regarding the regulation of the Dg-Dys interaction depicts a model that strikingly resembles what we know about integrin-talin interactions (40-42). Integrins are heterodimeric, transmembrane proteins that like dystroglycan link the extracellular matrix to the intracellular cytoskeleton. The NPXY motif on the integrin
subunit interacts with talin, an actin-binding protein, via the F3 subdomain within the FERM domain of talin, a PTB-like domain (43). Talin plays a role analogous to dystrophin by binding the NPXY motif on integrin
cytoplasmic tails and linking integrins to the actin cytoskeleton. Binding of Talin to the NPXY motif is required for energy-dependent activation of integrins (44). In addition to performing analogous structural roles, a similar regulatory mechanism may exist. It is known that integrin-talin interaction is mediated in a phosphorylation-dependent manner. When the tyrosine of the NPXY motif is phosphorylated, binding of the integrin to talin is abolished (43, 45-47). Focal adhesion kinase and integrin-linked kinase bind to integrins in vitro and may regulate integrin-talin interaction, although this remains to be demonstrated in vivo. Furthermore, several other proteins, including platelet myosin, SHC, and Grb2, have been shown to bind integrins in their phosphorylated state in vitro (48). This study provides evidence that a similar mechanism may act to regulate Dg-Dys interaction. We have shown that a PXXP motif, which may be an SH3 domain binding site, is important for Dg function, opening up the possibility that an SH3 domain containing kinase may bind to Dg and phosphorylate the tyrosine on the WW domain binding site. Other signaling molecules may then interact with Dg in a phosphorylation-dependent manner.
We have identified two putative signaling molecule binding sites, the second WW domain binding site and a putative SH3 domain binding site, that are important for the regulation of the Dg complex. The key question now is to identify the signaling molecules that bind to these sites. Previous work has revealed SH3 domain-mediated interaction between Dg and Grb2 (21). However, we have not been able to observe direct binding between Dg and Drk, a Drosophila homologue of Grb2 (Kd = 480 µM), suggesting a different candidate for the SH3 domain interaction in Drosophila. Identification of the critical molecule that will associate with the putative SH3 domain binding site in Dg will further our understanding of the role Dg plays in signaling and may provide new insights into the pathogenesis of muscular dystrophy.
| FOOTNOTES |
|---|
The on-line version of this article (available at http://www.jbc.org) contains supplemental Results, Experimental Procedures, and Figs. S1 and S2. ![]()
1 Both authors contributed equally to the publication. ![]()
2 To whom correspondence should be addressed: Dept. of Biochemistry, University of Washington, HSB J-591, Box 357350 Seattle, WA 98195. Tel.: 206-543-8468; E-mail: hannele{at}u.washington.edu.
3 The abbreviations used are: Dg, dystoglycan; Dys, dystrophin; MD, muscular dystrophy; SH3, Src homology 3; SH2, Src homology 2; MEK1, dual threonine/tyrosine kinase; ERK, extracellular signal-regulated kinase; DBR, dystroglycan binding region; bs, binding site; FL, full-length; MOPS, 4-morpholinepropanesulfonic acid; PBS, phosphate-buffered saline; DAPI, 4,6-diamidino-2-phenylindole; GFP, green fluorescent protein. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |