Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M701083200 on May 3, 2007

J. Biol. Chem., Vol. 282, Issue 26, 18945-18952, June 29, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/26/18945    most recent
M701083200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, J.
Right arrow Articles by Ren, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, J.
Right arrow Articles by Ren, D.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

CatSperbeta, a Novel Transmembrane Protein in the CatSper Channel Complex*

Jin Liu{ddagger}, Jingsheng Xia{ddagger}, Kwang-Hyun Cho{ddagger}, David E. Clapham§, and Dejian Ren{ddagger}1

From the {ddagger}Department of Biology, University of Pennsylvania, Philadelphia, Pennsylvania 19104 and §Howard Hughes Medical Institute, Enders 1309, Children's Hospital Boston, Boston, Massachusetts 02115

Received for publication, February 5, 2007 , and in revised form, April 26, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Four CatSper ion channel subunit genes (CatSpers 1-4) are required for sperm cell hyperactivation and male fertility. The four proteins assemble (presumably as a tetramer) to form a sperm-specific, alkalinization-activated Ca2+-selective channel. We set out to identify proteins associating with CatSper that might help explain its unique role in spermatozoa. Using a transgenic approach, a CatSper1 complex was purified from mouse testis that contained heat shock protein 70-2, a testis-specific chaperone, and CatSperbeta, a novel protein with two putative transmembrane-spanning domains. Like the CatSper ion channel subunits, CatSperbeta was restricted to testis and localized to the principal piece of the sperm tail. CatSperbeta protein is absent in CatSper1-/- sperm, suggesting that it is required for trafficking or formation of a stable channel complex. CatSperbeta is the first identified auxiliary protein to the CatSper channel.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
During mammalian fertilization, Ca2+ is crucial for sperm capacitation, motility, the acrosome reaction, sperm-egg fusion, and the activation of the fertilization wave in eggs (1). Depolarization, intracellular alkalization, progesterone, cyclic nucleotides, and egg coat proteins trigger Ca2+ influx in mammalian sperm (1-4). The dominant Ca2+-selective current in epididymal sperm is mediated via CatSper, although transient receptor potential (TRP), CaV, and cyclic nucleotide-gated channel proteins have been detected in sperm cells and their precursors (see Refs. 5-7 for review). Of >20 ion channel genes disrupted in mice, only CatSper family mutations result in male infertility (6).

CatSpers1-4 are expressed in testis and localized primarily to the principal piece of sperm tail (8-12). CatSpers are most closely related to the six-transmembrane (TM)2 voltage-gated sodium channel (NaVBP) in bacteria, with the next closest relatives being the large mammalian CaV and NaV channels (13). CatSpers contain positively charged amino acids interspersed within their S4 transmembrane segments, suggesting they are voltage-sensitive channel subunits. CatSper1 is relatively unique and contains a remarkable abundance of histidine residues in its amino terminus, perhaps related to the known pH sensitivity of the CatSper Ca2+ current (14). CatSpers are also present in sea urchin and the ascidian Ciona intestinalis (15).

Targeted disruption of the mouse CatSper1 resulted in complete male infertility in an otherwise normal mouse (9). Although mutant mouse mating behavior, sperm count, and sperm cell morphology were indistinguishable from wild type (WT) mice, mutant sperm motility was abnormal. These sperm had reduced basal velocity and lacked vigorous beating and bending in the tail region. Mutant spermatozoa failed to fertilize intact eggs but could fertilize those in which their outer layers had been enzymatically removed (9). Further studies showed that CatSper null sperm cells could not be hyperactivated under physiological conditions (16, 17). Interestingly, depolarization evoked an increase in intracellular Ca2+ ([Ca2+]i) in WT sperm cells, but not in CatSper1 null spermatozoa (16). The phenotype of CatSper2, 3, and 4-/- mice was indistinguishable from CatSper1-/- mice, and their sperm also lacked the hyperactivated motility needed for fertilization (12, 18). Whole sperm patch clamp of epididymal sperm showed that CatSper current is absent in CatSper1, 2, 3, and 4-/- mice (12, 14). Finally, CatSper genes appear to have similarly important roles in human fertility. Subfertile men with deficient sperm cell motility had significantly reduced expression of CatSper1 (19). CatSper2 has been implicated by linkage analysis in human asthenoteratozoospermia (20).

Despite the essential roles of CatSper proteins in sperm Ca2+ signaling and mammalian fertilization, detailed biophysical and structure-function studies have been hindered by the lack of function in heterologous expression systems essential for these studies. None of the four mammalian CatSper channel subunits expressed in heterologous expression systems, alone (HEK293 cells, Chinese hamster ovary-K1 cells) or in combination (Xenopus oocytes) (9),3 produced detectable ICatSper. Similarly, two CatSper homologs from sea urchin testis and two from ascidian C. intestinalis did not yield current when expressed in mammalian cells and Xenopus oocytes.3 In contrast, the functions of the majority of the several hundred channels (K+, Cl-, Ca2+, Na+, CNG (cyclic nucleotide-gated), and transient receptor potential (TRP)) found in somatic cells have been faithfully reproduced in heterologous systems (21, 22).

One potential reason for the failure of functional heterologous expression is the lack of auxiliary subunits needed for proper channel trafficking, assembly, or gating. In this report, we describe a transgenic strategy to purify proteins associating with CatSper1. We found that a partial CatSper1 complex contained HSP70-2, a testis-specific HSP70 protein, and a novel transmembrane protein, CatSperbeta.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Transgenic Animal Generation—Animal protocols followed approved institutional regulations and guidelines. The CatSper1-/- mouse was previously described (9). A BAC clone containing the mouse CatSper1 gene (isolated from an sv129 genomic DNA library) was used to engineer a transgenic construct containing a genomic DNA fragment (~4 kb; from an NheI site) 5' to the CatSper1 open reading frame (ORF), and a fragment of ~9 kb covering the whole ORF, and 0.5 kb 3' to the ORF. A HA-eGFP fusion gene without a stop codon was synthesized by PCR using an eGFP vector (Clontech) as template. This mini-gene was inserted in-frame with the CatSper1 ORF (see Fig. 1 for detail). All fragments generated using PCR were sequenced to ensure that no unintended mutations were introduced. The insert, cloned in the pBluescript II SK vector (Stratagene), was excised, gel-purified, and used for pronuclear injection (Children's Hospital, Boston, MA). Founders carrying the transgene were identified by PCR. Males from two independent lines were subsequently crossed to CatSper1-/- females in order to engineer lines carrying the transgene but lacking WT CatSper1. Mice homozygous for the insertion were generated by crossing hemizygous mice and selected by semi-quantitative genomic PCR and mating tests.

Ca2+ Imaging—Ca2+ imaging was as previously described (9). Briefly, caudal sperm were collected, loaded with Fura-2, and seeded onto coverslips coated with Cell-Tak (BD Biosciences). The ratiometric dye Fura-2 was used to minimize contributions from GFP in the transgenic sperm. Signals collected in the head region were analyzed. Imaging and analysis employed an inverted fluorescence microscope (IX-71; Olympus) with monochromator (DeltaRAM V; PTI), a cooled CCD camera (CoolSNAP HQ; Roper Scientific), data acquisition system, and control software (ImageMaster; PTI). Only cells that were evenly loaded with dye and motile were chosen for analysis (T = 20-25 °C).

Sperm Whole-cell Patch Clamp Recordings—Sperm whole-cell patch clamp recordings followed previously described methods (14). Corpus epididymal sperm were collected from 3-7-month-old mice. Giga seals were formed between glass pipettes (7-10 M{Omega}) and the cell membrane of sperm cytoplasmic droplets. Pipette solutions contained (in mM) 135 cesiummethanesulfonate, 5 CsCl, 5 HEPES, 10 EGTA, 5 Na2ATP, and 0.5 Na2GTP (pH 7.2 with CsOH). HS bath solution contained (in mM) 135 NaCl, 5 KCl, 2 CaCl2, 1 MgSO4, 20 HEPES, 5 glucose, 10 lactic acid, and 1 pyruvic acid (pH adjusted to 7.4 with NaOH). Divalent-free Na+ bath solution contained (in mM) 150 sodium gluconate, 20 HEPES, 5 HEDTA (pH 7.4 with NaOH). In the absence of extracellular divalent ions, CatSper channels became permeable to monovalent cations (14), leading to an apparent reversal potential of ~0 mV in Fig. 2A. Recordings were made with an Axopatch 200B amplifier controlled by pCLAMP8.2 software through a Digidata 1322A interface (Axon). Signals were low pass-filtered at 1 kHz and sampled at 5 kHz.

Protein Purification—All purification steps were carried out at 4 °C unless otherwise stated. Frozen testes were homogenized in binding buffer (1.5 ml/testis) containing 50 mM NaH2PO4 and 300 mM NaCl, pH 8.0, supplemented with EDTA-free proteinase inhibitor mixture (protease inhibitor cocktail (PIC); Roche Applied Science). The homogenate was spun at 1,000 x g for 10 min at 4 °C. The supernatant was centrifuged at 100,000 x g for 50 min to obtain the microsomal fraction. ~100 mg of protein was solubilized for 1 h in 40 ml of buffer containing 50 mM NaH2PO4, 300 mM NaCl, 1x detergent and EDTA-free PIC, pH 8.0. Detergent contained 1% Nonidet P-40, 0.05% deoxycholate, and 0.1% SDS (radioimmune precipitation buffer) in one large scale purification, but only 1% Nonidet P-40 in several other such purifications. Following a 15-min spin, the supernatant was added to 1.5 ml of buffer-equilibrated cobalt resin and 1.6 ml of imidazole (1 M, pH 7.5), resulting in a final imidazole concentration of 37 mM. The large number of histidine residues in the amino terminus enabled CatSper1 to bind cobalt (9). After mixing 1 h, unbound protein was washed 2x using the same binding buffer supplemented with 40 mM imidazole, followed by wash in pH 6.5 buffer. Bound protein was eluted (22 °C) with 3 ml of elution buffer containing 50 mM NaH2PO4, 300 mM NaCl, 300 mM imidazole, 1x detergent, and EDTA-free PIC, pH 7.0. The eluate was concentrated to ~0.7 ml (YM-100; Centricon) and the 0.7 ml of concentrate added to 100 µl of buffer-equilibrated anti-HA affinity beads (Roche Applied Science) and 3.3 ml of IP buffer containing 150 mM NaCl, 2 mM EDTA, 1x EDTA-free PIC, 0.5x detergent, and 10 mM HEPES, pH 8.0, mixed x 2 h, and washed 3x with IP buffer. Bound protein was eluted with 200 µl of HA peptide (5 mg/ml in IP buffer) for 15 min at 37 °C. The eluate was concentrated and resuspended in an lithium dodecyl sulfate (LDS) gel loading buffer (Invitrogen). Samples were heated for 15 min at 70 °C before being loaded onto a 4-12% Bis-Tris gradient gel (Invitrogen). After electrophoresis in SDS denaturing buffer, the gel was fixed and stained with Coomassie Blue (R-250) or silver stain for scaled down pilot purifications. Protein bands were excised and stored in 1% acetic acid before protein identification.

Protein Identification—Peptides from in-gel trypsin digestion were separated on a C18 column with a nano liquid chromatography system (Eksigent) and subsequently sequenced online using a nanospray/Qstar-XL mass spectrometer (ABI). Analyst QS software was used for data analysis and Mascot for data base searches (University of Pennsylvania Proteomics Facility).

Cloning of CatSperbeta—The 12 peptide sequences (covering 109 amino acids) identified by mass spectrometry were used to search expressed sequence tag and genomic databases. Primers were designed according to the available sequences and used to amplify the whole ORF from mouse testis first strand cDNA by PCR. PCR products were subcloned into a modified pTracer-CMV2 vector (Invitrogen) and multiple clones sequenced. Sequences were blasted against cDNA and genome data bases to ensure that the clones selected for further analysis were free of mutations. The start of the ORF was unambiguously determined by the presence of an inframe stop codon in the 5'-untranslated region. The predicted sequences of the human and C. intestinalis CatSperbeta homologs were from NCBI data bases and the C. intestinalis cDNA data base (23).

Multiple Tissue Reverse Transcription PCR—PCR was performed according to standard protocols using commercial multiple panel cDNAs (Clontech) as templates. The sequences of the forward and reverse primers for CatSperbeta amplification were (5' to 3') AGGTTCATCGTTTCAAGTTTCCAGTCAC and ACAGTTGTACTTGAGGTGAGTCCAG, respectively. Samples were denatured for 2 min at 94 °C, followed by 35-cycle amplification, denature (20 s at 94 °C), annealing (20 s at 58 °C), and extension (30 s at 72 °C). Reactions were incubated at 72 °C for 10 min. Aliquots withdrawn from the reactions at 30 amplification cycles were also analyzed. Comparison between products after 30 and 35 cycles indicated no saturation. Mouse G3PDH gene was used as control for cDNA input.

In Situ Hybridization—Frozen mouse testis sections (~10-µm thick) were used for in situ staining. Single strand, digoxigenin-labeled RNA probes were synthesized from the double strand DNA templates (nucleotides 1940-3323) generated using PCR with primers attached to a T7 sequence. This fragment had no significant sequence similarity to other genes. A sense probe was used as a negative control. Hybridizations were washed, and signals were visualized using alkaline phosphate-conjugated anti-digoxigenin antibody and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate.

Electrophoresis and Western Blotting—Unless otherwise stated, pre-cast 4-12% Bis-Tris gradient gels without SDS (from Invitrogen) were used for electrophoresis. All the gels were run in electrophoresis buffer containing SDS. A fragment encoding amino acids 648-984 was cloned into the vector pET-32(a) and used for bacterial expression. The fusion protein was purified under denaturing condition and used for antibody production in rabbits. Because CatSperbeta is only expressed in testis, anti-CatSperbeta sera were preabsorpted against Sepharose beads conjugated with total protein from mouse brain and kidney to minimize non-specificity. Preabsorpted sera were used at 1:2000 for Western blots.

Immunostaining—Sperm were placed on coverslips and fixed with cold methanol at -20 °C for 10 min, followed by acetone for 1 min. Fixed sperm were blocked with 10% normal goat sera in phosphate-buffered saline for 30 min and incubated with anti-CatSperbeta serum (1:50) at 4 °C overnight. After being washed three times with 1% Triton X-100 in phosphate-buffered saline, coverslips were incubated with Alex 594-conjugated goat anti-rabbit IgG secondary antibody (4 µg/ml) at 22 °C for 1 h and washed three times for 5 min each. Washed coverslips were mounted in 90% glycerol with anti-fade reagent and visualized under a Leica laser scanning confocal microscope. WT and CatSper1-/-sperm were processed identically.


Figure 1
View larger version (26K):
[in this window]
[in a new window]

  		FIGURE 1.
The HA·eGFP·CatSper1 transgene. A, CatSper1 genomic structure. Vertical bars indicate exons. B, an HA·eGFP construct (hatched bar) was fused to CatSper1 for the HA·eGFP·CatSper1 transgenic construct. C, detection of the HA·eGFP·CatSper1 fusion protein from mouse testis. Approximately 60 µg of proteins from testes of the indicated genotypes were separated on SDS-PAGE and probed with anti-CatSper1 antibody. +/+, WT, only CatSper1 detected; -/-, CatSper1-/-, no detected CatSper1; Tg;+/+, transgene in a wild-type background (both CatSper1 and HA·eGFP·CatSper1 detected. Results from four mice of each type are shown). Tg;-/-, transgene in the CatSper1-/-background with only the HA·eGFP·CatSper1 detected. The Tg;-/- lane was from a separate gel. HA·eGFP·CatSper1 protein corresponded to ~110 kDa compared with 80 kDa for WT CatSper1, as expected from their predicted sizes.

