HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 282, Issue 21, 15730-15742, May 25, 2007

This Article Abstract Full Text (PDF) All Versions of this Article: 282/21/15730    most recent M611197200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Samson, T. Articles by Wixler, V. Search for Related Content PubMed PubMed Citation Articles by Samson, T. Articles by Wixler, V. Social Bookmarking                      What's this?

Def-6, a Guanine Nucleotide Exchange Factor for Rac1, Interacts with the Skeletal Muscle Integrin Chain 7A and Influences Myoblast Differentiation^*

Thomas Samson¹, Carola Will, Alexander Knoblauch, Lisa Sharek, Klaus von der Mark^¶, Keith Burridge², and Viktor Wixler²

From the Department of Cell and Developmental Biology, Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, North Carolina 27599, the Institut für Molekulare Virologie, Zentrum für Molekularbiologie der Entzündung, Universitätsklinikum Münster, 48149 Münster, Germany, and the ^¶Experimentelle Medizin I, Nikolaus-Fiebiger Zentrum, Universität Erlangen-Nürnberg, 91054 Erlangen, Germany

Received for publication, December 6, 2006 , and in revised form, March 23, 2007.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Integrin 71 is the major laminin binding integrin receptor of muscle cells. The 7 chain occurs in several splice isoforms, of which 7A and 7B differ in their intracellular domains only. The fact that the expression of 7A and 7B is tightly regulated during skeletal muscle development suggests different and distinct roles for both isoforms. However, so far, functional properties and interacting proteins were described for the 7B chain only. Using a yeast two-hybrid screen, we have found that Def-6, a guanine nucleotide exchange factor for Rac1, binds to the intracellular domain of the 7A subunit. The specificity of the Def-6-7A interaction has been shown by direct yeast two-hybrid binding assays and coprecipitation experiments. This is the first description of an 7A-specific and -exclusive interaction, because Def-6 did not bind to any other tested integrin cytoplasmic domain. Interestingly, the binding of Def-6 to 7A was abolished, when cells were cotransfected with an Src-related kinase, which is known to phosphorylate Def-6 and stimulate its exchange activity. We found expression of Def-6 was not only restricted to T-lymphocytes as described thus far but in a more widespread manner, including different muscle tissues. In cells, Def-6 is seen in newly forming cell protrusions and focal adhesions, and its localization partially overlaps with the 7A integrin receptor. C2C12 myoblasts overexpressing Def-6 show a delay of Rac1 inactivation during myogenic differentiation and abnormal myotube formation. Thus, our data suggest a role for Def-6 in the fine regulation of Rac1 during myogenesis with the integrin 7A chain guiding this regulation in a spatio-temporal manner.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Integrins are heterodimeric cell surface receptors that bind to components of the surrounding extracellular matrix (ECM)³ or to other cell surface molecules. They are composed of two non-covalently linked transmembrane polypeptides (- and -chain). So far 18 - and 8 -chains have been described, which form at least 24 integrin receptors with different substrate-binding specificities determined by the individual combination of - and -chains. Besides forming a mechanical link between the ECM and the cytoskeleton, integrins regulate a broad variety of signaling events that influence cellular functions such as proliferation, cell differentiation, and apoptosis (1). Consequently, the cytoplasmic domains of integrin receptors play key roles in the transduction of "outside-in" as well as "inside-out" signals (2-6). They have been found to interact with an array of proteins that are part of signaling cascades or that provide linkage to the actin cytoskeleton (7).

Integrin 71 is mainly expressed in muscle tissues (8, 9), and the receptor exclusively binds to laminins (10). Muscle precursor cells (myoblasts) use the 71 receptor to adhere to and migrate on laminin (11), and laminin-containing ECM increases the differentiation potential of myoblasts (12). The importance of this kind of cell-matrix linkage in muscles becomes obvious when one considers the phenotypes of mouse null mutants, which lack either the major laminin isoform in muscles (laminin 2 chain as part of laminin-211)⁴ (13) or the integrin 7 chain (14). In both cases, the animals suffer from severe postnatal muscular dystrophy and muscle wasting.

The integrin 7 chain exists in different splice isoforms (8, 15, 16). The 7X1 and 7X2 splice variants differ in the extracellular putative -propeller domain, a region between the homology repeats III and IV (17). This leads to different binding abilities of the receptor for certain laminin isoforms (10). However, the physiological relevance of these diverse binding affinities is not known.

The splice isoforms 7A and 7B have different amino acid sequences within the intracellular tail. Interestingly, the expression of 7A and 7B during muscle development and regeneration is tightly regulated, and this regulation pattern is highly conserved among different mammalian species (15, 18, 19). Undifferentiated myoblasts express the 7B splice isoform only, whereas 7A expression is up-regulated after induction of myotube formation (15). Interestingly, 7 splice variants are also regulated during muscle regeneration after injury (20). All these observations strongly suggest an important function for the 7A chain during differentiation of myoblasts into myotubes. The cytoplasmic tail of the 7 chain does not influence the attachment ability of 71 expressing cells to laminin (21). Therefore the physiological relevance of the different intracellular parts is most likely due to different abilities of 7A and 7B to interact with intracellular proteins. Thus they might function in alternative signaling events during muscle differentiation and regeneration or provide additional mechanical linkage to the cytoskeleton.

Rho GTPases are molecular switches regulating a variety of cellular processes, like endocytosis, cell-cycle progression, differentiation, and gene transcription (22). Members of the Rho GTPase family cycle between an activated GTP-bound state and an inactivated form in which the GTP has been hydrolyzed to GDP. Guanine nucleotide exchange factors (GEFs) promote the exchange of GDP for GTP, thereby activating Rho GTPases.

Rho GTPases were shown to be strongly involved in the proper differentiation of myoblasts (23). Specifically, the tight regulation of Rac1 seems to be important for myogenesis. During normal differentiation of myoblasts the overall endogenous pool of active Rac1 significantly decreases. However, Rac1 activity is never shut off completely but remains at a basal level during differentiation (24). In fact, some steps of myogenesis seem to require locally restricted Rac1 activity (25). The mechanisms regulating these complex patterns of Rac1 activity during myogenesis are still poorly understood.

In the present study, we report a novel interaction between the cytoplasmic tail of the integrin 7A chain and Def-6 (also known as: IBP, SLAT). The Def-6-related protein Swap-70 also binds to the 7A cytoplasmic domain, albeit with a lower affinity. Def-6 and Swap-70 were recently described as a novel group of GEFs for Rho GTPases (26, 27). Their interactions with 7A are highly specific and exclusive, because no other integrin cytoplasmic domain showed binding to these proteins. Interestingly, we found that tyrosine phosphorylation of Def-6 abolishes this interaction. Our data implicate Def-6 in the tight regulation of Rac1 activity during myoblast differentiation.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
DNA Vectors—All yeast two-hybrid pAS2-1 (Clontech) derivate constructs coding for fusion proteins of the GAL4-DNA binding domain and full-length or truncated intracellular parts of integrin subunits have been described elsewhere (28). cDNA fragments encoding the complete sequences of Def-6 (NCBI accession number gi:142375804) and Swap-70 (NCBI gi:40789274) or their deletion mutants were generated by RT-PCR from murine spleen RNA. The RT-PCR fragments were subsequently cloned in-frame into pACT2 vector (Clontech).

pEBG-derived expression constructs containing GST-7A or GST-7B and their deletion mutants for expression in mammalian cells have been described previously (28). To express Def-6 in mammalian cells, the Def-6 cDNA insert was subcloned from the pACT2 vector into pEF1-Myc/his (Invitrogen), pCS2+MT (29), or pBabe-neo (30). pBabe-puro constructs containing the cDNA for the complete 7A or 7B chain have been already described elsewhere (28).

To generate pBabe-neo/-puro-derived retroviruses, GPE86-cells (31) were stably transfected with FuGene6 (Roche Applied Science). Supernatants from these cells were collected and used for the infection of C2C12 cells. 48 h later, selection of infected cells was started with 1 mg/ml G418 or 4 µg/ml puromycin.

Yeast Two-hybrid Analysis—The initial yeast two-hybrid screen to identify novel intracellular binding partners of the 7A1 integrin receptor has been described elsewhere (28). Briefly, a human placenta cDNA library (MATCHMAKER^TM, Clontech) was screened for proteins that interact with the cytoplasmic part of the 7A integrin chain. The intracellular part of the murine integrin 7A subunit (amino acids 1104-1161) was cloned in the pAS2-1 vector and used as bait (amino acids positions refer to NCBI accession code gi:3378242).

For direct yeast two-hybrid analysis, the yeast strain Y190 was cotransformed with the pAS2-1 plasmid containing the GAL4-DNA binding domain (DBD) fused with appropriate cDNAs as bait and with pACT2 plasmid containing cDNAs fused to GAL4-activation domain (AD) as prey. Transformants were grown on synthetic defined medium lacking leucine, tryptophan, and histidine in the presence of 25 mM 3-amino-1,2,4-triazole. On day 6 the colonies were tested for the lacZ reporter gene activity in a -galactosidase filter assay. The interaction was scored as negative (-) when no blue colonies were visible after 8 h, and scored as: weak (+), intermediate (++), or strong (+++) when blue colonies became visible after 8, 4, or 1 h, respectively. For relative quantification of the -galactosidase activity, the transformants were first grown on synthetic defined medium lacking leucine and tryptophan and subsequently introduced into the liquid culture assay using ortho-nitrophenyl--D-galactopyranoside as substrate. The measured -galactosidase activity within one experiment was calculated relative to a positive control, which was set as 100%.

Cell Culture—HEK293, NIH3T3, and HeLa cells were cultured in Dulbecco's modified Eagle's medium-high glucose supplemented with 10% fetal bovine serum. C2C12 myoblasts were cultured at low densities in growth medium: 1:1 mixture of Dulbecco's modified Eagle's medium-low glucose and F-12/Ham medium, supplemented with 20% fetal calf serum. To induce differentiation, growth medium was replaced by differentiation medium (Dulbecco's modified Eagle's medium-high glucose, 2% horse serum). All cells were grown in a 37 °C and 5% CO₂ incubator.

Antibodies—The following antibodies were used: mouse-anti-Myc, clone 9E10 (32), rabbit-anti-GST, and anti-slow skeletal myosin monoclonal antibody (NOQ7.5.4D, Sigma), mouse-anti-sarcomere myosin (clone MF-20, Developmental Studies Hybridoma Bank, University of Iowa), mouse-anti-phosphotyrosine (clone PY99, Santa Cruz Biotechnology), mouse-anti-integrin 7, clone 3C12 (recognizes the extracellular part of the receptor) (21, 33), rabbit-anti-integrin 7A (a gift of Ulrike Mayer, Manchester, UK), mouse anti-Rac1 (BD Biosciences), peroxidase-conjugated secondary antibodies for immunoblot analysis (Amersham Biosciences), and secondary fluorescent antibodies (Dianova and Molecular Probes).

Polyclonal antibodies against Def-6 were raised against a bacterially expressed GST fusion protein that contained amino acids 410-630 of murine Def-6. The final serum was precleared with GST-loaded glutathione-Sepharose beads (Amersham Biosciences). Subsequently, Def-6 antibodies were affinity-purified using GST-Def-6-amino acids 410-630-conjugated CNBr-Sepharose (Amersham Biosciences). The specificity of the purified antibodies was tested by immunoblotting cell lysates from Def-6-transfected cells versus non-transfected cells (Fig. 4C, last two lanes).

Immunofluorescence Staining of Cells—Cells were cultured on coverslips as indicated in the figure legends. Before staining, the cells were washed in phosphate-buffered saline, fixed for 15 min with 2% paraformaldehyde at room temperature, permeabilized with 0.2% Triton X-100 for 2 min, and subsequently blocked with 1% bovine serum albumin in phosphate-buffered saline. The cells were incubated at room temperature for 1 h with primary antibody and were detected by species-specific fluorochrome-conjugated secondary antibodies. Fluorescence images were taken with a Axioplan-2 microscope (Zeiss). Images shown in Fig. 5 (F and G) were taken with a Zeiss 510 Meta laser-scanning confocal microscope.

Determination of Myotube Fusion Index—C2C12 cells were grown and differentiated on coverslips. On day 3 after the switch to differentiation medium, cells were fixed and stained with 4',6-diamidino-2-phenylindole and anti-sarcomere myosin antibody MF-20. Photos were taken from random fields (20x objective), and nuclei were counted per field. The fusion index was calculated as the ratio of nuclei in differentiated myotubes versus the total amount of nuclei per field. Myotubes were defined as MF-20-positive cells, which contain more than three nuclei. At least four fields were counted per experiment.

Coprecipitation Assays and Immunoblotting—2 x 10⁵ HEK293 cells were plated in 6-well dishes 48 h before transfection with FuGene6 transfection reagent (Roche Applied Science). 1 µg of each cDNA plasmid was used per transfection. The total DNA amount was equalized with appropriate empty expression vectors. 30 h after transfection the cells were washed with phosphate-buffered saline and lysed in IP buffer (25 mM Tris, pH 7.5, 137 mM NaCl, 2 mM MgCl₂, 10% glycerol, 0.5% Triton X-100, 1 mM sodium vanadate, 5 µg/ml leupeptin, 5 µg/ml aprotinin) for 10 min. The lysates were cleared by centrifugation at 13,000 x g for 10 min at 4 °C. To reduce nonspecific binding of proteins, Sepharose beads were blocked with 1% bovine serum albumin in IP buffer before incubation with cell lysates. For GST pulldown experiments, the cleared supernatants were incubated for 1.5 h at 4 °C with GSH-Sepharose beads (Amersham Biosciences). For immune precipitations, Protein G-Sepharose beads (Amersham Biosciences) were used instead. The beads were subsequently washed twice with IP buffer, boiled in sample buffer, and separated on 10% SDS-PAGE and immunoblotted as indicated. To detect the peroxidase-conjugated secondary antibodies, an ECL detection system (Pierce) was used.

For detection of phosphorylated Def-6 protein in cell lysates, C2C12 cells were lysed in 2x SDS gel sample buffer and boiled for 5 min, to denature all proteins completely. Subsequently the samples were diluted 20-fold with phospho-IP buffer (150 mM NaCl, 20 mM Tris, pH 7.6, 1% Triton X-100, 1% sodium deoxycholate, 1 mM sodium vanadate, 5 µg/ml leupeptin, 5 µg/ml aprotinin) to a final concentration of 0.1% SDS. Tyrosine-phosphorylated proteins were then precipitated using PY-99 antibody and Protein G-Sepharose beads. The beads were washed four times with phospho-IP buffer before being analyzed by immunoblotting with anti-Def-6 polyclonal antibody.

Rac1 Activity Assay—Activity assays for Rac1 were performed as previously described (34). Briefly, the cells were lysed in lysis buffer (50 mM Tris, pH 7.6, 150 mM NaCl, 5 mM MgCl₂, 1% Triton X-100, 5 µg/ml leupeptin, 5 µg/ml aprotinin, 1 mM phenylmethylsulfonyl fluoride). The lysates were cleared by centrifugation at 13,000 x g for 4 min at 4 °C. The supernatants were incubated for 30 min at 4 °C with glutathione-Sepharose beads previously loaded with 30 µg of GST-tagged PBD (Rac1/cdc42 binding domain of PAK1). Subsequently the beads were washed four times in lysis buffer, boiled in sample buffer, and separated by 15% SDS-PAGE followed by immunoblotting.

RT-PCR—For the isolation of total RNA from cells or tissues, TRIzol (Invitrogen) was used. mRNA was isolated from the total RNA using Oligotex (Qiagen) and reverse transcribed with the First-strand-cDNA synthesis Kit (Roche Applied Science). For qualitative expression analysis the High Fidelity PCR System (Roche Applied Science) was used with the following primers: Def-6, ACCATGGCCCTGCGCAAGGAGCTG/TGGTGCTGGATCCAGTTTTTC; Itga7, CTCTACAGCTTTGATCGTGCAGC/AAACCACTGGACTGGTACAGCAC; and glyceraldehyde-3-phosphate dehydrogenase, ATCACTGCCACCCAGAAGAC/ATGAGGTCCACCACCCTGTT.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Both Def-6 and Swap-70 Bind Specifically to the Cytoplasmic Part of the Integrin 7A Subunit—To identify novel proteins that specifically interact with the cytoplasmic part of the 7A integrin subunit, we performed a yeast two-hybrid screen. A human placenta cDNA library was screened with the complete intracellular domain of the 7A chain (amino acids 1104-1161) as bait. Out of 288 isolated clones, 7 coded for Def-6 and 2 for Swap-70. Both proteins have recently been described as GEFs for the Rho GTPase Rac1 (26, 27). Def-6 and Swap-70 differ from all other GEFs of the Dbl family in that the pleckstrin homology domain is located N-terminal to a dbl-homology-like (DHL) domain, which shows a low homology to the DH domain of other GEFs like Vav and Tiam1 (26, 35).

To test the specificity of the interactions, direct yeast two-hybrid analyses were carried out. Def-6 and Swap-70 were expressed in yeast Y190 cells as AD fusion proteins and tested for interaction with DBD fusions of several different integrin cytoplasmic domains (Table 1). Interestingly, with the exception of 7A, none of the 11 tested -integrin subunits showed binding to either Def-6 or Swap-70. Also 7B, the splice counterpart of 7A chain, did not interact with these GEF proteins. According to previous reports, the nine most C-terminal amino acids of the 7B chain seem to have an inhibitory effect on the interaction with other proteins (15, 28). But even a deletion mutant of the 7B cytoplasmic tail, which lacks these nine amino acids (7B_del1), did not bind to Def-6 or Swap-70. Furthermore, the cytoplasmic domains of neither 1A nor 1D integrin subunits interacted with these GEF proteins. Nonspecific binding of Def-6 and Swap-70 to the DBD alone could be excluded, because there was no interaction detectable between the DBD and AD-Def-6 or AD-Swap-70 (Table 1).

View larger version (26K): [in this window] [in a new window]   FIGURE 1. Interaction of Def-6 and SWAP70 with the cytoplasmic domain of the integrin 7A chain. A, yeast Y190 cells were transformed with GAL4-DBD and GAL4-AD chimeric constructs. Induced -galactosidase activity was measured using a liquid o-nitrophenyl--D-galactosidase assay. Three different yeast transformants were used for each measurement. The control represents the interaction of p53 with SV40 large T-antigen, which was set as 100% of induced -galactosidase activity. The asterisks indicate significant differences to corresponding controls with DBD vector only (p < 0.05 according to the t test). B, HEK293 cells were transiently transfected with cDNA constructs as indicated. After 40 h, GST proteins were precipitated (P) with glutathione-conjugated Sepharose beads (GSH) from cell lysates. The coprecipitated proteins were detected by immunoblots (IB) with monoclonal anti-Myc antibody (upper blot). The same blot was stripped and subsequently redeveloped with a rabbit anti-GST antibody (middle blot). The lower panel shows the expression of Myc-Def-6 and Myc-Swap-70 analyzed by immunoblotting of equal amounts of total cell lysates with anti-Myc monoclonal antibody.

Next we tested if these interactions could occur in mammalian cells. HEK293 cells were cotransfected with plasmids coding for the expression of GST-tagged 7A- or 7B-cytoplasmic tails and Myc-tagged Def-6 or Swap-70. GST-tagged 7-cytodomains were precipitated and analyzed by immunoblotting for the coprecipitation of Myc-Def-6 or Myc-Swap-70. Def-6 coprecipitated only with GST-7A, but not with GST-7B_del1 or GST alone (Fig. 1B, top panel). Myc-Swap-70 showed the same coprecipitation behavior, except that the degree of binding to GST-7A was much lower (Fig. 1B, long exposure blot). Thus the results from coprecipitation experiments correlate well with those obtained by the quantitative yeast two-hybrid data.

Taken together, these studies show that Def-6 and Swap-70 interact with the cytoplasmic domain of the integrin 7A chain, but not with any other integrin tested, including 7B and 1 chains. As the A splice isoform of the 7 integrin subunit occurs exclusively in differentiating and mature skeletal muscle cells, these results suggest a muscle specific role for this interaction.

Mapping of the Interaction-mediating Protein Domains and Amino Acid Sequences—As both Def-6 and Swap-70 bind to the 7A integrin chain, it was of interest to test whether they use identical binding sites on the 7A chain. To study this, a series of deletion mutants of the 7A cytoplasmic domain was created and used for direct yeast two-hybrid interaction assays with Def-6 and Swap-70, respectively. As shown in Fig. 2A both proteins bind to the full-length 7A cytoplasmic domain and to the 7A_del1 deletion mutant, which lacks the last 10 C-terminal amino acids. Deletion of an additional 13 amino acids (7A_del2), or more, abrogated the binding of Def-6 and Swap-70. These data indicate that both Def-6 and Swap-70 use the same amino acid motif of the 7A chain for interaction which is at least 13 amino acids (GTVGWDSSSGRST) in length.

Def-6 and Swap-70 show an identical arrangement of protein subdomains: an N-terminal EF-hand motif (EF), a central PH domain, and a C-terminal DHL domain (26, 27, 35). So far, none of these subdomains have been found to bind to integrin receptors. To investigate if one of these subdomains is sufficient for interaction with 7A or whether the complete protein structure is required, a series of deletion mutants for both Def-6 and Swap-70 was generated and tested for binding ability to the 7A cytoplasmic domain in direct yeast two-hybrid assays. Interestingly, only full-length Def-6 and Swap-70 interacted with the 7A cytoplasmic domain. No single subdomain or combination of domains led to an interaction (Fig. 2B).

View larger version (21K): [in this window] [in a new window]   FIGURE 2. Determination of the interacting amino acid motifs and protein domains. Yeast Y190 cells were cotransformed with DBD and AD chimeric constructs. The interaction was evaluated using a -galactosidase filter assay as described under "Experimental Procedures." Numbers in the figures refers to amino acid positions in the corresponding protein. A, interaction of different 7A deletion mutants with Def-6 and Swap-70. The gray box indicates the minimal amino acid motif of the 7A chain for the binding to Def-6 and SWAP70. B, interaction of different deletion mutants of Def-6 and Swap-70 with the intracellular part of the integrin 7A chain.

The GEF-activating Phosphorylation of Def-6 Abolishes Its Binding Capacity to 7A Cytodomain—It was previously reported that Def-6 exists in two different conformations. Normally, an intramolecular interaction keeps the protein in a closed conformation, thereby inhibiting its GEF activity. Phosphorylation of the tyrosine residue Y210 by a Src-related kinase and binding to cell membrane-associated phosphatidyl inositol 3,4,5-trisphosphate relieves the intramolecular interaction and activates the GEF (26). Our interaction analysis of Def-6 mutants showed that the entire protein structure is needed for binding to the 7A cytodomain. To test whether the conformational change of Def-6 induced by Y210 phosphorylation influences the interaction with the 7A intracellular domain, two Def-6 mutants were generated. The mutant Y210F cannot be phosphorylated due to the lack of a hydroxyl residue on the aromatic amino acid. In contrast, the mutant Y210E mimics phosphorylation due to the negative charge of the glutamate (phosphomimetic). These mutants were used for quantitative direct yeast two-hybrid assays. As shown in Fig. 3A, the binding of 7A to the Def-6-Y210F mutant was comparable to that of wild-type Def-6 protein (Def-6 wild type: 232% ± 43%; Y210F: 159% ± 83%). In contrast, the Def-6-Y210E mutant did not show any interaction with the 7A cytodomain (Y210E: 3.7% ± 1.0%; AD only: 1.9% ± 0.2%), suggesting that the phosphorylation of Def-6 on Y210 abolishes association with the 7A chain.