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Transgenic Approach to CatSper1 Complex Purification—Native ion channel plasma membrane proteins are of low abundance, requiring immunoprecipitation methods. Our anti-CatSper1 antibodies worked well for immunoblotting and immunostaining (9), but not for immunoprecipitation. To circumvent this problem we generated mice transgenic for CatSper1-HA·GFP on the CatSper1-/- background. The mouse CatSper1 ORF covers 12 exons spanning ~9 kb; an HA epitope-tagged green fluorescence protein (HA·eGFP) encoding a mini ORF was inserted into the CatSper1 genomic DNA, immediately 5' of the translational start site (Fig. 1, A and B). A genomic DNA fragment of ~4kb 5' of the first exon was used to drive the expression of the synthetic fusion gene. We established two independent lines with the transgene in the CatSper1-/- background (Fig. 1C). Both these lines were fertile, suggesting that the HA·eGFP·CatSper1 fusion protein fully rescued WT CatSper1 function. We did not observe any gross abnormality in the transgenic mice for a period of >4 years. This transgenic rescue experiment further confirmed that the male sterile phenotype in the CatSper1-/- mice was caused by the deficiency in the CatSper1 gene, but not by any potential spurious mutations introduced in the process of mutant generation.

Normal alkalinization-activated, voltage-dependent ICatSper (Fig. 2) was recorded from HA·eGFP transgenic mouse epididymal sperm (n = 7), but was absent in all CatSper1-/- sperm (Ref. 14 and not shown). Fusion of the GFP protein to the amino terminus of CatSper1 did not abrogate the pH sensitivity of ICatSper, because intracellular alkalization (induced by bath application of NH4Cl) readily potentiated ICatSper current (Fig. 2A). Membrane-permeant nucleotides increase [Ca2+]i by an unknown process requiring CatSper1 expression (9, 24), although not via direct nucleotide activation of the CatSper channel (14). In HA·eGFP·CatSper1 transgenic sperm, application of cell-permeable cGMP (8-Br-cGMP, 2 mM) elicited an increase in [Ca2+]i (Fig. 2B). Finally, based on observations from >100 litters over 4 years, the transgenic mice were fertile. Taken together, these data suggest that the HA·eGFP·CatSper1 fusion gene functionally replaced the native CatSper1.


Figure 2
View larger version (15K):
[in this window]
[in a new window]

  		FIGURE 2.
Rescue of ICatSper in HA·eGFP·CatSper1 transgenic mouse sperm. A, whole-cell currents in response to a 1-s voltage ramp (from -100 to +100 mV); transgenic sperm. Lower panel shows representative currents obtained in HS bath solution containing 2 mM [Ca2+]o (black), divalent-free (DVF; green), DVF with 10 mM NH4Cl (NH4Cl, red), and after HS wash (blue). B, caudal sperm were loaded with Fura-2AM fluorescent indicator and illuminated alternately by 340 and 380 nm wavelength light. Cyclic GMP (2 mM 8-Br-cGMP, indicated by horizontal bars) induced an increase in [Ca2+]i in the transgenic (upper, n = 5), but not the CatSper1-/- (lower, n = 10) sperm. The increase in [Ca2+]i due to bath application of the Ca2+ ionophore ionomycin (10 µM) serves as a reference.

 
Commercial antibodies that efficiently precipitated the CatSper1 fusion protein from mouse testis were selected for use in fusion protein purification (Fig. 3A). In addition, the numerous amino-terminal histidine residues served as native metal binding sites. Indeed, CatSper1 bound well to a cobalt column under relatively stringent conditions (pH 6.5 wash with 1% Triton X-100, 40 mM imidazole). With these two "handles" on CatSper1, a simple strategy could be designed to purify the channel protein complex (Fig. 3B). The HA·eGFP-tagged CatSper1 protein solubilized from the transgenic testes was enriched on a cobalt column, followed by purification on an anti-HA antibody column. The protein eluted with the HA peptide was separated by SDS-PAGE. Proteins from CatSper1-/- (for small scale pilot purification) or WT (untagged CatSper1; for large scale purification) testes were used as negative controls. The purification procedure was highly efficient (silver stain detection with <5 mg of membrane protein starting material from 1-3 mice).

Identification of the CatSper1 Protein Complex—Three specific bands were identified (Fig. 3C). The bands from a purification using ~100 mg of protein (60 testes) were stained with Coomassie Blue, excised, trypsin-digested, and identified using mass spectrometry. Peptides from one band were identified as CatSper1 and GFP proteins. The second band was identified as testis-specific HSP70 (HSP70-2) (25). From the 12 peptides in the third band, a novel protein (CatSperbeta) was identified. These three proteins (GFP-CatSper1, HSP70-2, and CatSperbeta) were identified in two independent purifications. Using an HSP70-2-specific antibody for Western blot (25), we confirmed that HSP70-2 could be precipitated with anti-HA antibody from the transgenic mouse testis, presumably by the interaction between HSP70-2 and HA·eGFP·CatSper1, but not with anti-FLAG M2 antibody (negative control; not shown).