To confirm these observations in a mammalian cell system, we expressed these mutants or the wild-type Def-6 as Myc-tagged proteins along with the GST-tagged 7A or GST alone in HEK293 cells and performed pulldown assays. The presence of bound Def-6 in the GST precipitates was checked via immunoblotting (Fig. 3B). In accordance with the results obtained in the yeast two-hybrid experiments, only the Def-6 wild-type protein and the Def-6-Y210F mutant associated with 7A, but not the phosphomimetic Def-6-Y210E mutant.

View larger version (19K): [in this window] [in a new window]   FIGURE 3. Influence of phosphorylation of Def-6-Y210 on 7A binding. A, the interaction capacities of Def-6 point mutations (Def-6-Y210F and Y210E) with the cytoplasmic domain of the integrin 7A chain were analyzed by quantitative yeast two-hybrid assays (performed as described in Fig. 1A). B, HEK293 cells were transiently transfected with cDNA constructs for GST or GST-7A and Myc-Def-6 or its mutants (Y210F and Y210E) as indicated. GST proteins were precipitated (P) and coprecipitated proteins were detected in immunoblots (IB) with anti-Myc antibody (upper blot). The same blot was stripped and subsequently redeveloped with a rabbit anti-GST antibody (middle blot). The lower panel shows the expression of Myc-Def-6 (or its mutants) analyzed by immunoprecipitating (IP) Def-6 from equal amounts of total cell lysates and immunoblotting with anti-Myc antibody. C, HEK293 cells were transiently transfected with cDNA constructs for GST-7A, Myc-Def-6 and one of three different forms of Lck: Lck wild type, Lck-K273E (dominant negative), and Lck-Y505F (constitutive active). Def-6 protein was immunoprecipitated and coprecipitated GST-proteins were detected in immunoblots with polyclonal anti-GST antibody (upper blot). The same blot was stripped and subsequently redeveloped with anti-Myc antibody (middle blot). The lower panel shows the expression of GST-7A analyzed by precipitating GST-proteins from equal amounts of total cell lysates and immunoblotting with anti-GST antibody. D, C2C12 cultures were harvested as myoblasts and day 4 myotubes. After lysis and denaturing treatment of the lysate, immunoprecipitations were performed. Def-6 was detected when tyrosine-phosphorylated proteins were precipitated (PY, antibody: PY99) but not when a control antibody was used (control, antibody: 9E10). Panels at the bottom show immunoblots of total cell lysates (1:500 of input) stained for Def-6 and the myogenic differentiation marker sarcomere myosin (antibody: MF20).

In summary, the combination of direct yeast two-hybrid and coprecipitation assays suggests that Y210 phosphorylation of Def-6 abolishes its binding to the cytoplasmic domain of the 7A integrin chain. These data imply that only the non-active GEF is able to bind to 7A, because the phosphorylation of Y210 was previously shown by others to stimulate exchange activity of Def-6 (26).

Def-6 Expression in Tissues and the C2C12 Cell Line—To date, Def-6 function has mainly been analyzed in lymphocytes (26, 37-39), and no consistent data of Def-6 expression in other tissues or cell types are available. Because the 7A splice isoform is expressed exclusively in differentiating myogenic cells or in terminally differentiated skeletal myotubes (8, 19, 40), it was of interest to know whether Def-6 is endogenously expressed in these cell types. To analyze this, RT-PCRs were performed with mRNA preparations from spleen and skeletal muscle originating from an adult c57/Bl6 mouse. The spleen RNA was used as a positive control and resulted in a Def-6 RT-PCR product of the expected size. Interestingly, a clear and specific Def-6 PCR product was also amplified from the skeletal muscle mRNA preparation (Fig. 4A). In a parallel PCR reaction, the existence of 7A mRNA was checked with primers, which amplify both 7A and 7B but result in different PCR fragments of different length. As expected, 7A as well as 7B chains were found in muscle tissue according to previous reports (19). 7B mRNA was also found in spleen tissue, which probably originates from smooth muscle cells of blood vessels expressing only this splice variant of the integrin 7 chain (18).

View larger version (48K): [in this window] [in a new window]   FIGURE 4. Endogenous expression of Def-6. Mouse tissues and C2C12 cells were analyzed for expression of Def-6. A and B, different mRNA preparations were analyzed by RT-PCR. The different primer combinations led to the amplification of specific PCR fragments of Def-6, 7 integrin chain or glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The 7 primers anneal to both splice variants (7A and 7B), resulting in different lengths of the PCR product. The C2C12 cultures were harvested at different times after the switch to differentiation medium (day 0). C and D, radioimmune precipitation assay lysates from different mouse tissues and C2C12 cells were analyzed by immunoblotting (used antibodies are indicated). HEK293 cells, which overexpressed Def-6 protein, were used as a positive control for the anti-Def-6 serum. Dots in C indicate 32, 56, and 88 kDa. 50 µg of total protein was loaded per lane. n.d., not determined.

To extend these expression studies to the protein level, a polyclonal rabbit serum was raised against Def-6 and subsequently affinity-purified. The specificity of this serum was confirmed by immunoblotting lysates from HEK293 cells overexpressing Def-6 protein (Fig. 4C, last two lanes). Compared with lysate from non-transfected HEK293 cells, this serum detects a strong signal at 75 kDa, which corresponds to the molecular mass of murine Def-6 (37). Lysates of different mouse tissues were then analyzed by immunoblotting with this antibody (Fig. 4C). As expected, the highest expression of Def-6 protein was detected in thymus and spleen. Interestingly, Def-6 protein was also present in all organs tested, including different muscle tissues (heart, tongue, and skeletal muscle (Fig. 4C)). Additionally, lysates from differentiating C2C12 cells were analyzed for Def-6 protein. In accordance to the RT-PCR data, the expression of Def-6 protein was not changed during the differentiation (Fig. 4D). The proper differentiation of the C2C12 cells was confirmed by immunoblot analyzes of the same lysates with antibodies against the muscle-specific marker "slow myosin heavy chain" and the A splice isoform of the 7 integrin chain. Taken together, these results demonstrate that Def-6 is endogenously expressed in several mouse tissues and cells, including skeletal muscle and in the myoblast cell line C2C12.

Next we questioned if endogenous Def-6 protein in C2C12 myoblasts is phosphorylated and if this phosphorylation changes during myogenic differentiation. We performed immunoprecipitations of tyrosine-phosphorylated proteins from C2C12 cells. To avoid a potential coprecipitation instead of a direct precipitation, the immunoprecipitation was performed after a denaturing treatment of the cell lysates. Indeed, Def-6 was found to be tyrosine-phosphorylated in myoblasts and myotubes at a low level, because it was detected in the precipitates by immunoblotting of the precipitates with polyclonal Def-6 antibody (Fig. 3D). The relative amount of phosphorylated Def-6 changed little from myoblasts to myotubes. Specificity of the immunoprecipitation was confirmed by using the 9E10 antibody as a control, by which Def-6 was not precipitated.

Def-6 Localizes at Cell Protrusions and Focal Adhesions—To investigate the subcellular localization of Def-6, different cell types (NIH-3T3, HeLa, and C2C12) were transfected with expression constructs for Def-6 and subsequently analyzed by immunofluorescence microscopy (Fig. 5). The protein was found to localize to the edge of lamellipodial cell protrusions (Fig. 5A) and to focal adhesions (Fig. 5B).

Next we wanted to study whether the intracellular localization of Def-6 is influenced by the 7A1 integrin receptor in myogenic cells. We first tried using the polyclonal anti-Def-6 antibody, but this resulted in inconclusive staining of C2C12 myoblasts.⁵ Despite a well detectable band of endogenous Def-6 protein in immunoblotting analysis of C2C12 lysates (Fig. 4D), its expression seemed to be below the level of detection for immunofluorescence applications. To overcome this problem, Def-6 protein was stably overexpressed in C2C12 cells (Fig. 5C, left panel). Because undifferentiated myoblasts express only integrin 7B1, the 7A subunit was also expressed by a retroviral gene transfer in Def-6-overexpressing C2C12 cells. Myoblasts infected with retroviruses for 7B expression served as a control. The expression of the integrin 7A chain was confirmed by immunoblotting (Fig. 5C, right panel). These cells were plated on coverslips precoated with laminin-111, an ECM substrate for the 71 receptor. The immunofluorescence analysis of these cells revealed that Def-6 localizes to focal adhesions and lamellipodia, as seen in fibroblasts (NIH-3T3) and epithelia cells (HeLa). Further, in these structures Def-6 localization partially overlaps with laminin-binding 71 integrin. The same observations were noted for 7A- and 7B-expressing cells (Fig. 5, D and E).