CatSperbeta, a Novel Transmembrane Protein in the CatSper1 Complex—CatSperbeta was identified from data base searches and reverse transcription PCR. The full-length mouse CatSperbeta (GenBankTM accession number EF199807 [GenBank] ) encodes an 1109-amino acid protein (126 kDa; calculated pI of 8.6; Fig. 4A). CatSperbeta contains two clear transmembrane domains (6-22 of the NH2 terminus, and 1060-1076 at the end of the COOH domain; Fig. 4B). A large extracellular domain (~1000 amino acids) precedes the carboxyl terminal transmembrane segment. The predicted mouse intracellular carboxyl terminus is only 27 amino acids in length. Eight N-glycosylation sites are predicted in the polypeptide. The overall 2-TM topology is reminiscent of that of the large conductance K+ channel (BK) beta subunits and the P2X receptor (ATP-gated channel) (26, 27), but CatSperbeta (~126 kDa) is significantly larger (BK beta subunits <30 kDa) (28). Data base searches indicate that CatSperbeta is not predicted to be similar to any other protein of established function, although a putative extracellular fragment (Val-166-Gly-294) is weakly similar (42% similarity, 24% identity) to the extracellular loop of a P2X receptor (P2X3b, GenBankTM accession number NP_945337 [GenBank] ).


Figure 3
View larger version (21K):
[in this window]
[in a new window]

  		FIGURE 3.
Purification of the CatSper1 protein complex. A, transgenic testis membrane proteins were solubilized and precipitated with anti-GFP or anti-HA antibodies. The eluate and flow-through were probed with anti-CatSper1 antibody. B, strategy used to purify the CatSper1-containing protein complex. C, the purified CatSper1 protein complex was separated by SDS-PAGE and stained with silver. Proteins from CatSper1-/- testes were used as controls. Three specific bands are indicated by arrows.

 


Figure 4
View larger version (77K):
[in this window]
[in a new window]

  		FIGURE 4.
CatSperbeta, a novel transmembrane protein isolated in the CatSper1 protein complex. A, alignment between the predicted mouse (upper) and human (lower) CatSperbeta protein sequences. The eight putative glycosylation sites in the mouse sequence are indicated by *. The two predicted transmembrane domains (TM1, TM2) are boxed. The 12 peptide sequences identified by mass spectrophotometry are underlined. Amino acids 156-183 were identified as three peptides, 156-165, 166-173, and 174-183. B, hydrophilicity plot (window size = 11). Alternative TM prediction model suggests a third potential TM segment (indicated by arrow).

 
Human CatSperbeta (GenBankTM accession number AK126034 [GenBank] ) is located on chromosome 14. Mouse (C57BL/6) has two copies of CatSperbeta, separated by ~37 kb on chromosome 12. For reasons not fully understood, fertilization-specific proteins seem to be less conserved between species (29). Like CatSper1, CatSperbeta is relatively poorly conserved between human and mouse (amino acid identity ~56%; Fig. 4A). A CatSperbeta homolog in the marine chordate C. intestinalis is predicted to encode a 977-amino acid protein. The sequence identity between the mouse and C. intestinalis CatSperbeta homologs is 21%, with highest homology in the region close to the carboxyl terminus (not shown).


Figure 5
View larger version (109K):
[in this window]
[in a new window]

  		FIGURE 5.
Tissue distribution of CatSperbeta mRNA. A, reverse transcription PCR of CatSperbeta (upper panel) and G3PDH (control; lower panel) from 12 mouse cDNAs (lanes 1-12); H2O served as negative control (lane "-"). Lanes 1, heart; 2, brain; 3, spleen; 4, lung; 5, liver; 6, skeletal muscle; 7, kidney; 8, testis; 9, 7-day embryo; 10, 11-day embryo; 11, 15-day embryo; 12, 17-day embryo. B, representative fields of in situ hybridization in mouse testis using antisense probes corresponding to a unique portion of the CatSperbeta sequence. Sense probe served as a background control (lower right panel). Scale bar, 50 µm.

 
Restricted Expression of CatSperbeta mRNA in Testis—Among the eight adult tissues/organs and embryos of four developmental stages examined, only testis had detectable expression of CatSperbeta mRNA (Fig. 5A). In situ mRNA antisense revealed robust, specific staining of CatSperbeta in the seminiferous tubules; no significant signal was detected in the interstitial cells (Fig. 5B). Within the tubules, CatSperbeta appears to be expressed in spermatocytes and spermatids, but not in spermatogonia (Fig. 5B), similar to CatSpers 1-4.

Disruption of CatSperbeta Protein in CatSper1-/- Sperm—We developed a polyclonal antibody against amino acids 648-984 of CatSperbeta protein. Taking advantage of the restricted expression of CatSperbeta, nonspecific activity of the antibody was reduced by preabsorption of the antibody sera by total protein from mouse brain and kidney. The purified antibody specifically recognized a protein band from CatSperbeta-transfected HEK293 cells, but not from mock-transfected cells (Fig. 6A). The anti-CatSperbeta antibody also recognized a band of ~130 kDa from cobalt-purified testis proteins, presumably by association between CatSperbeta and the histidine-rich CatSper1 (not shown). Anti-GFP antibody (but not anti-FLAG M2) immunoprecipitated CatSperbeta from HA·eGFP·CatSper transgenic testicular protein, further confirming the association of the two proteins (Fig. 6B).