View larger version (35K): [in this window] [in a new window]   FIGURE 5. Subcellular localization of Def-6. A and B, different cell types were transiently transfected with a Def-6 expression construct, plated on coverslips, and stained for immunofluorescence. A, NIH-3T3 fibroblast plated on laminin-111; a, Def-6; b, actin; c, merged image; image d represents a higher magnification of the frame in image c. B, HeLa cell; red, Def-6; green, actin. C, C2C12 myoblasts were stably transduced with an expression construct for Def-6 (left panel). These Def-6-overexpressing cells were subsequently transduced with expression constructs for the integrin chain 7A or 7B. Expression of 7A was verified by immunoblotting (right panel). D and E, cells were plated on laminin-111-coated coverslips. D, 7A/Def-6-expressing C2C12 cells. E, 7B/Def-6-expressing C2C12 cells. Cells in D and E were stained for Def-6 (D, panel a and E, panel a) and the 7 integrin chain (D, panel b and E, panel b). Merged images are shown in D, panel c and E, panel c. The white arrows indicate regions of partial colocalization. F and G, Def-6-overexpressing C2C12 cells were fixed, stained either as myoblasts (F) or as differentiated myotubes (G), and analyzed using confocal microscopy. Panels: a, Def-6; b, 7 integrin chain; and c, merged image. The white bars represent 10 µm.

To study where Def-6 localizes in C2C12 cells during the differentiation from myoblasts to myotubes we used the Def-6-overexpressing C2C12 cells (Fig. 5C, left panel). The cells were plated on uncoated coverslips and subsequently induced to differentiate. In undifferentiated myoblasts we again detected Def-6 in cellular protrusions (Fig. 5F). In myotubes Def-6 localized to the sarcolemma where a clear colocalization with the integrin 7 chain could be observed (Fig. 5G). It is worth noting that the analyzed myotubes (day 4 after induction of differentiation) express endogenously the integrin 7A chain.

Def-6 Influences Differentiation of C2C12 Myoblasts—During differentiation of myoblasts expression of the 7A integrin chain is gradually up-regulated. Because Def-6 binds to the cytoplasmic tail of 7A, we next tested if myogenic differentiation of the Def-6-overexpressing C2C12 cells is affected. C2C12 cells, which were infected with an empty-vector virus, expressed only the endogenous level of Def-6 and served as a control (Fig. 5C, left panel). These cells were plated on 6-well dishes, and differentiation was induced after 24 h. Progression of morphological changes in the differentiating cultures were monitored by microscopy (Fig. 6A). Empty vector-infected C2C12 cells aligned and fused normally like uninfected cells. Fusion of control cells started to occur on day 2 after growth factor deprivation. On day 5 they showed a high density of parallel arrays of thin and mainly unbranched myotubes. Def-6-overexpressing myoblasts also began to fuse on day 2, but in contrast to empty vector-infected cells they tended to lose contact to the tissue culture dish, which resulted in lower cell density. In addition, the myotube formation of Def-6-overexpressing cells was severely impaired. A subset of these cells formed strongly branched and very thick myotubes after 3 days (Fig. 6, B and C). Nevertheless, the control cells as well as the Def-6-overexpressing cells underwent myogenic differentiation, because sarcomeric myosin was expressed in both cases (MF-20 staining, Fig. 6B). Measuring the thickness of fused myotubes revealed that those originating from Def-6-overexpressing C2C12 cells had about twice the diameter compared with control myotubes (Fig. 6C). In addition, differentiated Def-6-overexpressing C2C12 cultures exhibited an unusually high fusion index (Def-6-overexpressing cells: fusion index > 0.4; control cells: fusion index = 0.26; Fig. 6D), and such myotubes had an increased amount of nuclei (Def-6-overexpressing myotubes: 40 nuclei; control myotubes: 15 nuclei; Fig. 6E). The nuclei were often accumulated in clusters at branch points of the myotubes (arrows in Fig. 6B).

View larger version (127K): [in this window] [in a new window]   FIGURE 6. Def-6 overexpression impairs differentiation of C2C12 myoblasts. A, myogenic differentiation of C2C12-control or Def-6-overexpressing C2C12 cells was induced by switching the culture medium to differentiation medium (day 0). Phase micrographs of differentiating cells were taken at different times (days 1, 3, and 5). Def-6-overexpressing C2C12 cells formed arrays of unparallel and branched myotubes and cells tended to detach from the tissue culture dish during differentiation. B, differentiating cultures were fixed on day 3 and stained with 4',6-diamidino-2-phenylindole and the myogenic differentiation sarcomeric myosin (MF-20). The arrows indicate clusters of nuclei in myotubes originating from Def-6 overexpressing C2C12 cells. C-E, different parameters of differentiating C2C12 control cells and two different Def-6-overexpressing clones. Def-6-overexpressing C2C12 cells developed myotubes with increased average diameter (C) and number of nuclei per myotube (E). The fusion index of Def-6-overexpressing C2C12 cells was also increased (D). Data in C-E are mean ± S.E.

Taken together, these experiments show that overexpression of Def-6 in C2C12 myoblasts impairs the down-regulation of Rac1 activity, causing dysregulated formation of unusually thick and branched myotubes.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Here we report a specific interaction between the Rac1 GEF Def-6 and the cytoplasmic domain of the integrin chain 7A, which is a splice isoform expressed exclusively in skeletal muscle tissues. This interaction was found to be inhibited by a tyrosine phosphorylation of Def-6, which was described to stimulate the GEF activity of this protein. Further, we show a widespread tissue distribution of Def-6, including different muscle types and the C2C12 myoblast cell line. The protein localizes to cellular protrusions and focal adhesions where it overlaps with 71 distribution. Overexpression of Def-6 in C2C12 myoblasts leads to elevated Rac1.GTP levels and altered myogenic differentiation.

The process of muscle development and regeneration is a complex cascade of numerous cell functions, which finally lead to the formation of myofibers. Undifferentiated myoblasts proliferate and migrate on ECM substrates (12, 42), align with each other, and eventually fuse to form multicellular myotubes (43). This process is accompanied by a cell cycle arrest and expression of muscle-specific genes (44). Both, Rac1 and 71 integrin were described to affect differentiation and maintenance of muscles (9, 23). Because the integrin 7A chain is a splice isoform exclusively expressed in skeletal muscle cells and Def-6 is a GEF for Rac1, this interaction could provide a skeletal muscle-specific signaling link between integrin 71 and the Rho GTPase Rac1.