Figure 6
View larger version (32K):
[in this window]
[in a new window]

  		FIGURE 6.
CatSperbeta protein. A, anti-CatSperbeta antibody specifically recognized protein from CatSperbeta cDNA-transfected HEK293 cells, but not from mock-transfected cells. B, interaction between CatSperbeta and HA·eGFP·CatSper1. Total testis membrane proteins (~100 µg) prepared from the HA·eGFP·CatSper1 transgenic mice were immunoprecipitated with anti-GFP or anti-FLAG M2 antibody (negative control) and blotted with anti-CatSperbeta antibody. The lower bands are presumed immunoglobulins (Ig). C, disruption of CatSperbeta protein in sperm, but not in testis, in the CatSper1 mutant mice. Total sperm (7.5 x 105 cells) (upper) or testis (50 µg) (lower) proteins prepared from WT (+/+), CatSper1-/-, and the HA·eGFP·CatSper1 transgenic (Tg;in CatSper1-/- background) mice were blotted with anti-CatSperbeta antibody. Protein expressed from CatSperbeta-transfected HEK293 cells was loaded on the same gel as the molecular weight reference (lane ctrl). Prolonged exposure did not reveal a CatSperbeta band in the CatSper1-/- lane (not shown). The migrations of CatSperbeta in panels B and C were aberrant due to lower SDS content of the commercial gel compared with our own in panel A. D, immunofluorescence detection with anti-CatSperbeta antibody in WT (+/+) and CatSper1 (-/-) sperm. Immunofluorescence (in green) localizes specifically to the principal piece. Scale bar, 10 µm.

 
In mouse sperm, the CatSperbeta antibody recognized a single major band migrating at the same position as recombinant CatSperbeta protein from HEK293 cells (Fig. 6C). Interestingly, CatSperbeta was undetectable in the CatSper1 mutant sperm, but was present in CatSper1 mutant testes. In HA·eGFP·CatSper1 transgenic mice, CatSperbeta protein was again detected in the mutant sperm (Fig. 6C). Like CatSper1, CatSperbeta protein was localized to the sperm principal piece and was largely absent in the CatSper1-/- sperm (Fig. 6D). These data suggest that CatSperbeta protein is colocalized with, and dependent upon, CatSper1 protein. Because CatSper2, 3, and 4 antibodies are not as specific for their targets by immunohistochemistry, CatSperbeta dependence on these proteins will be examined in more detail using CatSper 2, 3, and 4-/- mice.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
We used a tagged CatSper1 transgenic mouse to enable unambiguous purification of CatSper1-associating proteins from testes. Previous work has suggested that CatSpers1-4 form a heterotetrameric complex surrounding the Ca2+-selective pore (12). In this report, we have shown that a novel auxiliary subunit, CatSperbeta, accompanies CatSper proteins. We suggest that CatSperbeta is a subunit of the CatSper complex based on its in vitro co-purification, in vivo colocalization, disappearance in CatSper1-/- sperm, and reappearance in sperm from mice rescued with tagged CatSper1. Interestingly both CatSpers and CatSperbeta are lacking in Caenorhabditis elegans and Drosophila but both appear in the ascidian C. intestinalis, suggesting that the origin of this molecular complex structure can be traced back to before the divergence among deuterosomes.

The CatSper channel complex is reminiscent of the maxi-K Ca2+-activated K+ channel, which consists of a pore-forming {alpha} subunit (7-TM) and a 2-TM beta subunit. Many other channel complexes have transmembrane auxiliary subunits. In CaV channels, the single TM {alpha}2/{delta} subunit not only increases channel protein surface expression but also affects current kinetics (30). The 1-TM beta subunit of NaV channels has a short intracellular tail but large extracellular domains that also mediate cell-cell interaction (31, 32). The CatSperbeta protein is predicted to have a large extracellular fragment (~1000 amino acids) with several putative N-glycosylation sites, and we speculate that these extracellular domains could be "sensors" for sperm interactions with other cell types or surfaces.

Not surprisingly, heat shock proteins have been implicated in channel assembly, including the HERG K+ channel (33), the ClC-2 Cl- channel (34), and the CFTR Cl- channel (35). Here, we find that the testis-specific HSP70-2 purifies with CatSper1, suggesting that sperm-specific membrane proteins such as channels require unique chaperones for their correct folding/assembly or trafficking. Unfortunately, preliminary experiments in which HSP70-2, CatSperbeta, and all four CatSper subunits were expressed in Xenopus oocytes did not yield functional currents. Similarly, we did not observe changes in the subcellular localization of CatSper1 protein when co-expressed with CatSperbeta in cultured HEK293 cells. Functional expression of sperm-specific proteins commonly fails in heterologous systems, as it does in proteins specific to other ciliated structures (e.g. olfactory receptors) (36). We can only speculate as to why this might be so; functional heterologous CatSper channel formation may require 1) additional unknown protein subunits, 2) an intact intraflagellar transport system (37), 3) the unique lipid composition of sperm plasma membrane (38), 4) sperm-specific cytosolic composition (39), or 5) all the above. Whatever the reasons may be for this complexity, the CatSper protein complex appears to consist of some of the most unique and diverse elements in the field of ion channels.


   FOOTNOTES
 
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) EF199807 [GenBank] .