Integrin 71 was shown to be important for development and homeostasis of muscles, because mice deficient for the integrin 7 chain show both a partial embryonic lethality and muscular dystrophy in adult animals (14). Interestingly, integrin 51 is up-regulated in 7-deficient mice (45); however, the compensation is obviously incomplete, because severe muscle wasting can be observed in these animals. This may be at least partly due to the fact that 51 is a fibronectin receptor instead of a laminin receptor. In addition, the intracellular domains of the 5 and both 7 splice isoforms are different, which implies diverse intracellular protein interactions and signaling events. So far, all experiments attempting to elucidate the signaling capacity of the 7 intracellular domain were performed with 7B-expressing cells or in myoblasts where the exact expression of splice isoforms was not analyzed. Mielenz and coworkers (21) found that 7B interacts with a p130^CAS/crk complex. The muscle integrin-binding protein was shown to interact with 7B, thereby regulating laminin matrix deposition and paxillin signaling (46). FHL2 and FHL3 bind to 7A and 7B, but not to 5 (28), which may be one reason for the failure of integrin 5 compensation in 7-deficient mice. FHL2 and FHL3 were also found to bind to actin (47), which suggests that they may link 7A and 7B to the actin cytoskeleton. All this could be necessary to provide a more stable connection between integrins and the cytoskeleton, to resist the strong mechanical forces acting on muscle cells. Interestingly, the muscle-specific splice variant 1D was also shown to provide a stronger link to the actin cytoskeleton (48). However, although FHL2 and FHL3 are the only proteins found to bind to the 7A cytoplasmic domain, these interactions are not exclusive, because other integrin cytoplasmic domains (including 7B) also interact with FHL2 and FHL3 (28, 29). No functional data about a specific and exclusive role for 7A1 have yet been obtained, and the question why muscles express 7A and 7B splice variants has not been answered so far. Likewise, the tissue distribution and subcellular localization of 7A does not give a conclusive indication about a specific function. Except for the finding that the 7A splice isoform only occurs in differentiated skeletal muscles (19), 7A and 7B always codistribute within the muscle cell, for example at myotendinous and neuromuscular junctions (49). So far, 7A has not been reported to localize exclusively without 7B at any cellular compartment of muscle cells.

View larger version (38K): [in this window] [in a new window]   FIGURE 7. Elevated Rac1.GTP levels in Def-6-overexpressing C2C12 myoblasts during differentiation. A, the amount of Rac1.GTP in differentiating C2C12 cultures was determined at different times by precipitating Rac1.GTP from total cell lysates using GST-PBD (left panel) as described under "Experimental Procedures." The panel on the right shows immunoblotting of equal amounts of total cell lysates. Compared with empty vector-infected C2C12 cells, Def-6-overexpressing cells had a delayed decrease of Rac1.GTP levels during differentiation. Only later (days 4 and 5), Def-6-overexpressing cells also decreased the amount of activated Rac1.GTP. B, immunoblots that show expression of Def-6, sarcomeric myosin (MF20), and 7A integrin in differentiating C2C12 control and Def-6-overexpressing cells.

Def-6 and Swap-70 represent a novel family of Rho-GEFs that have recently been described (26, 27). The classic arrangement of DH/PH domains is inverted in these GEFs. In addition, the degree of homology of the Def-6 and Swap-70 DH-like domains to other DH domains is not significant, and a potential coiled-coil stretch was identified within this region (50). So far, Def-6 was reported to be mainly associated with functions of lymphocytes with highest expression in T-cells and T-cell homing organs (26, 37, 38). Here we confirmed the high expression of Def-6 in the thymus as a T-cell compartment (Fig. 4C), but additionally we detected Def-6 mRNA and protein expression in all tested organs, including muscle tissues (heart, skeletal muscle, and tongue) and the C2C12 myoblast cell line. After initial reports that expression of Swap-70 is almost exclusively restricted to B-cells (51), it turned out that this protein is present in a more widespread manner (52) with a signaling function upstream of Rac1 (27). Likewise, our RT-PCR analysis also revealed Swap-70 expression in skeletal muscle tissue.⁵ Similarly, our expression analysis of Def-6 also showed a more general distribution, indicating that it functions in cell types other than T-cells. Mavrakis and coworkers (35) have already suggested endogenous expression of Def-6 in NIH-3T3 fibroblasts.

Rac1 activity levels and its downstream signaling effects during myoblast differentiation are still an active field of discussion and controversy (23). Overall, Rac1 activity has to decrease for proper myoblast differentiation, because overexpression of constitutive active Rac1 in C2C12 myoblasts leads to impairment of differentiation (24). However, several steps during myogenesis seem to require Rac1 activity in certain compartments of the cell. Rac1.GTP is required for the formation of acetylcholine clusters, and overexpression of constitutively active Rac1 increases the clustering of acetylcholine receptors on myotubes (25). Expression of muscle-specific genes in the nuclear compartment were shown to be regulated by Rac1, even though the results are inconsistent concerning the mode of regulation (53, 54). In founder cells of forming muscles in Drosophila, Rac1 becomes specifically aggregated at fusion sites (55). In summary, all these findings indicate that Rac1 regulates certain locally restricted steps of differentiation, even though the net Rac1 activity level decreases in differentiating myoblasts.

It is thus interesting that we found an interaction of a Rac1 GEF and a muscle-specific integrin, which is regulated during myogenesis. Indeed, focal adhesions containing 7A also contained Def-6, even though we observed Def-6 localization to focal adhesions independently of 7A as well. Thus, subcellular localization of Def-6 must be guided by interactions with other proteins or binding of the Def-6-PH domain to phosphatidylinositol phosphates. Def-6 membrane localization was previously shown to be dependent on phosphatidylinositol 3-kinase activity (35). Because Def-6 does not bind to 7A when it is tyrosine-phosphorylated, this interaction could provide a mechanism to recruit inactive Def-6 to certain areas of the cell. Because 7A is up-regulated during differentiation, it might act to sequester inactive Def-6, thereby contributing to the general decrease in Rac1 activity that accompanies myogenesis. Alternatively, by recruiting Def-6 to specific sites where this integrin is concentrated, the association between 7A and Def-6 may allow local activation of Rac1 at these sites, for example by phosphorylation of Def-6 by Src family kinases.

Interestingly, the Src family kinase Yes is up-regulated and activated in differentiating myoblasts (56), and we indeed detected tyrosine-phosphorylated Def-6 in C2C12 myoblasts and myotubes. However, the amount of phosphorylated Def-6 was low, and the relative total amount of phosphorylated Def-6 did not change dramatically from myoblasts to myotubes, implying that Def-6 phosphorylation probably occurs only in a small area of the cell.

Down-regulation of Rac1 was shown to be essential for establishing the cell cycle exit of differentiating myoblasts (24). Overexpression of constitutive active Rac1 in differentiating myoblasts delays the cell cycle exit, and the resulting myotubes are much thicker. Interestingly, when we overexpressed Def-6 in C2C12 myoblasts, we observed the same phenotype. The myotubes were much thicker compared with control cells, and the number of nuclei was increased. The Rac1.GTP level in differentiating C2C12 myoblasts overexpressing Def-6 was initially higher compared with control cells. By day 5 it decreased to a level comparable to that found in control cells. This observation strongly suggests that the GEF activity of Def-6 is normally down regulated in differentiating myoblasts, because the overall Def-6 amount is not changed (Fig. 4D). Due to the high amount of Def-6 protein in overexpressing cells, this fine regulation is probably delayed, because mechanisms that normally down-regulate Def-6 GEF activity or the localization of Def-6 are overstrained.

To further analyze the role of Def-6 during myoblast differentiation, we also attempted to generate Def-6 knockdown cell lines. To date a successful knockdown of Def-6 has not been reported, and we did not get a reliable and efficient reduction of Def-6, despite numerous attempts using different RNA interference sequences and transfection methods.⁵ Similar difficulties with knocking down a different GEF (GEFT) in C2C12 myoblasts have been reported (57). The mouse knock-out models of both Def-6 and Swap-70 genes have been generated (58-60), but the published reports have focused on lymphocyte-specific functions only. Whether muscle functions are affected in these mice has not been reported, and it might be that a mild muscle phenotype was not yet detected. On the other hand, it is possible that Def-6 and Swap-70 are functionally redundant, because both have GEF activity on Rac1, and both can bind to the same amino acid sequence in the cytoplasmic domain of 7A. Indeed, our PCR analysis also revealed Swap-70 in C2C12 myoblasts.⁵ Redundancy seems to be a general feature of GTPase regulators, as it was reported for the Vav GEF family (61) as well as the GTPase-activating proteins Bcr and Abr (62).

In summary, we have found that Def-6 and Swap-70 bind to the cytoplasmic part of the 7A integrin chain, which is the first description of a specific interaction with this integrin splice variant. Our data suggest that Def-6 as a GEF for Rac1 has a role during formation of myotubes. Def-6 and its activity have to be precisely regulated for proper differentiation of myoblasts. The interaction between 7A and Def-6 could serve as a mechanism to locally restrict Def-6 GEF activity within differentiating cells. We hope to clarify this question by employing recently developed FRET-based biosensor technologies, which allow measurement of locally restricted Rac1 activity.