* This work was supported by grants from the NICHD, National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Dept. of Biology, University of Pennsylvania, 415 S. University Ave. Philadelphia, PA 19104. Tel.: 215-898-9271; Fax: 215-898-8780; E-mail: dren{at}sas.upenn.edu.

2 The abbreviations used are: TM, transmembrane; CaV, voltage-gated Ca2+ channel; eGFP, enhanced green fluorescent protein; HA, hemagglutinin; HEK, human embryonic kidney; HSP, heat shock protein; ICatSper, CatSper channel current; NaV, voltage-gated Na+ channel; ORF, open reading frame; WT, wild-type. Back

3 D. Ren and J. Xia, unpublished observations. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Margaret Thompson (Gene Manipulation Facility, Children's Hospital, Boston, MA) for pronuclear injections. We thank Drs. Sally Zigmond for the use of an FPLC, Phillip Rea for the use of an ultra-speed centrifuge, Edward Eddy for anti-HSP70-2 antibody, Victor Vacquier for a sea urchin testis cDNA library, Noriyuki Satoh and Yuji Kohara for C. intestinalis expressed sequence tag clones, Urs Berger for in situ hybridization, and Yanhua Su for cell culture. Dr. Chao-Xing Yuan at the Proteomic Core Facility at the University of Pennsylvania provided invaluable assistance with protein identification.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Yanagimachi, R. (1994) in The Physiology of Reproduction (Knobil, E., and Neil, J., eds) pp. 189-317, Raven Press, New York
  2. Babcock, D. F., and Pfeiffer, D. R. (1987) J. Biol. Chem. 262, 15041-15047[Abstract/Free Full Text]
  3. Florman, H. M., Corron, M. E., Kim, T. D., and Babcock, D. F. (1992) Dev. Biol. 152, 304-314[CrossRef][Medline] [Order article via Infotrieve]
  4. Jimenez-Gonzalez, C., Michelangeli, F., Harper, C. V., Barratt, C. L., and Publicover, S. J. (2005) Hum. Reprod. Update 12, 253-267[CrossRef][Medline] [Order article via Infotrieve]
  5. Wennemuth, G., Westenbroek, R. E., Xu, T., Hille, B., and Babcock, D. F. (2000) J. Biol. Chem. 275, 21210-21217[Abstract/Free Full Text]
  6. Darszon, A., Acevedo, J. J., Galindo, B. E., Hernandez-Gonzalez, E. O., Nishigaki, T., Trevino, C. L., Wood, C., and Beltran, C. (2006) Reproduction 131, 977-988[Abstract/Free Full Text]
  7. Evans, J. P., and Florman, H. M. (2002) Nat. Cell Biol. Nat. Med (Suppl.) S57-S63
  8. Quill, T. A., Ren, D., Clapham, D. E., and Garbers, D. L. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 12527-12531[Abstract/Free Full Text]
  9. Ren, D., Navarro, B., Perez, G., Jackson, A. C., Hsu, S., Shi, Q., Tilly, J. L., and Clapham, D. E. (2001) Nature 413, 603-609[CrossRef][Medline] [Order article via Infotrieve]
  10. Lobley, A., Pierron, V., Reynolds, L., Allen, L., and Michalovich, D. (2003) Reprod. Biol. Endocrinol. 1, 53-67[CrossRef][Medline] [Order article via Infotrieve]
  11. Jin, J. L., O'Doherty, A. M., Wang, S., Zheng, H., Sanders, K. M., and Yan, W. (2005) Biol. Reprod. (Oxford) 73, 1235-1242[CrossRef]
  12. Qi, H., Moran, M. M., Navarro, B., Chong, J. A., Krapivinsky, G., Krapivinsky, L., Kirichok, Y., Ramsey, I. S., Quill, T. A., and Clapham, D. E. (2007) Proc. Natl. Acad. Sci. U. S. A. 104, 1219-1223[Abstract/Free Full Text]
  13. Clapham, D. E., and Garbers, D. L. (2005) Pharmacol. Rev. 57, 451-454[Free Full Text]
  14. Kirichok, Y., Navarro, B., and Clapham, D. E. (2006) Nature 439, 737-740[CrossRef][Medline] [Order article via Infotrieve]
  15. Okamura, Y., Nishino, A., Murata, Y., Nakajo, K., Iwasaki, H., Ohtsuka, Y., Tanaka-Kunishima, M., Takahashi, N., Hara, Y., Yoshida, T., Nishida, M., Okado, H., Watari, H., Meinertzhagen, I. A., Satoh, N., Takahashi, K., Satou, Y., Okada, Y., and Mori, Y. (2005) Physiol. Genomics 22, 269-282[Abstract/Free Full Text]
  16. Carlson, A. E., Westenbroek, R. E., Quill, T., Ren, D., Clapham, D. E., Hille, B., Garbers, D. L., and Babcock, D. F. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 14864-14868[Abstract/Free Full Text]
  17. Marquez, B., Ignotz, G., and Suarez, S. S. (2007) Dev. Biol. 303, 214-221[CrossRef][Medline] [Order article via Infotrieve]
  18. Quill, T. A., Sugden, S. A., Rossi, K. L., Doolittle, L. K., Hammer, R. E., and Garbers, D. L. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 14869-14874[Abstract/Free Full Text]