	FOOTNOTES

 
^* This work was supported by the Deutsche Forschungsgemeinschaft (DFG) Sa 1636/1-1 (to T. S.) and DFG Wi 1235/4-1 (to V. W.) and by National Institutes of Health Grant GM29860 (to K. B.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

² Both authors contributed equally to this work.

¹ To whom correspondence should be addressed: Dept. of Cell and Developmental Biology, Lineberger Comprehensive Cancer Center, CB#7295, University of North Carolina, Chapel Hill, NC 27599. Tel.: 919-966-5783; Fax: 919-966-3015; E-mail: thomas_samson{at}med.unc.edu.

³ The abbreviations used are: ECM, extracellular matrix; GEF, guanine nucleotide exchange factor; RT, reverse transcription; DBD, DNA-binding domain; AD, activation domain; GST, glutathione S-transferase; DHL, dbl-homology-like.

⁴ Nomenclature of laminin isoforms according to Aumailley et al. (63).

⁵ T. Samson, C. Will, A. Knoblauch, L. Sharek, K. von der Mark, K. Burridge, and V. Wixler, unpublished observation.

	ACKNOWLEDGMENTS

 
We thank J. van Buul, R. Garcia-Mata, and A. Dubash for critical reading of the manuscript. We are grateful to U. Mayer for anti-7A polyclonal antibody and to the Michael Hooker Microscopy Facility, University of North Carolina, Chapel Hill for technical assistance. The monoclonal antibody MF20 developed by D. A. Fischman was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD, National Institutes of Health and maintained by The University of Iowa.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Hynes, R. O. (2002) Cell 110, 673-687[CrossRef][Medline] [Order article via Infotrieve]
2. DeMali, K. A., Wennerberg, K., and Burridge, K. (2003) Curr. Opin. Cell Biol. 15, 572-582[CrossRef][Medline] [Order article via Infotrieve]
3. Giancotti, F. G., and Ruoslahti, E. (1999) Science 285, 1028-1032[Abstract/Free Full Text]
4. Ginsberg, M. H., Partridge, A., and Shattil, S. J. (2005) Curr. Opin. Cell Biol. 17, 509-516[CrossRef][Medline] [Order article via Infotrieve]
5. Kinashi, T. (2005) Nat. Rev. Immunol. 5, 546-559[CrossRef][Medline] [Order article via Infotrieve]
6. Nayal, A., Webb, D. J., and Horwitz, A. F. (2004) Curr. Opin. Cell Biol. 16, 94-98[CrossRef][Medline] [Order article via Infotrieve]
7. van der Flier, A., and Sonnenberg, A. (2001) Cell Tissue Res. 305, 285-298[CrossRef][Medline] [Order article via Infotrieve]
8. Burkin, D. J., and Kaufman, S. J. (1999) Cell Tissue Res. 296, 183-190[CrossRef][Medline] [Order article via Infotrieve]
9. Mayer, U. (2003) J. Biol. Chem. 278, 14587-14590[Free Full Text]
10. von der Mark, H., Williams, I., Wendler, O., Sorokin, L., von der Mark, K., and Poschl, E. (2002) J. Biol. Chem. 277, 6012-6016[Abstract/Free Full Text]
11. Yao, C. C., Ziober, B. L., Squillace, R. M., and Kramer, R. H. (1996) J. Biol. Chem. 271, 25598-25603[Abstract/Free Full Text]
12. von der Mark, K., and Ocalan, M. (1989) Differentiation 40, 150-157[Medline] [Order article via Infotrieve]
13. Xu, H., Wu, X. R., Wewer, U. M., and Engvall, E. (1994) Nat. Genet. 8, 297-302[CrossRef][Medline] [Order article via Infotrieve]
14. Mayer, U., Saher, G., Fassler, R., Bornemann, A., Echtermeyer, F., von der Mark, H., Miosge, N., Poschl, E., and von der Mark, K. (1997) Nat. Genet. 17, 318-323[Medline] [Order article via Infotrieve]
15. Song, W. K., Wang, W., Sato, H., Bielser, D. A., and Kaufman, S. J. (1993) J. Cell Sci. 106, 1139-1152[Abstract]
16. Ziober, B. L., Vu, M. P., Waleh, N., Crawford, J., Lin, C. S., and Kramer, R. H. (1993) J. Biol. Chem. 268, 26773-26783[Abstract/Free Full Text]
17. Ziober, B. L., Chen, Y., and Kramer, R. H. (1997) Mol. Biol. Cell 8, 1723-1734[Abstract]
18. Collo, G., Starr, L., and Quaranta, V. (1993) J. Biol. Chem. 268, 19019-19024[Abstract/Free Full Text]
19. Velling, T., Collo, G., Sorokin, L., Durbeej, M., Zhang, H., and Gullberg, D. (1996) Dev. Dyn. 207, 355-371[CrossRef][Medline] [Order article via Infotrieve]
20. Kaariainen, M., Nissinen, L., Kaufman, S., Sonnenberg, A., Jarvinen, M., Heino, J., and Kalimo, H. (2002) Am. J. Pathol. 161, 1023-1031[Abstract/Free Full Text]
21. Mielenz, D., Hapke, S., Poschl, E., von Der Mark, H., and von Der Mark, K. (2001) J. Biol. Chem. 276, 13417-13426[Abstract/Free Full Text]
22. Etienne-Manneville, S., and Hall, A. (2002) Nature 420, 629-635[CrossRef][Medline] [Order article via Infotrieve]
23. Bryan, B. A., Li, D., Wu, X., and Liu, M. (2005) Cell Mol. Life Sci. 62, 1547-1555[CrossRef][Medline] [Order article via Infotrieve]
24. Heller, H., Gredinger, E., and Bengal, E. (2001) J. Biol. Chem. 276, 37307-37316[Abstract/Free Full Text]
25. Weston, C., Yee, B., Hod, E., and Prives, J. (2000) J. Cell Biol. 150, 205-212[Abstract/Free Full Text]
26. Gupta, S., Fanzo, J. C., Hu, C., Cox, D., Jang, S. Y., Lee, A. E., Greenberg, S., and Pernis, A. B. (2003) J. Biol. Chem. 278, 43541-43549[Abstract/Free Full Text]
27. Shinohara, M., Terada, Y., Iwamatsu, A., Shinohara, A., Mochizuki, N., Higuchi, M., Gotoh, Y., Ihara, S., Nagata, S., Itoh, H., Fukui, Y., and Jessberger, R. (2002) Nature 416, 759-763[CrossRef][Medline] [Order article via Infotrieve]
28. Samson, T., Smyth, N., Janetzky, S., Wendler, O., Muller, J. M., Schule, R., von der Mark, H., von der Mark, K., and Wixler, V. (2004) J. Biol. Chem. 279, 28641-28652[Abstract/Free Full Text]
29. Wixler, V., Geerts, D., Laplantine, E., Westhoff, D., Smyth, N., Aumailley, M., Sonnenberg, A., and Paulsson, M. (2000) J. Biol. Chem. 275, 33669-33678[Abstract/Free Full Text]
30. Morgenstern, J. P., and Land, H. (1990) Nucleic Acids Res. 18, 3587-3596[Abstract/Free Full Text]
31. Markowitz, D. G., Goff, S. P., and Bank, A. (1988) Trans Assoc. Am. Physicians 101, 212-218[Medline] [Order article via Infotrieve]
32. Evan, G. I., Lewis, G. K., Ramsay, G., and Bishop, J. M. (1985) Mol. Cell Biol. 5, 3610-3616[Abstract/Free Full Text]
33. Schober, S., Mielenz, D., Echtermeyer, F., Hapke, S., Poschl, E., von der Mark, H., Moch, H., and von der Mark, K. (2000) Exp. Cell Res. 255, 303-313[CrossRef][Medline] [Order article via Infotrieve]
34. Ren, X. D., Kiosses, W. B., and Schwartz, M. A. (1999) EMBO J. 18, 578-585[CrossRef][Medline] [Order article via Infotrieve]
35. Mavrakis, K. J., McKinlay, K. J., Jones, P., and Sablitzky, F. (2004) Exp. Cell Res. 294, 335-344[CrossRef][Medline] [Order article via Infotrieve]
36. Jullien, P., Bougeret, C., Camoin, L., Bodeus, M., Durand, H., Disanto, J. P., Fischer, S., and Benarous, R. (1994) Eur. J. Biochem. 224, 589-596[Medline] [Order article via Infotrieve]
37. Gupta, S., Lee, A., Hu, C., Fanzo, J., Goldberg, I., Cattoretti, G., and Pernis, A. B. (2003) Hum. Immunol. 64, 389-401[CrossRef][Medline] [Order article via Infotrieve]
38. Hotfilder, M., Baxendale, S., Cross, M. A., and Sablitzky, F. (1999) Br. J. Haematol. 106, 335-344[CrossRef][Medline] [Order article via Infotrieve]
39. Tanaka, Y., Bi, K., Kitamura, R., Hong, S., Altman, Y., Matsumoto, A., Tabata, H., Lebedeva, S., Bushway, P. J., and Altman, A. (2003) Immunity 18, 403-414[CrossRef][Medline] [Order article via Infotrieve]
40. Vignier, N., Moghadaszadeh, B., Gary, F., Beckmann, J., Mayer, U., and Guicheney, P. (1999) Biochem. Biophys. Res. Commun. 260, 357-364[CrossRef][Medline] [Order article via Infotrieve]
41. Blau, H. M., Pavlath, G. K., Hardeman, E. C., Chiu, C. P., Silberstein, L., Webster, S. G., Miller, S. C., and Webster, C. (1985) Science 230, 758-766[Abstract/Free Full Text]
42. Ocalan, M., Goodman, S. L., Kuhl, U., Hauschka, S. D., and von der Mark, K. (1988) Dev. Biol. 125, 158-167[CrossRef][Medline] [Order article via Infotrieve]
43. Taylor, M. V. (2002) Curr. Biol. 12, R224-R228[CrossRef][Medline] [Order article via Infotrieve]
44. Sabourin, L. A., and Rudnicki, M. A. (2000) Clin. Genet. 57, 16-25[CrossRef][Medline] [Order article via Infotrieve]
45. Nawrotzki, R., Willem, M., Miosge, N., Brinkmeier, H., and Mayer, U. (2003) Hum Mol. Genet 12, 483-495[Abstract/Free Full Text]
46. Li, J., Rao, H., Burkin, D., Kaufman, S. J., and Wu, C. (2003) Dev. Biol. 261, 209-219[CrossRef][Medline] [Order article via Infotrieve]
47. Coghill, I. D., Brown, S., Cottle, D. L., McGrath, M. J., Robinson, P. A., Nandurkar, H. H., Dyson, J. M., and Mitchell, C. A. (2003) J. Biol. Chem. 278, 24139-24152[Abstract/Free Full Text]
48. Belkin, A. M., Retta, S. F., Pletjushkina, O. Y., Balzac, F., Silengo, L., Fassler, R., Koteliansky, V. E., Burridge, K., and Tarone, G. (1997) J. Cell Biol. 139, 1583-1595[Abstract/Free Full Text]
49. Burkin, D. J., Gu, M., Hodges, B. L., Campanelli, J. T., and Kaufman, S. J. (1998) J. Cell Biol. 143, 1067-1075[Abstract/Free Full Text]
50. Rossman, K. L., Der, C. J., and Sondek, J. (2005) Nat. Rev. Mol. Cell Biol. 6, 167-180[CrossRef][Medline] [Order article via Infotrieve]
51. Borggrefe, T., Wabl, M., Akhmedov, A. T., and Jessberger, R. (1998) J. Biol. Chem. 273, 17025-17035[Abstract/Free Full Text]
52. Borggrefe, T., Masat, L., Wabl, M., Riwar, B., Cattoretti, G., and Jessberger, R. (1999) Eur. J. Immunol. 29, 1812-1822[CrossRef][Medline] [Order article via Infotrieve]
53. Gallo, R., Serafini, M., Castellani, L., Falcone, G., and Alema, S. (1999) Mol. Biol. Cell 10, 3137-3150[Abstract/Free Full Text]
54. Takano, H., Komuro, I., Oka, T., Shiojima, I., Hiroi, Y., Mizuno, T., and Yazaki, Y. (1998) Mol. Cell Biol. 18, 1580-1589[Abstract/Free Full Text]
55. Chen, E. H., Pryce, B. A., Tzeng, J. A., Gonzalez, G. A., and Olson, E. N. (2003) Cell 114, 751-762[CrossRef][Medline] [Order article via Infotrieve]
56. Rosoff, W. J., and Swope, S. L. (2002) J. Cell Physiol. 193, 328-339[CrossRef][Medline] [Order article via Infotrieve]
57. Bryan, B. A., Mitchell, D. C., Zhao, L., Ma, W., Stafford, L. J., Teng, B. B., and Liu, M. (2005) Mol. Cell Biol. 25, 11089-11101[Abstract/Free Full Text]
58. Borggrefe, T., Keshavarzi, S., Gross, B., Wabl, M., and Jessberger, R. (2001) Eur. J. Immunol. 31, 2467-2475[CrossRef][Medline] [Order article via Infotrieve]
59. Fanzo, J. C., Yang, W., Jang, S. Y., Gupta, S., Chen, Q., Siddiq, A., Greenberg, S., and Pernis, A. B. (2006) J. Clin. Invest. 116, 703-714[CrossRef][Medline] [Order article via Infotrieve]
60. Gross, B., Borggrefe, T., Wabl, M., Sivalenka, R. R., Bennett, M., Rossi, A. B., and Jessberger, R. (2002) Eur. J. Immunol. 32, 1121-1128[CrossRef][Medline] [Order article via Infotrieve]
61. Tedford, K., Nitschke, L., Girkontaite, I., Charlesworth, A., Chan, G., Sakk, V., Barbacid, M., and Fischer, K. D. (2001) Nat. Immunol 2, 548-555[CrossRef][Medline] [Order article via Infotrieve]
62. Kaartinen, V., Gonzalez-Gomez, I., Voncken, J. W., Haataja, L., Faure, E., Nagy, A., Groffen, J., and Heisterkamp, N. (2001) Development 128, 4217-4227[Abstract/Free Full Text]
63. Aumailley, M., Bruckner-Tuderman, L., Carter, W. G., Deutzmann, R., Edgar, D., Ekblom, P., Engel, J., Engvall, E., Hohenester, E., Jones, J. C., Kleinman, H. K., Marinkovich, M. P., Martin, G. R., Mayer, U., Meneguzzi, G., Miner, J. H., Miyazaki, K., Patarroyo, M., Paulsson, M., Quaranta, V., Sanes, J. R., Sasaki, T., Sekiguchi, K., Sorokin, L. M., Talts, J. F., Tryggvason, K., Uitto, J., Virtanen, I., von der Mark, K., Wewer, U. M., Yamada, Y., and Yurchenco, P. D. (2005) Matrix Biol. 24, 326-332[CrossRef][Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				J. Liu, P. B. Gurpur, and S. J. Kaufman Genetically Determined Proteolytic Cleavage Modulates {alpha}7{beta}1 Integrin Function J. Biol. Chem., December 19, 2008; 283(51): 35668 - 35678. [Abstract] [Full Text] [PDF]

				K. V. Pajcini, J. H. Pomerantz, O. Alkan, R. Doyonnas, and H. M. Blau Myoblasts and macrophages share molecular components that contribute to cell-cell fusion J. Cell Biol., March 5, 2008; 180(5): 1005 - 1019. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 282/21/15730    most recent M611197200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Samson, T. Articles by Wixler, V. Search for Related Content PubMed PubMed Citation Articles by Samson, T. Articles by Wixler, V. Social Bookmarking                      What's this?