  19. Nikpoor, P., Mowla, S. J., Movahedin, M., Ziaee, S. A., and Tiraihi, T. (2004) Hum. Reprod. 19, 124-128[Abstract/Free Full Text]
  20. Avidan, N., Tamary, H., Dgany, O., Cattan, D., Pariente, A., Thulliez, M., Borot, N., Moati, L., Barthelme, A., Shalmon, L., Krasnov, T., Ben-Asher, E., Olender, T., Khen, M., Yaniv, I., Zaizov, R., Shalev, H., Delaunay, J., Fellous, M., Lancet, D., and Beckmann, J. S. (2003) Eur. J. Hum. Genet. 11, 497-502[CrossRef][Medline] [Order article via Infotrieve]
  21. Hille, B. (2001) Ion Channels of Excitable Membranes, 3rd Ed., Sunderland, MA
  22. Yu, F. H., and Catterall, W. A. (2004) Sci. STKE 2004, re15
  23. Inaba, K., Padma, P., Satouh, Y., Shin, I. T., Kohara, Y., Satoh, N., and Satou, Y. (2002) Mol. Reprod. Dev. 62, 431-445[CrossRef][Medline] [Order article via Infotrieve]
  24. Wiesner, B., Weiner, J., Middendorff, R., Hagen, V., Kaupp, U. B., and Weyand, I. (1998) J. Cell Biol. 142, 473-484[Abstract/Free Full Text]
  25. Eddy, E. M. (1998) J. Exp. Zool. 282, 261-271[CrossRef][Medline] [Order article via Infotrieve]
  26. Knaus, H. G., Folander, K., Garcia-Calvo, M., Garcia, M. L., Kaczorowski, G. J., Smith, M., and Swanson, R. (1994) J. Biol. Chem. 269, 17274-17278[Abstract/Free Full Text]
  27. Vial, C., Roberts, J. A., and Evans, R. J. (2004) Trends Pharmacol. Sci. 25, 487-493[CrossRef][Medline] [Order article via Infotrieve]
  28. Brenner, R., Jegla, T. J., Wickenden, A., Liu, Y., and Aldrich, R. W. (2000) J. Biol. Chem. 275, 6453-6461[Abstract/Free Full Text]
  29. Swanson, W. J., and Vacquier, V. D. (2002) Nat. Rev. Genet. 3, 137-144[Medline] [Order article via Infotrieve]
  30. Arikkath, J., and Campbell, K. P. (2003) Curr. Opin. Neurobiol. 13, 298-307[CrossRef][Medline] [Order article via Infotrieve]
  31. Catterall, W. A. (2000) Neuron 26, 13-25[CrossRef][Medline] [Order article via Infotrieve]
  32. Isom, L. L., Ragsdale, D. S., De Jongh, K. S., Westenbroek, R. E., Reber, B. F., Scheuer, T., and Catterall, W. A. (1995) Cell 83, 433-442[CrossRef][Medline] [Order article via Infotrieve]
  33. Ficker, E., Dennis, A. T., Wang, L., and Brown, A. M. (2003) Circ. Res. 92, e87-e100[Abstract/Free Full Text]
  34. Hinzpeter, A., Lipecka, J., Brouillard, F., Baudoin-Legros, M., Dadlez, M., Edelman, A., and Fritsch, J. (2006) Am. J. Physiol. 290, C45-C56
  35. Meacham, G. C., Patterson, C., Zhang, W., Younger, J. M., and Cyr, D. M. (2001) Nat. Cell Biol. 3, 100-105[CrossRef][Medline] [Order article via Infotrieve]
  36. Reed, R. R. (2004) Cell 116, 329-336[CrossRef][Medline] [Order article via Infotrieve]
  37. Kierszenbaum, A. L. (2002) Mol. Reprod. Dev. 63, 1-4[CrossRef][Medline] [Order article via Infotrieve]
  38. Wolf, D. E., Maynard, V. M., McKinnon, C. A., and Melchior, D. L. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 6893-6896[Abstract/Free Full Text]
  39. Ikawa, M., Wada, I., Kominami, K., Watanabe, D., Toshimori, K., Nishimune, Y., and Okabe, M. (1997) Nature 387, 607-611[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Biol. Reprod.Home page
J. Xia and D. Ren
Egg Coat Proteins Activate Calcium Entry into Mouse Sperm via CATSPER Channels
Biol Reprod, June 1, 2009; 80(6): 1092 - 1098.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
J. Schwenk, N. Harmel, G. Zolles, W. Bildl, A. Kulik, B. Heimrich, O. Chisaka, P. Jonas, U. Schulte, B. Fakler, et al.
Functional Proteomics Identify Cornichon Proteins as Auxiliary Subunits of AMPA Receptors
Science, March 6, 2009; 323(5919): 1313 - 1319.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
L. M. Turner, E. B. Chuong, and H. E. Hoekstra
Comparative Analysis of Testis Protein Evolution in Rodents
Genetics, August 1, 2008; 179(4): 2075 - 2089.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
S. T. Page, J. K. Amory, and W. J. Bremner
Advances in Male Contraception
Endocr. Rev., June 1, 2008; 29(4): 465 - 493.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/26/18945    most recent
M701083200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, J.
Right arrow Articles by Ren, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, J.
Right arrow Articles by Ren, D.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement