Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M611841200 on April 26, 2007

J. Biol. Chem., Vol. 282, Issue 27, 19575-19588, July 6, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/27/19575    most recent
M611841200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baroukh, N.
Right arrow Articles by Van Obberghen, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baroukh, N.
Right arrow Articles by Van Obberghen, E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

MicroRNA-124a Regulates Foxa2 Expression and Intracellular Signaling in Pancreatic β-Cell Lines*Formula

Nadine Baroukh{ddagger}1, Magalie A. Ravier§, Merewyn K. Loder§, Elaine V. Hill§, Ali Bounacer, Raphaël Scharfmann, Guy A. Rutter§, and Emmanuel Van Obberghen{ddagger}2

From the {ddagger}INSERM, U145, Nice, F-06107 France and Université de Nice-Sophia Antipolis, FacultédeMédecine, Institut de Génétique et Signalisation Moléculaire (IFR50), Nice, F-06107 France, the §Department of Cell Biology, Division of Medicine, Faculty of Medicine, Imperial College London, Exhibition Road, London SW7 2AZ, United Kingdom, and the INSERM EMI 0363, Paris F-75015 France and Site Necker, FacultédeMédecine René Descartes, Université Paris-Descartes, Paris, France

Received for publication, December 27, 2006 , and in revised form, March 22, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
MicroRNAs (miRNAs) are short non-coding RNAs that have been implicated in fine-tuning gene regulation, although the precise roles of many are still unknown. Pancreatic development is characterized by the complex sequential expression of a gamut of transcription factors. We have performed miRNA expression profiling at two key stages of mouse embryonic pancreas development, e14.5 and e18.5. miR-124a2 expression was strikingly increased at e18.5 compared with e14.5, suggesting a possible role in differentiated β-cells. Among the potential miR-124a gene targets identified by biocomputation, Foxa2 is known to play a role in β-cell differentiation. To evaluate the impact of miR-124a2 on gene expression, we overexpressed or down-regulated miR-124a2 in MIN6 β-cells. As predicted, miR-124a2 regulated Foxa2 gene expression, and that of its downstream target, pancreatic duodenum homeobox-1 (Pdx-1). Foxa2 has been described as a master regulator of pancreatic development and also of genes involved in glucose metabolism and insulin secretion, including the ATP-sensitive K+ (KATP) channel subunits, Kir6.2 and Sur-1. Correspondingly, miR-124a2 overexpression decreased, and anti-miR-124a2 increased Kir6.2 and Sur-1 mRNA levels. Moreover, miR-124a2 modified basal and glucose- or KCl-stimulated intracellular free Ca2+ concentrations in single MIN6 and INS-1 (832/13) β-cells, without affecting the secretion of insulin or co-transfected human growth hormone, consistent with an altered sensitivity of the β-cell exocytotic machinery to Ca2+. In conclusion, whereas the precise role of microRNA-124a2 in pancreatic development remains to be deciphered, we identify it as a regulator of a key transcriptional protein network in β-cells responsible for modulating intracellular signaling.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Studies implicating small regulatory RNAs in the control of gene expression have demonstrated that transcriptional regulation is controlled not only by protein factors, but also by small endogenous RNA molecules of ~19–23 nucleotides in length called microRNAs (miRNAs or miRs)3 (1, 2). The first miRNAs discovered were lin-4 and let-7, which are crucial for regulating the developmental timing in the nematode, Caenorhabditis elegans (1, 3). Since this initial report, several hundred miRNAs have been identified in plants and animals that regulate diverse biological processes ranging from cell metabolism to cell differentiation and growth, apoptosis, and immune responses (4–8). Moreover, it has been shown that miRNAs are characterized by differential spatial and temporal expression patterns supporting their role in such processes (3, 9). miRNAs serve as regulators of gene expression by binding to complementary sites on their target transcripts and, by an ill-defined mechanism, significantly induce the cleavage of mRNA or the repression of translation, depending on the partial or complete sequence homology, respectively (2, 10–12). It has been estimated that miRNA genes represent ~1% of the genome of complex organisms. It appears that they share a certain degree of structural similarity and are highly conserved between species (13).

Recently, the development of different computational approaches provides a reliable prediction for discovering novel miRNAs and their target genes, the identification of which is crucial to understand miRNA regulatory function (for review, see Brown et al. (14)). Several miRNA do not have an obvious role in vertebrate development, but rather act in diverse physiological and cellular processes. This is the case for the miR-375, which was specifically expressed in murine pancreatic cells, which regulates the Myotrophin (Mtpn) gene and insulin exocytosis (15). More recently, it has been described that overexpression of miR-9 in insulin-secreting cells causes a reduction in insulin exocytosis through an indirect effect on Granuphilin/Slp4 levels (16). In the present work, we have used computational analysis and the available databases to uncover microRNAs regulating the expression of genes important for pancreatic β-cell function. A review indicates that miR-375 may act synergistically with miR-124a, both of which are abundantly expressed in islet cells and may coordinately repress Myotrophin and regulate insulin exocytosis (17, 18). Initially miR-124 was described as a brain-specific miRNA in mammals, the function of which is presumably to help define and maintain cell-specific characteristics (19). It is also well represented in the mouse pancreatic MIN6 β-cell line, in which a large number of miR molecules have been found by sequencing of the library (15). In this study, we have focused on miR-124a in an effort to uncover regulated genes important for pancreatic β-cell function. Several transcription factors have been demonstrated to be critical regulators of pancreatic development through disruption of the corresponding gene in mice (20). One of these factors is the winged-helix transcription factor Foxa2 (Forkhead box a2 or formerly named HNF3-β for hepatocyte nuclear factor 3β), which is required for β-cell-specific functions. Thus, conditional deletion of Foxa2 in murine pancreatic β-cells results in hyperinsulinemic hypoglycemia, mimicking the pathophysiological features of familial hyperinsulinism (21). Foxa2 is therefore part of the transcriptional network downstream of the insulin receptor, and improves insulin resistance in peripheral tissues. Foxa2 is known to control the expression of many key genes involved in β-cell glucose sensing, such as the Pdx-1 gene. Moreover, Foxa2 plays a central role in insulin release via the regulation of genes coding for both Kir6.2 (inward rectifier potassium channel member 6.2) and Sur1 (sulfonylurea receptor 1) genes, the two subunits of the ATP-dependent K+ (KATP) channel. In brief, it appears that Foxa2 plays a pivotal role in key β-cell functions and physiology (22–25).

In the present work, we have analyzed the expression of the miR-124a in adult mouse organs and in the developing mouse pancreas. We found that miR-124a2 is increased at embryonic (e) stage e18.5 compared with stage e14.5. We computationally identify the Foxa2 gene product as a potential miR-124a2 target, and reveal that increasing the level of miR-124a2 negatively regulates the level of the Foxa2 protein. This, in turn, decreases the level of the downstream targets of Foxa2 including Pdx-1, Kir6.2, and Sur1, resulting in an impairment of insulin biosynthesis and changes in glucose signaling in pancreatic β-cell lines.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Total RNA Isolation—Adult mouse organs, dissected mouse pancreas from e14.5 and e18.5 embryos (about 8–10 of each), or β-cells were homogenized in TRIzol reagent (Invitrogen), followed by RNA isolation using chloroform extraction and isopropyl alcohol precipitation. After being washed with 70% (v/v) ethanol, RNA pellets were dissolved in diethyl pyrocarbonate-treated H2O. The RNA quality was analyzed by 1% (v/v) agarose gel and properly quantified with a bioanalyzer. For MicroRNA array, 5 µg of total RNA (1 µg/µl) of e14.5 and e18.5 stages was used. All RNA samples were conserved at -80 °C until used in assays.

MicroRNA Array Hybridization and Data Analysis—The microRNA array contains 226 mouse microRNA sequences. miRNA sequences were selected from a public data base (26). The 35-mer probes were designed by the Genosensor Company (Genosensor, Tempe, AZ), based on mature miRNA sequences and their flanking sequences. The synthesized probes were immobilized on the chips. RNA processing procedures were as described in the MicroRNA-Chip Expression Analysis Technical Manual. Briefly, 5 µg of total RNA was isolated at stage e14.5 and e18.5 from pancreata of mouse embryos and directly labeled with a biotin molecule. Labeled RNA was then used as a target for on-chip hybridization assays under optimized conditions. A streptavidin-Alexa dye was used to stain the hybridized targets, and the fluorescent signals were then scanned and analyzed. tRNA and 5 S rRNA functions were used as loading controls for normalization.

Identification of MicroRNA-124 Targets—To identify genomic targets of miR-124a, we used an algorithm named miRanda as described by Enright et al. (27), and Pic Tar (17).

Reporter Vectors and DNA Constructs—A putative miRNA124a-recognition element (as single copy) from the Foxa2 gene (miR-124a-RE Foxa2) was cloned in the 3'-untranslated region (UTR) of the Renilla luciferase reporter vector following the protocol already described in Cheng et al. (28). Briefly, the sense and antisense strands of the oligonucleotide sequences were annealed by adding 1 mM of each oligonucleotide to 46 µl of annealing buffer (100 nM potassium acetate, 30 mM HEPES, pH 7.4, and 2 mM magnesium acetate) and incubated at 90 °C for 5 min and then 37 °C for 1 h. The oligonucleotide sequences were designed to carry the HindIII and SpeI sites at their extremities facilitating ligation into the HindIII and SpeI sites of pmir-Report luciferase (Ambion, Inc.). The oligonucleotides used in these studies were: miR-124aRE Foxa2 (pLuc-miR-124a-RE), 5'-CTAGTATAAAGCACGAGAAACCAA-3' and 5'-AGCTTTGGTTTCTGCGTGCTTTATA-3'; scrambled miR-124a-RE Foxa2 (pLuc-scrambled miR-124a-RE), 5'-CTAGTGTCTTTGGCGTGTTTATA-3' and 5'-AGCTTATAAAGCACGACCAAAGAC-3'; mature mir-124a sequence (pLuc-miR-124-RE as a positive control of regulation), 5'-CTAGTTGGCATTCACCGCGTGCCTTAA-3' and 5'-AGCTTTTAAGGCACGCGGTGAATGCCAA-3'.

Expression vectors directing the synthesis of miR-124a2 were prepared either by introducing oligonucleotides corresponding to the murine precursor sequence of mir-124a2 into the pcDNA6.2 (Invitrogen), or into human growth hormone expressing vector (pXGH5) (29). In the former case, the oligonucleotide sequences were as follows: sense, 5'-TGCTGATCAAGATCAGAGACTCTGCTCTCCGTGTTCACAGCGGACCTTGATTTAATGTCATACAATTAAGGCACGCGGTGAATGCCAAGAGCGGAGCCTACGGCTGCACTTGAA-3' and antisense, 5'-CCTGTTCAAGTGCAGCCGTAGGCTCCGCTCTTGGCATTCACCGCGTGCCTTAATTGTATGACATTAAATCAAGGTCCGCTGTGAACACGGAGAGCGAGATCTCTGATCTTGATC-3'. For miR-9, the sequences were as follows: sense, 5'-GATCCTATCTTTGGTTATCTAGCTGTATGAGTATATTGGTGTTCATAAAGCTAGATAACCGAAAGTTTTTA-3' and antisense, 5'-AGCTTAAAAACTTTCGGTTATCTAGCTTTATGAAGACCAATACACTCATACAGTAGATAACCAAAGATAG-3'. For cloning into pXGH5, the above sequences were inserted into vector pSUPER after the addition of BglII and HindIII sites, and the H1 promoter and miR sequences were inserted into pXGH5 after excision with XbaI and HindIII.

Cell Culture and Transfections—Mouse islets were isolated from pancreata of female CD1 mice as described (30).

The murine pancreatic MIN6 β-cell line was a kind gift of Dr. Jun-ichi Miyazaki (Osaka University, Osaka, Japan). MIN6 cells were maintained in Dulbecco's modified Eagle's medium containing 25 mM glucose supplemented with 10% (v/v) heat-inactivated fetal calf serum, 100 units/ml penicillin, 100 µg/ml streptomycin, 100 µg/ml glutamine, and 5.5 µM 2-β-mercaptoethanol in humidified 5% CO2, 95% air at 37 °C (31) and used between passages 20 and 30.

The rat β-cell lines INS-1E (between passages 70 and 75) and INS-1 (832/13), passages 50–64 (32), were cultured as described in Merglen et al. (33), in a humidified atmosphere containing 5% (v/v) CO2 in complete medium composed of RPMI 1640 supplemented with 5% (v/v) heat-inactivated fetal calf serum, 1 mM sodium pyruvate, 50 µM 2-β mercaptoethanol, 2mM glutamine, 10 mM HEPES, 100 units/ml penicillin, and 100 µg/ml streptomycin.

Lipofectamine 2000 transfection reagent (Invitrogen) was used to transfect the MIN6 and INS-1 (832/13) cells according to the manufacturer's instructions. A total of 5 to 250 pmol of miR-124a2 precursor or miR-124a2 inhibitor (Ambion, Inc.) (28) and 2 µl of Lipofectamine 2000 were used per well, containing 2.5 x 105 cells (6-well plate). The effects of miR transfection were tested in at least three separate experiments. Transient transfection of plasmids was performed using the same methodology as described above, and luciferase activities were measured 2 days after transfection with the dual-luciferase reporter assay system (Promega, Madison, WI).

RNA Reverse Transcription, Real Time PCR, and Northern Blot Experiments—RNA from transfected β-cells was isolated as previously described using TRIzol reagent. 1 µg of RNA from each transfected wells was reverse-transcribed at 42 °C for 15 min with 1 µg of Oligo(dT) Primer, 5x First Strand Buffer, 100 mM dithiothreitol, 10 mM dNTP, RNAsin, and SuperScript II Reverse Transcriptase (Promega Reverse Transcription System, Charbonnière, France). cDNA was used at 1:50 dilution in water in subsequent real time PCR.

For miR-124a precursor detection, RT was performed as described in Schmittgen et al. (34) and cDNA was used at a dilution of 1:100 in real time PCR. PCR reaction mixtures included the Brilliant SYBR Green qPCR Master Mix (Stratagene), 10 µM primers, and the included reference dye at a dilution of 1:200 according to the manufacturer's instructions in a total reaction volume of 20 µl. Reactions were performed with the SYRB Green (with dissociation Curve) program on the 7000 Sequence Detection System ABI Prim 7000 (Applied Biosystems). Cycling parameters were 95 °C for 10 min and then 40 cycles of 95 °C (30 s), 60 °C (1 min), and 72 °C (30 s), followed by a melting curve analysis.

All reactions were performed in triplicate with reference dye normalization (β-actin or U6 RNA), and the median Ct (cycle threshold) value was used for analysis. Results were expressed relative to the control condition, which was arbitrarily assigned a value of 1. Each RT-PCR quantification experiment was performed in triplicate.

Primer sequences used to quantify mRNA by real time RT-PCR were designed by using the Primer Express software from Applied Biosystems. The following forward and reverse primers were used for amplification: mouse Foxa2, forward, 5'-CACCATCAGCCCCACAAAAT-3' and reverse, 5'-GGGTAGTGCATGACCTGTTCG-3'; mouse Pdx-1, forward, 5'-AAAACCGTCGCATGAAGTGG-3' and reverse, 5'-CCCGCTACTACGTTTCTTATCTTCC-3'; mouse Insulin-1, forward, 5'-CAGAGACCATCAGCAAGCAGG-3' and reverse, 5'-GTGCACCAACAGGGCCAT-3'; mouse Kir6.2, forward, 5'-CGCTTCGTGTCCAAGAAAGG-3' and reverse, 5'-TCGAATGTTCTTGTGGGCG-3'; rat Sur-1 (isoform D), forward, 5'-TCCTGGTCACACCGCTGTT-3' and reverse, 5'-CCTTGACAGTGGACCGAACC-3'; mmu-miR-124a, forward, 5'-TCCGTGTTCACAGCGGAC-3' and reverse, 5'-CATTCACCGCGTGCCTTA-3'; mmu-miR-124a2, forward, 5'-ATCAAGATCAGAGACTCTGCTC-3' and reverse, 5'-GTGCAGCCGTAGGCTCCGCTC-3'; rat β-actin, forward, 5'-CGAGCGTGGCTACAGCTTC-3' and reverse, 5'-GTCACGCACGATTTCCCTCT-3'; U6, forward, 5'-CTCGCTTCGGCAGCACA-3' and reverse, 5'-AACGCTTCACGAATTTGCGT-3'; Cyclophilin, forward, 5'-TATCTGCACTGCCAAGACT-3' and reverse, 5'-CCACAATGCTCATGCCTTC-3'.

For mature miR-124a detection, RT was performed as described in the Applied Biosystems TaqMan MicroRNA Assays protocol using specific RT primers and cDNA was used at a dilution of 1:50 in real time PCR. PCR mixtures included the TaqMan mouse microRNA-124a and TaqMan Universal PCR Master Mix in a total reaction volume of 20 µl. Reactions were performed with the 9600 emulation (Default) program on a Sequence Detection System ABI Prism 7000 (Applied Biosystems) or 7500 (Applied Biosystems). Cycling parameters were 95 °C for 10 min and then 40 cycles of 95 °C (15s), annealed/extended at 60 °C for 1 min. All reactions were performed in triplicate. Results were expressed relative to the control empty vector for (mouse) MIN6 cells and for (rat) INS-1 (832/13) cells and arbitrarily assigned a value of 1.

Total RNA from the same transfected MIN6 cells was used for Northern blot analysis. Twelve µg of total RNA was separated on a 12% denaturing polyacrylamide gel containing 7 M urea, at 25 watts for 1 h in 0.5x TBE. The RNA was then transferred to a Nytran N membrane (Schleicher & Schuell) using a Trans-blot SD semi-dry transfer cell (Bio-Rad) at 20 volts for 30 min using 0.5x TBE as a transfer buffer. Membrane was UV cross-linked and baked at 80 °C for 2 h. Twenty pmol of miR-124a antisense oligonucleotide was end labeled by [{gamma}-32P]dATP with T4 polynucleotide kinase for 1 h at 37°C (Amersham Biosciences). The reactions were stopped with 2 µl of 0.5 M EDTA. The probe was then purified with a G-25 MicroSpin column (Amersham Biosciences). Pre-hybridization and hybridization were carried out at 30 °C using ULTRAhyb-Oligo hybridization buffer (Ambion), according to the manufacturer's manual. After hybridization the membrane was washed twice with 2x SSC, 0.5% SDS (w/v) for 30 min at 30 °C. The membrane was then exposed for autoradiography. 5 S rRNA was probed as a loading control and exposed for autoradiography for 20 min.

Whole Cell Extracts and Western Blotting Analysis—Fortyeight hours after transfection, MIN6 cells were washed twice with ice-cold phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl, 10 mM NaH2PO4, 1.7 mM KH2PO4, pH 7.4), scraped from the dishes, and homogenized at 4 °C in 100 µl (for one 6-well plate) of lysis buffer (50 mM NaF, 1 mM EDTA, 1 mM EGTA, 10 mM KH2PO4, 0.2% (v/v) Tween 20, 1 mM sodium orthovanadate, 1 mM 1.4-dithiothreitol, and 50 mM β-glycerophosphate, pH 7.4) containing the protease inhibitors: 5 µg/ml leupeptin, 150 µg/ml aprotinin, and 250 µg/ml 4-(2-aminoethyl)benzenesulfonyl fluoride. Protein extracts were then agitated at 4 °C for 20 min and centrifuged at 14,000 x g for 15 min at 4 °C and the supernatants were used for the experiments described below.

For Western blotting, total proteins were separated by electrophoresis using 7.5% (v/v) polyacrylamide, 0.1% (v/v) SDS gels and transferred to polyvinylidene difluoride membranes (Immobilon-P, Millipore) followed by immunoblotting. Immunodetection was performed using an affinity purified goat polyclonal antibody raised against a peptide located at the carboxyl terminus of Foxa2 (Hnf-3β) of mouse origin or an affinity purified rabbit polyclonal antibody against a peptide mapping near the C terminus of CREB-1 of human origin (Santa Cruz Biotechnology, Inc.). After an overnight incubation at 4 °C, membranes were washed with phosphate-buffered saline wash buffer (1x phosphate-buffered saline, 0.1% (v/v) Tween 20, pH 7.4). Incubation with the secondary anti-goat or anti-rabbit peroxidase-conjugated antibody (from Jackson Laboratories, Inc.) was then performed for 1 h at room temperature and membranes were washed again with wash buffer. Antibody binding was detected by enhanced chemiluminescence using an ECL kit (Amersham Biosciences) following the manufacturer's protocol. To assess the total amount of protein, the membranes were stripped (for 30 min at 60 °C in buffer containing 100 mM 2-β mercaptoethanol, 2% (v/v) SDS, and 62.5 mM Tris-HCl, pH 6.7) and reprobed with antibody to β-actin or β-tubulin (Sigma). Primary antibodies used in this study include anti-Foxa2, anti-CREB-1 (Santa Cruz Biotechnology, Inc.), and anti-Pdx-1 (kind gift from M. Montminy, Salk Institute, La Jolla, CA).

Immunocytochemistry—MIN6 or INS-1 (832/13) cells were transfected with 1 µg of pcDNA6.2-miR-124a2 plasmids or the corresponding pcDNA6.2 empty vector (Invitrogen). The pcDNA6.2-miR-124a2 was obtained by cloning the miR-124a2 precursor sequence (see Sanger data base) into the empty vector following instructions of the Invitrogen Technical Manual.

After transfection, MIN6 or INS-1 (832/13) cells were fixed and incubated with primary and secondary antibodies as described (35, 36). Foxa2 was probed with the same antibody used for Western blotting (Santa Cruz Biotechnology, Inc.; 1:2500) and revealed with Alexa Fluor 568 donkey anti-goat IgG (Molecular Probes, Eugene, OR; 1:35,000). Guinea pig polyclonal antibodies to anti-insulin were from Dako (Cambridge, UK, 1:1,000) and revealed using an Alexa Fluor 568 donkey anti-guinea pig antibody (1:2,000). Images were captured on an upright Leica SP2 laser-scanning confocal or a Zeiss 200M inverted optics spinning disc confocal microscope (x63 oil immersion in both cases) and analyzed with appropriate software (Leica, Heidelberg, Germany, or Volocity 4.0TM, Improvision, Coventry, UK).

Intracellular Free Ca2+ Measurements and Assay of Human Growth Hormone (hGH) Release—MIN6 or INS-1 (832/13) cells were transfected with 1 µg of pcDNA6.2-miR-124a2 plasmids or the corresponding empty vector (pcDNA6.2) (Ca2+ experiments) or co-transfected together with 0.5 µg of hGH-encoding plasmid pXGH5 (37) (assay of hGH release), using 2 µg/ml Lipofectamine 2000 (Invitrogen) in Opti-MEM I medium for 4 h in 12-well plates. Cells were cultured for 36 h in complete growth medium (containing 25 or 11 mM glucose for MIN6 and INS-1 (832/13) cells, respectively), which were then replaced with 3 mM glucose-containing Dulbecco's modified Eagle's medium or RPMI-based medium, respectively, 12 h prior to experiments.

Changes in cytosolic concentration of Ca2+ ([Ca2+]c) were measured after loading cells with 5 µM Fura Red AM (Molecular Probes) for 30 min in 3 mM glucose. Cells were perifused at 37 °C in Krebs-Ringer buffer (KRB) containing 125 mmol/liter NaCl, 3.5 mmol/liter KCl, 1.5 mmol/liter CaCl2, 0.5 mmol/liter NaH2PO4, 0.5 mmol/liter MgSO4, 3 mmol/liter glucose, 10 mmol/liter HEPES, 2 mmol/liter NaHCO3, pH 7.4, and equilibrated with O2/CO2 (95:5) and supplemented with 0.1% (w/v) bovine serum albumin. Stimulation with KCl was achieved using 50 mmol/liter KCl-containing KRB (NaCl was reduced to maintain the osmolarity). Cells were imaged using an Olympus IX-70 microscope (x63 oil immersion objective) with an Imago charge-coupled device camera (Till Photonics, Grafelfing, Germany) controlled by TILLvisION software (Till Photonics). Cells were illuminated alternatively for 20 ms at 430 and 480 nm, and the emitted light was filtered at 600 nm. The ratio images were used to calculate [Ca2+]c off-line.

Assay of hGH release was essentially performed as previously described (35). Cells were preincubated for 30 min in KRB containing 3 mM glucose and then incubated for 30 min subsequently at the glucose or KCl concentrations given. Released and total hGH content were assayed using a colorimetric sandwich enzyme-linked immunosorbent assay method according to the manufacturer's instructions (Roche Diagnostics).

Insulin Secretion Assay—Cells were incubated in Dulbecco's modified Eagle's medium or RPMI as appropriate and supplemented as given above but containing 3 mM glucose for 16 h prior to experiments. The cells were preincubated for 30 min in KRB buffer as above and containing 3 mM glucose. The cells were then treated with 1.0 ml of KRB buffer containing the glucose or KCl concentrations given. Insulin secreted into the medium, and total cellular insulin, were measured by radioimmunoassay (Linco).

Statistical Analysis—Results are expressed as arbitrary units and are presented as the mean ± S.D. or mean ± S.E. as stated. In each experiment, all determinations were performed at least in triplicate. Statistical significance was assessed using Student's t test or analysis of variance followed by Newman-Keul's test for experiments with multiple groups.


Figure 1
View larger version (42K):
[in this window]
[in a new window]

  		FIGURE 1.
Specific expression of microRNA-124a in mouse tissues. A, primer sequences to miR-124a isoforms. The sequences of the precursor and mature members of the mouse miR-124a family of isoforms are shown. Underlined, sequences of the mature miRNA-124a. F and R, sequences of the forward/reverse PCR primers amplifying miR-124a (corresponding to a 60 bp); F' and R', sequences of the forward/reverse PCR primers amplifying the miR-124a2-specific isoform (corresponding to a 105 bp); in bold, sequences that differ among isoforms. Sequences are presented in the 5' to 3' direction. B, RT-PCR of mouse total tissues and β-pancreatic models. Representative abundance of miR-124a2 (upper panel) and miR-124a (lower panel) and corresponding U6 small nuclear RNA in tissue. Br, brain; Ht, heart; Lg, lung; Lv, liver; Pn, pancreas; Kd, kidney; Sp, spleen; Ms, muscle; Min-6, mouse insulinoma β-cells; Ins-1E, rat β-pancreatic cells; Islet, mouse pancreatic islets. C, microRNA-124a expression levels at stage e14.5 and e18.5 in developing pancreas of mouse embryos. The results are expressed as relative units normalized with tRNA and are the mean ± S.D. from 3 samples. **, p < 0.01.

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
miR-124a Expression in Mouse Adult Organs and Developing Pancreas—Three genes encode the miR-124a mature sequence, miR-124a1, miR-124a2, and miR-124a3, respectively, located on chromosomes 14, 3, and 2 in the mouse genome. We first analyzed pre-miR-124a (isoforms 1, 2, and 3) expression by RT-PCR in different organs in the mouse. Using specific primers (F' and R') designed for amplifying pre-miR-124a2 (Fig. 1A), we revealed that pre-miR-124a2 is preferentially expressed in brain, lung, pancreas, kidney, and muscle (Fig. 1B, left panel). In this study, we were interested in identifying a role for miR-124a in the pancreatic β-cell. To that aim, we first confirmed the expression of pre-miR-124a in two insulin-secreting cell lines, Min-6 and Ins-1E, and in primary pancreas islets (Fig. 1B, right panel). To continue, we analyzed miR-124a expression during pancreas development by microRNA array GenoSensor Technology. We selected embryonic stages e14.5 and e18.5 because of their importance in β-cell differentiation in terms of their difference in expression of transcription factors. miR-124a2, characterized by more than a 6-fold change in the expression level, was clearly differentially expressed during pancreas development (stage e14.5 compared with e18.5), whereas the two other isoforms, miR-124a1 and miR-124a3, were unchanged (Fig. 1C). The miR-124a2 up-regulation in developing pancreas was confirmed by RT-PCR analysis (data not shown). miR-124a2 expression thus appears to be turned-on at e18.5 indicating its potential role in the regulation of genes involved in pancreatic β-cell-specific functions. Moreover, the microRNA chip array revealed a specific pattern of expression between these 2 key stages in embryonic pancreas development. 45 of the 226 mouse microRNAs analyzed in this array exhibited a variation in expression, representing 20% of all miRNAs analyzed (supplemental Table 1).


Figure 2
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 2.
Foxa2 protein and mRNA gene expression levels in MIN6 β-cells treated with pre-mir-124a2 or anti-miR-124a2. A, analysis of Foxa2 protein levels. MIN6 cells were transfected with miR-124a2 precursor or inhibitor (5 to 250 pmol) and left as such for 48 h. Proteins were extracted and subjected to SDS-PAGE. Representative immunoblots with anti-Foxa2 antibodies (upper panel) and anti-β-actin antibodies (lower panel) are shown. *, overexposure of the immunoblots done in the presence of the anti-miR-124a2. B, relative quantification of Foxa2 protein levels. Five independent experiments were performed and three gels showing Foxa2 protein levels were scanned and quantified using the Scion image program. The values were corrected for differences in the total amount of β-actin. C, analysis of Foxa2 gene expression levels. MIN6 cells were transfected with miR-124a2 precursor or inhibitor (250 pmol) and left as such for 48 h. RNA was extracted and subjected to reverse transcription followed by real-time PCR. Data represent three independent experiments ± S.D. with n = 3. *, p < 0.05.

 
Prediction of MicroRNA-124a Targets Using Bio-informatics—The striking up-regulation of miR-124a2 at e18.5 suggested that this microRNA might participate in or simply be associated with regulatory events involved in the modulation of gene products having a role at this stage of pancreas development. Using bio-informatic tools (miRanda and Pic Tar), we searched for potential mRNA targets of human miR-124a. This analysis identified several genes as being potentially targeted by miR-124a, from which we selected a series of genes anticipated to have a key role in pancreatic β-cells: forkhead box protein A2 (Foxa2 or Hnf-3β), cAMP responsive element-binding protein 1 (Creb-1), Isl-1 transcription factor (Isl-1), Myotrophin (Mtpn), neurogenic differentiation (NeuroD1), and vesicle associate membrane 3 (Vamp-3) genes based on their acknowledged role in pancreas (supplemental Table 2). In the listed genes, one emerges as the gene encoding for a key protein in endodermal development in most species and corresponds to the forkhead transcription factor box a2 gene (Foxa2) (38).

Foxa2 Protein Regulation Identified by miR-124a2 Functional Analysis—To investigate the influence of miRNA-124a on predicted mRNA targets, we transfected the miR-124a2 precursor (pre-miR-124a2) or inhibitor (anti-miR-124a2) into murine pancreatic MIN6 β-cells and searched for changes in Foxa2 protein levels using Western blotting with an antibody to Foxa2. Introduction of miR-124a2 precursor decreased Foxa2 protein levels and, conversely, miR-124a2 inhibitor increased Foxa2 protein amounts (Fig. 2A). Quantification of the signals shown in Fig. 2B revealed a direct dose-dependent relationship between the amount of anti-miR-124a2 and the Foxa2 protein level, and an inverse relationship between pre-mir-124a2 and Foxa2.

To investigate the influence of microRNAs on transcript levels, we transfected the miR-124a2 precursor (pre-miR-124a2) or inhibitor (anti-miR-124a2) into MIN6 cells and examined changes on Foxa2 mRNA levels. We showed that delivering miR-124a2 causes no significant change in Foxa2 mRNA expression, whereas the anti-miR-124a2 induced more than a 2-fold increase in the Foxa2 transcript (Fig. 2C).


Figure 3
View larger version (25K):
[in this window]
[in a new window]

  		FIGURE 3.
Analysis of miRNA-124a activity. A, bioinformatic prediction of miRNA-124a and Foxa2 transcript interaction using human miRNA target predictions (version 2005 at cbio.mskcc.org/cgi-bin/mirnaviewer/mirnaviewer.pl). B, relative expression of miR-124a-RE-reporter by miRNA-124a2. miR-124a-RE of Foxa2 was cloned into the pmiR-Report luciferase vector in the 3'-UTR region. Once cloned the miR-124a-RE vector is co-transfected with the pmiR-Report β-galactosidase vector as a control for transfection efficiency and the pcDNA6.2-miR124a2. HeLa cells were plated at 50,000 cells/well in 6-wells plates. Cells were transfected using Lipofectamine 2000 in triplicate with pmiR-Report β-galactosidase, a luciferase reporter construct that contained one target site for miR-124a and either plasmid expressing miR-124a2 (pcDNA-miR-124a2) or the empty vector (pcDNA6.2) as a negative control. Forty-eight hours post-transfection cells were assayed for luciferase and β-galactosidase expression, and β-galactosidase is used to normalize for differences in transfection efficiency. Data represent four independent transfections ± S.E. with n = 3. **, p < 0.01; ***, p < 0.001.

 
Most miRNAs are thought to control gene expression by base pairing with the microRNA-recognition element (RE) found in their messenger RNA target (Fig. 3A). To verify this hypothesis, the miR-124a-RE (as a single copy) of Foxa2 has been cloned into the 3'-UTR of the luciferase gene of the pmiR-Report Luciferase vector. We tested the activity of miR-124a by transfecting the luciferase reporter vector bearing the miR-124a-RE of Foxa2, or the scrambled miR-124a-RE of Foxa2 (as a negative control vector that does not target any known cellular miRNA), with the pcDNA6.2-miR-124a2 and the pmiR-Report β-galactosidase vector as a control for transfection efficiency. Following transfection into HeLa cells, both luciferase and β-galactosidase activity were measured and the relative level of luciferase was normalized against the β-galactosidase reading to control the transfection variation. To evaluate the activity of miR-124a, the mature miR-124a sequence was cloned in the antisense orientation in the 3'-UTR of the luciferase reporter gene. This construct (pLuc-miR-124a-RE) allows a perfect match between mir-124a and its target sequence located in the 3'-UTR of the luciferase mRNA. Importantly, pcDNA6.2-miR-124a2 was able to inhibit, by ~20% (p < 0.01), the expression of the reporter gene containing the miR-124a-RE of Foxa2 (Fig. 3B). Furthermore, pcDNA6.2-miR-124a affected the activity of a reporter gene containing the canonical response element for miR-124a.

Role of miR-124a2 in Foxa2 Gene Regulation—Foxa2 is known to regulate hepatic and/or pancreatic gene expression and to play a central role in maintaining glucose homeostasis (39–42). Foxa2, which is expressed in islets, is a major upstream trans-activator of pancreatic duodenal homeobox-1 (Pdx-1) (22, 43, 44), a homeobox gene essential for pancreatic development and for the maintenance of β-cell functions (39, 40).

To further explore whether miR-124a2 regulates the Foxa2 protein, we analyzed Pdx-1 expression levels in MIN6 cells transfected with microRNA corresponding to miR-124a2. We found that Pdx-1 mRNA levels were down- or up-regulated (p < 0.01 and p < 0.05, respectively) in the presence of the miR-124a2 precursor or inhibitor, respectively (Fig. 4A). At the protein level, exposure of MIN6 cells to microRNA induced a pattern of regulation in which pre-miR-124a2 decreased the Pdx-1 protein level (p < 0.05), whereas anti-miR-124a2 increased it (p < 0.05). Collectively our data provide evidence that modulation of Foxa2 protein by miR-124a2 has an impact on its downstream gene Pdx-1 (Fig. 4B). Importantly, Pdx-1 is known to play a key role in regulating Insulin gene transcription. Therefore, we decided to analyze the expression of the Insulin gene, which lies downstream of Pdx-1. As expected, we found that Insulin mRNA levels were down- or up-regulated (p < 0.001 and p < 0.05, respectively) in the presence of miR-124a2 precursor or inhibitor, respectively (Fig. 4C).

KATP channels are heteromultimers composed of four Sur-1 (sulfonylurea receptor 1) subunits surrounding an inner core of four Kir6.2 (inward rectifier K+ channel member 6.2) subunits (45). ATP-sensitive K+ channels are found in β-cells and play an important role in the regulation of insulin secretion (46–48). Importantly, expression of the β-cell KATP channel subunits Sur-1 and Kir6.2 have been described as being Foxa2-dependent (23). To verify such a relationship, we examined Kir6.2 and Sur-1 gene expression in MIN6 cells transfected with miR-124a2. We found that both genes are indeed regulated, as pre-miR-124a2 significantly decreases the mRNA level of both Kir6.2 and Sur-1 (p < 0.05) and, conversely, anti-miR-124a2 increases the corresponding mRNA levels (p < 0.05) (Fig. 4C).

miR-124a2 Regulates Stimulus-dependent Increases in Intracellular Free Ca2+ Concentration but not Hormone Secretion—To determine whether miR-124a2 overexpression may affect the response to single β-cell stimulation by glucose or other agents, we subcloned miR-124a2 into a plasmid vector (pcDNA6.2) from which the miRNA was expected to be produced by processing of a precursor mRNA also encoding the green fluorescent protein (GFP). Green fluorescence could thereafter be used to identify individual transfected cells. First, we confirmed the correct processing of the mature miR-124a from the precursor transcripts of pcDNA6.2-miR-124a2 expression by quantitative RT-PCR and/or Northern blot analysis (supplemental Fig. 1). Correspondingly, transfection with pcDNA6.2-miR-124a2 caused a small but statistically significant decrease in Foxa2 immunoreactivity in transfected (GFP-positive) MIN6 cells (Fig. 5).


Figure 4
View larger version (26K):
[in this window]
[in a new window]

  		FIGURE 4.
miR-124a effect on cascade genes related to Foxa2. A, Pdx-1 mRNA levels in MIN6 β-cells transfected with miR-124a2 precursor or with anti-miR-124a2 (250 pmol). *, p < 0.05; **, p < 0.01. B, Pdx-1 protein levels in MIN6 cells transfected with miR-124a2 precursor or anti-miR-124a2 (250 pmol). Three independent experiments were performed and gels showing Pdx-1 protein levels were scanned and quantified using the Scion image program. The values were corrected for differences in the total amount of β-actin. *, p < 0.05. C, Insulin, Kir6.2, and Sur-1 mRNA gene expression. MIN6 cells were transfected with miR-124a precursor or inhibitor (250 pmol) and left for 48 h. RNA was extracted and subjected to reverse transcription followed by real time PCR. Data represent three independent experiments ± S.D. with n = 3. *, p < 0.05; ***, p < 0.001.

 
Consistent with the decrease in the Foxa2 level and likely decrease in KATP channel subunit expression, we observed a significant increase in basal cytosolic free Ca2+ concentration ([Ca2+]c) (Fura Red 430/480 fluorescence ratio: 0.618 ± 0.024, n = 35 in empty pcDNA6.2-transfected cells and 0.716 ± 0.014, n = 54 cells in pcDNA6.2-miR-124a2 transfected cells; p < 0.001; see also Fig. 6A). When assessed in single cells, overexpression of miR-124a2 led to an increase in the proportion of cells in which an increase in [Ca2+]c was apparent in response to elevated (30 versus 3mM) glucose (Fig. 6B). Thus, 29/54 (54%) of miR-124a2-expressing cells displayed a significant increase in [Ca2+]c in response to high glucose, compared with only 8/35 (22.85%) of empty vector-transfected cells (six to nine independent experiments). However, analysis of the magnitude of the increase in those cells that responded to glucose in each case, by measurement of the "area under the curve" (arbitrary units) for the Fura Red ratio revealed a smaller increase in miR-124a2-expressing cells (empty vector, 0.048 ± 0.024, n = 8 versus 0.021 ± 0.003, n = 25, microRNA-expressing cells; p < 0.05, three to eight independent experiments; Fig. 6A). Likewise, the increase in [Ca2+]c in response to depolarization with 50 mM KCl in cells pretreated at 30 mM glucose was reduced by about 50% in miR-124a2-expressing versus empty vector expressing cells (area under the curve values: 0.035 ± 0.009, n = 19 cells, and 0.070 ± 0.013, n = 19 cells, respectively, three independent experiments, p < 0.05; Fig. 6B).


Figure 5
View larger version (36K):
[in this window]
[in a new window]

  		FIGURE 5.
Impact of miR-124a2 expression on Foxa2 immunoreactivity. MIN6 cells were transfected with either empty pcDNA6.2 or pcDNA6.2-miR-124a2 (see "Experimental Procedures") and, 48 h later, the immunoreactivity of Foxa2 determined by confocal microscopy using a goat anti-Foxa2 antibody (1:200 dilution) and Alexa Fluor 568-labeled anti-goat secondary antibody (1:500). GFP fluorescence was monitored by excitation at 488 nm and emission at 500–520 nm, and Alexa 568 at 568 for excitation and 560–600 for emission. Foxa2 immunoreactivity was normalized in individual fields to the fluorescence in non-transfected cells (taken as 100%) to account for the nonspecific effects of GFP expression alone. Cells 1 and 2 displayed ~20 and ~50% decrease in the expression of Foxa2, respectively. Scale bar = 10 µm. *, p < 0.05.

 


Figure 6
View larger version (21K):
[in this window]
[in a new window]

  		FIGURE 6.
Impact of miR-124a2 on glucose- and KCl-induced [Ca2+]c in single MIN6 β-cells. A, single cells transfected as in Fig. 5 were perifused initially in KRB at the indicated glucose concentrations before changing to media with the concentrations of glucose shown or 50 mM KCl. Cells were selected as showing a significant increase in [Ca2+]c in response to glucose. B, distribution of [Ca2+]c increases in response to a step increase in [glucose] from 3 to 30 mM in pcDNA6.2 alone or pcDNA6.2-miR-124a2-transfected cells, relative to the -fold increase indicated. Cells were stimulated during perifusion in KRB medium as described ("Experimental Procedures"). The black column illustrates the percentage of cells that did not display any statistically significant change in [Ca2+]c under glucose stimulation. The total number of cells in each group was 35 and 54, respectively, and data are from 6 to 9 independent experiments.

 
Assessed in transfected cell populations, no change was apparent in basal, high glucose-, or KCl-stimulated release of hGH, used as a surrogate for insulin (35) (hGH secreted as % cell content/30 min for miR-124a2-transfected versus empty vector- (GFP alone) transfected cells, respectively, at 3 mM glucose, 8.4 ± 1.9 and 6.7 ± 1.6; at 30 mM glucose, 13.7 ± 2 and 12.6 ± 1.6; at 50 mM KCl, 31.7 ± 2.4 and 30.7 ± 2.8; three independent experiments were performed in triplicate in each case) (Fig. 7A). Moreover, introduction of miR-124a2 oligonucleotides directly had no effect on regulated insulin secretion in MIN6 β-cells at either 3 or 30 mM glucose, or in the presence of 50 mM KCl (Fig. 7B).

Similar experiments to the above were also performed in INS-1 (832/13) cells. In contrast to MIN6 cells, INS-1 (832/13) cells displayed oscillatory increases in [Ca2+]c, similar to those apparent in primary mouse β-cells (49) (Fig. 8A) in response to high glucose. Whereas the amplitude of these oscillations was not significantly affected in cells expressing miR-124a2 from plasmid pcDNA6.2 compared with empty vector, basal [Ca2+]c was slightly but significantly increased in miR-124a2 expressing cells (Fig. 8, B and C). No change was apparent in the extent of the [Ca2+]c response to depolarization with 50 mM KCl of control or miR-124a2 expressing cells (~14% in each case) (Fig. 8C). As also observed in MIN6 cells, expression of miR-124a2 exerted no significant effect on the regulated release of hGH, when both were expressed from the same vector (Fig. 9 and see "Experimental Procedures"). By contrast, miR-9 augmented basal hGH release without affecting release in response to 20 mM glucose (Fig. 9), consistent with a recent study in which the effects of miR-9 were examined on the secretory response to a combination of secretagogues (16). Note that the release of hGH was quantitated above (Fig. 9) as percentage of total cellular hGH content in each case: total hGH content was identical in empty vector-transfected and miR124a2 vector expressing cells (data not shown). Correspondingly, immunocytochemical analyses revealed that insulin staining was not different between single vector-transfected (fluorescence intensity ratio = 0.87 ± 0.18, for 15 INS-1 (832/13) versus 16 non-transfected cells in a total of five separate fields) and miR124a2 plasmid transfected (1.05 ± 0.05; 19 transfected versus 18 control) cells. Thus, the absence of detectable changes in hormone release in miR-124a expressing cells is unlikely to be due to the "masking" of any such changes through alterations in total hormone content.


Figure 7
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 7.
Effect of miR-124a2 expression on hGH or insulin secretion from MIN6 cells. A, MIN6 cells were co-transfected with pXGH5 and pcDNA6.2-miR124a2 or empty vector (pcDNA6.2). After 48 h, cells were treated as described under "Experimental Procedures" and stimulated for 30 min in KRB containing 3 mM glucose (clear bars), 30 mM glucose (filled bars), or 20 mM glucose + 50 mM KCl (hatched bars). Data are expressed as the average of three separate experiments ± S.E. *, p < 0.05; **, p < 0.005. B, MIN6 β-cells were treated with pre-miR-124a2 or anti-miR-124a2 (250 pmol) and stimulated with glucose (30 mM) or50mM KCl. Data are expressed as average of three experiments ± S.E. *, p < 0.05.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Regulation of β-Cell Gene Expression by miR-124a2—MicroRNAs form a growing family of small non-protein-coding regulatory genes (~22 nucleotides) that regulate the expression of homologous target gene transcripts. Over the last couple of years, the list of reported miRNA functions and targeted genes has been extended at an impressive pace. miRNAs appear to decrease protein production by two different mechanisms: either by increasing the degradation of mRNA (RNA interference-like effect) or by blocking translation of mRNA into protein (genuine microRNA effect) (2, 10–12).

Here, we report a biological function of miR-124a2 to regulate gene expression and Ca2+ signaling in pancreatic β-cells. As previously described, miR-124a is mainly expressed in the brain and pancreas (11, 15). Using microRNA array technology, we found that miR-124a2 is up-regulated between stages e14.5 and e18.5 in the developing mouse pancreas. This microRNA exists in three isoforms, miR-124a 1, 2, and 3, respectively, located on chromosomes 14, 3, and 2 in the mouse. Each isoform possesses the same mature microRNA sequence, but each precursor has a distinct sequence. Interestingly, we observed a 6-fold increase exclusively for miR-124a2 expression at e18.5 compared with e14.5, whereas miR-124a1 and miR-124a3 are unchanged. These results suggest a specific pattern of microRNA regulation during pancreas development, which is likely to be controlled at the transcriptional level.

To identify genes that may be regulated by miR-124a, we applied algorithms designed to search for matching base pairs in miRNAs and mRNA targets. We found that Foxa2 is a potential candidate for regulation by miR-124a. Foxa2 contributes to the complex transcriptional circuitry within the pancreas and is involved in β-cell development and function. Therefore, we studied the expression of the Foxa2 gene by immunoblotting cell extracts obtained from MIN6 cells transfected with either the miR-124a2 precursor or the miR-124a2 inhibitor, which induce an enhancement or an inhibition of miR-124a functions, respectively. Expression of pre-miR-124a2 led to a reduced level of Foxa2 protein and, conversely, transfection with miR-124a2 inhibitor increased the Foxa2 protein level.

The mechanism(s) of regulation by miR-124a of Foxa2 expression in β-cells remain(s) unclear. No change was detected in the Foxa2 mRNA level in pre-miR-124a2-transfected cells compared with controls, and miR-124a2 inhibitor induced a 2-fold increase in Foxa2 mRNA levels. One may speculate that the regulation of this target gene by miR-124a2 is controlled by a cis/trans-regulation. Based on this hypothesis, and using genomic comparison, we investigated whether the transcription factor Creb-1 may be a regulated target of miR-124a, as predicted (supplemental Table 2). Creb-1 is a basic leucine zipper transcription factor, expressed widely and regulating many rapid response genes (50). Using Western (immuno) blotting with a polyclonal antibody to Creb-1, we found that the miR-124a2 precursor decreased Creb-1 protein levels, whereas the miR-124a2 inhibitor increased the amount of Creb-1 protein (supplemental Fig. 2, A and B). Next, we were interested to determine whether a relationship existed between Creb-1 and Foxa2 gene regulation. To this aim, we used genomic comparison to identify non-coding sequences that are evolutionarily conserved in human, mouse, and frog, and that in addition, are located upstream of the Foxa2 gene (supplemental Fig. 3A). The rationale for using inter-species sequence comparisons to identify non-coding regulatory elements is based upon the observation that sequences that exert important biological functions are frequently conserved between species. We localized an evolutionary conserved region, with 208 bp in length and 83.2% identity between human and mouse, and 111 bp in length and 73.9% identity in frog. We ran the rVISTA 2.0 program, which helped localize a potential regulatory element for Creb on this evolutionary conserved region (supplemental Fig. 3B). Together, our data suggest that Creb-1 may be a transcription factor regulating Foxa2 expression that, in part, might explain the observed up-regulation of the gene when cells are treated with anti-miR-124a2. Moreover, Foxa2 has been shown recently to be a direct target for Creb using genome wide analysis by Chip on Chip (51). However, much work needs to be done to precisely determine whether Creb-1 binds to Foxa2 promoter and trans-activates its gene expression. In any case, it remains conceivable that the regulation of Foxa2 expression by miR-124a2 is via both direct and indirect effects.

Foxa2 is known to activate gene transcription in pancreatic β-cells and regulate the expression of several genes including those encoding for transcription factor Pdx-1, a key regulator of β-cell gene expression (24). We show here that Foxa2 down-regulation in microRNA-124a2-transfected MIN6 cells induces a reduction in Pdx-1 mRNA and subsequent reduction in Pdx-1 protein level. A similar situation is observed with Preproinsulin gene expression, presumably reflecting the decrease in Pdx-1 level (52). As microRNA-124a is not predicted to interact directly with Pdx-1, Kir6.2, Sur-1, or Preproinsulin gene transcripts, we suspect that the decrease in the levels of each of these reflects a loss of the transcriptional stimulation of the respective genes by Foxa2. Consistent with this view, Pdx-1, Kir6.2, Sur-1, and Preproinsulin mRNA levels were closely correlated to Foxa2 protein levels. Thus, an increase in Foxa2 protein level induced an up-regulation of Pdx-1, Kir6.2, Sur-1, and Preproinsulin mRNA expression, whereas the reverse was observed when Foxa2 protein levels were decreased. To summarize, our data are compatible with a scenario in which miR-124a2 acts on Foxa2 expression, which consequently regulates Pdx-1, Kir6.2, Sur-1, and Preproinsulin gene transcription.


Figure 8
View larger version (25K):
[in this window]
[in a new window]

  		FIGURE 8.
Impact of miR-124a2 on glucose- or KCl-induced [Ca2+]c increases in INS-1 (832/13) cells. Cells were transfected as described under "Experimental Procedures." Single cells were perifused at the indicated glucose concentrations before changing to media containing 20 mM glucose (A) or 50 mM KCl (C). A, traces of [Ca2+]c increase in response to a step increase in glucose in two representative single cells, respectively, transfected with the empty vector, pcDNA6.2 alone (left) or the vector expressing the miR-124a2, pcDNA6.2-miR124a2 (right). B, effect of miR-124a2 on [Ca2+]c increases in response to glucose. Average of n = 39 (pcDNA6.2) and 34 (pcDNA6.2-miR124a2) cells selected as showing a significant [Ca2+]c response to glucose (-fold response > 1.10) and five to six independent experiments. Top left, effect of miR-124a2 on basal [Ca2+]c; top right, effect of miR-124a2 on sensitivity to glucose; bottom left, effect of miR-124a2 on total [Ca2+]c response; bottom right, effect of miR-124a2 on maximal [Ca2+]c response. ***, p < 0.001. C, effect of miR-124a2 on [Ca2+]c increase in response to stimulation with KCl. Left, average response n = 39 (pcDNA6.2) and 41 (pcDNA6.2-miR124a2) cells and three independent experiments. Right, effect of miR-124a2 on peak -fold increase in [Ca2+]c.*, p < 0.05.

 
Impact of miR-124a2 on Stimulus-dependent Ca2+ Changes in β-Cells—ATP-sensitive K+ channels are key regulators of β-cell membrane potential and insulin release (48). Inhibition of Foxa2 function, as observed here after miR-124a2 overexpression, has previously been shown to decrease the expression of each KATP channel subunit (22, 24, 25, 43) and to lead to persistent hyperinsulinemic hypoglycemia in Foxa2 knock-out mice (23). These changes seem likely to reflect a more depolarized membrane potential, increased Ca2+ influx through voltage-gated Ca2+ channels, and hence elevated basal free [Ca2+]c. This, in turn, is expected to lead to constitutive activation of insulin release. Correspondingly, we observed here that basal [Ca2+]c was significantly elevated in miR-124a2 expressing MIN6 and INS-1 (832/13) cells. In the case of MIN6 cells, the proportion of cells that subsequently responded to elevated glucose concentrations was substantially increased ("Results" and Fig. 6B), albeit with a decreased glucose-induced change in [Ca2+]c in the responding cells (Fig. 6A). Moreover, depolarization-dependent increases in [Ca2+]c were markedly lowered in miR-124a2 expressing MIN6 (Fig. 6) or INS-1 (832/13) cells (Fig. 8), the latter of which displayed an oscillatory increase in [Ca2+]c as observed in dissociated mouse β-cells (49). Because none of the subunits of L-type voltage-gated Ca2+ channels (the principle means of Ca2+ entry in stimulated β-cells) (53) are predicted to be direct targets of miR-124a24 these observations suggest that the apparent changes in the activity of this channel may reflect an indirect consequence of the decreases in the levels of Foxa2, or other transcription factors targeted by miR-124a.


Figure 9
View larger version (21K):
[in this window]
[in a new window]

  		FIGURE 9.
Effect of miR-124a2 on hGH secretion in INS-1 (832/13) cells. Effect of microRNA expression on hGH secretion as % of total hGH transfected in INS-1 (832/13) cells with plasmid pXGH5 or pXGH-mir-124a2 or pXGH-mir-9. After preincubation as described, cells were incubated for 30 min in KRB containing 3 mM glucose (clear bars), 30 mM glucose (filled bars), or 3 mM glucose + 50 mM KCl (hatched bars). **, p < 0.01; ***, p < 0.001; ns, non-significant.

 
Surprisingly, none of the above alterations in intracellular free Ca2+ concentrations were translated in the present study into differences in basal or stimulated hormone release, in either MIN6 (Fig. 7) or INS-1 (832/13) cells (Fig. 9), when measured either as the release of hGH (Fig. 7A), used as a surrogate for insulin in co-transfected cells, or via direct measurements of insulin release itself after treatment with miR duplexes (Fig. 7B). By contrast, overexpression of miR-9 (16), used as a positive control, caused a significant increase in basal hGH release from INS-1 (832/13) cells, and a tendency toward decreased glucose-stimulated release (Fig. 9). Similarly, we observed no effects of miR-124a2 over- or underexpression on hGH or insulin release from a third, distinct β-cell line, INS-1E cells, whereas miR-375, again used as a positive control (15), caused a clear inhibition of glucose-stimulated secretion from these as well as MIN6 cells (data not shown).

There are several plausible, and mutually inclusive, explanations for the apparent discordance between the effects of miR-124a on glucose-stimulated changes in [Ca2+]c and secretory activity. First, decreases in Foxa2 level, likely reflecting the increased levels of miR-124a2 achieved after plasmid transfection, were relatively small in the single cell assay required to measure Ca2+ changes (Fig. 6A). Given that miR-124a is estimated to comprise as much as 11.5% of the total microRNA profile in MIN6 cells (17) large changes in the level of this microRNA were difficult to achieve by transfection with an exogenous plasmid so that relatively small changes in the levels of target genes are anticipated (see "Results"). Importantly, direct measurements of mature miR-124 (supplemental Fig. 1) revealed clear and substantial increases in the levels of this species in both MIN6 and INS-1 (832/13) cells after transfection with the corresponding plasmid. Second, in MIN6 cells, an increase in the proportion of cells responding to glucose with a detectable increase in [Ca2+]c was accompanied by a decrease in the overall [Ca2+]c increase in these cells, two opposing effects that may have led to no net change in secretion. However, this was not the case in INS-1 (832/13) cells where there was no change in the proportion of cells responding to the sugar after the introduction of miR-124, and only a small although significant increase in basal [Ca2+]c. Finally, and perhaps most plausibly, miR-124a2 may have affected directly or indirectly the expression of a wide range of target genes, some of which may act to oppose the alterations in Ca2+ homeostasis. In particular, the smaller glucose- or depolarization-induced [Ca2+]c increase in miR-124a2 expressing cells may be compensated by relative increases in the expression of components of the vesicle trafficking and exocytotic machinery in β-cells, as in nerve cells (54). Whereas leaving exocytosis at basal [Ca2+]c unaffected by the small increase in the latter parameter, this alteration may sensitize insulin release to the smaller overall excursion in [Ca2+]c in response to cell stimulation. Intriguingly, the results of the present study suggest that such a sensitization to smaller changes in [Ca2+]c, the principal intracellular trigger for insulin release (55, 56), may be one of the properties acquired during the normal differentiation of pancreatic precursor cells into mature β-cells.

Conclusions—We have identified a regulated pancreatic microRNA, miR-124a2, that regulates Preproinsulin message levels. This might reflect Foxa2-directed decreases in Pdx-1 activity, and down-regulation of the genes encoding the KATP channel components, Kir6.2 and Sur-1, as reflected by alterations in basal and/or stimulated Ca2+ levels. It should be emphasized, however, that we were unable to detect changes in regulated insulin secretion, as observed in Foxa2 null mice (21). This observation presumably reflects additional actions of miR-124, including a "resetting" of the sensitivity of the exocytotic machinery to changes in Ca2+ (see above). Interestingly, miR-124a seems to share features with the miR-375, which has been shown to regulate insulin secretion, albeit at distal steps in the process, through the targeting of the Myotrophin gene (15). It is tempting to envision the possible occurrence of cooperation between miR-124a2 and miR-375, which leads to the concerted regulation of a series of target genes involved in insulin secretion, such as the Mtpn gene (also predicted to be regulated by miR-124a). Moreover, as described by Bartel and Chen (57), the dosage of gene expression regulated by miRNA is adjusted in a particular manner during cellular differentiation and development and it is unique to a specific cell type. Such fine orchestration may thus add a new dimension to the complexity of the mechanisms controlling gene expression.

However, the real picture seems likely to be substantially more complex as an individual protein is likely to be regulated by several microRNAs and, conversely, a particular microRNA is known to affect several proteins. Therefore, because of the multiplicity of possible interactions between one microRNA and its gene targets predicted by biocomputation, an urgent challenge is to define the particular function of each microRNA within an integrated response in a given cell system. In any case, the fast-accumulating evidence in favor of a key role of microRNAs in the regulation of a series of developmental and physiological programs probably represents only a glimpse of the complex network of gene regulation by microRNAs, given that they represent a large part of the human genome.

Although microRNA-124a has so far been described to help maintain cell-specific characteristics of neurons (19, 54), we now present direct evidence for the prediction (17) that this microRNA is also a key regulator of β-cell physiology. Because the inappropriate regulation of microRNAs is likely to be involved in processes leading to human disease (58, 59), we speculate that miR-124a may provide a novel target for cell-based treatments of type 2 diabetes characterized by β-cell failure.


   FOOTNOTES
 
* This work was supported at INSERM 145 (Nice) by INSERM-Fondation pour La Recherche Médicale-Juvenile Diabetes Research Foundation International (FRM-JDRF) Grant 4DA03H and the European Foundation for the Study of Diabetes (EFSD)/JDRF/Novo-Nordisk Program in Type 1 Diabetes (to E. V. O.). Research performed by the Department of Cell Biology (London) was supported by Juvenile Diabetes Research Foundation International Grant 1-2003-235, Wellcome Trust Programme Grant 067081/Z/02/Z, and a Research Leave Fellowship (to G. A. R.), Medical Research Council Grant G0401641 and Medical Research Council Infrastructure grant to the University of Bristol (UK) MRC Imaging Facility. Additional support to INSERM 145 (Nice) was provided by INSERM, Conseil Régional PACA and Conseil Général des Alpes-Maritimes, Université de Nice-Sophia Antipolis, and by European Community FP6 EUGENE 2 Grant LSHM-CT-2004-512013. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Tables 1 and 2 and Figs. S1–S3. Back

1 Supported by grants from INSERM-FRM-JDRF and EFSD/JDRF/Novo-Nordisk Program in Type 1 Diabetes. Back

2 To whom correspondence should be addressed. Tel.: 33-4-93-81-54-47; Fax: 33-4-93-81-54-32; E-mail: vanobbeg{at}unice.fr.

3 The abbreviations used are: miR or miRNA, microRNA; pre-miR-124a2, miR-124a2 precursor; anti-miR-124a2, miR-124a2 inhibitor; pcDNA6.2, empty vector; miR-124a2, pcDNA6.2-miR-124a2; Foxa2, forkhead transcription factor box a2 gene; Kir6.2, inward rectifier potassium channel member 6.2; Sur-1, sulfonylurea receptor 1; KATP, ATP-dependent K+ channel; [Ca2+]c, intracellular free Ca2+ concentrations; e, embryonic; Pdx-1, pancreatic duodenal homeobox-1; CREB, cAMP responsive element binding protein; Mtpn, Myotrophin; Ct, cycle threshold; hGH, human growth hormone; HNF-3β, hepatocyte nuclear factor 3β; UTR, untranslated region; RT, reverse transcriptase; KRB, Krebs-Ringer buffer; RE, recognition element; GFP, green fluorescent protein. Back

4 Assessed using cbio.mskcc.org/cgi-bin/mirnaviewer/mirnaviewer.pl. Back


   ACKNOWLEDGMENTS
 
We thank Dr. S. Longnus for critical reading of the manuscript, Dr. F. Fiory for advice, Dr. Suavet for subcloning, and Dr. A. Riboulet-Chavey for providing the pancreatic mouse islet mRNA.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lee, R. C., Feinbaum, R. L., and Ambros, V. (1993) Cell 75, 843-854[CrossRef][Medline] [Order article via Infotrieve]
  2. Wightman, B., Ha, I., and Ruvkun, G. (1993) Cell 75, 855-862[CrossRef][Medline] [Order article via Infotrieve]
  3. Reinhart, B. J., Slack, F. J., Basson, M., Pasquinelli, A. E., Bettinger, J. C., Rougvie, A. E., Horvitz, H. R., and Ruvkun, G. (2000) Nature 403, 901-906[CrossRef][Medline] [Order article via Infotrieve]
  4. Carrington, J. C., and Ambros, V. (2003) Science 301, 336-338[Abstract/Free Full Text]
  5. Ambros, V. (2003) Cell 113, 673-676[CrossRef][Medline] [Order article via Infotrieve]
  6. Johnson, S. M., Grosshans, H., Shingara, J., Byrom, M., Jarvis, R., Cheng, A., Labourier, E., Reinert, K. L., Brown, D., and Slack, F. J. (2005) Cell 120, 635-647[CrossRef][Medline] [Order article via Infotrieve]
  7. Brennecke, J., Hipfner, D. R., Stark, A., Russell, R. B., and Cohen, S. M. (2003) Cell 113, 25-36[CrossRef][Medline] [Order article via Infotrieve]
  8. Xu, P., Vernooy, S. Y., Guo, M., and Hay, B. A. (2003) Curr. Biol. 13, 790-795[CrossRef][Medline] [Order article via Infotrieve]
  9. Grosshans, H., Johnson, T., Reinert, K. L., Gerstein, M., and Slack, F. J. (2005) Dev. Cell 8, 321-330[CrossRef][Medline] [Order article via Infotrieve]
  10. Yekta, S., Shih, I. H., and Bartel, D. P. (2004) Science 304, 594-596[Abstract/Free Full Text]
  11. Lim, L. P., Lau, N. C., Garrett-Engele, P., Grimson, A., Schelter, J. M., Castle, J., Bartel, D. P., Linsley, P. S., and Johnson, J. M. (2005) Nature 433, 769-773[CrossRef][Medline] [Order article via Infotrieve]
  12. Bartel, D. P. (2004) Cell 116, 281-297[CrossRef][Medline] [Order article via Infotrieve]
  13. Kim, V. N. (2005) Nat. Rev. Mol. Cell. Biol. 6, 376-385[CrossRef][Medline] [Order article via Infotrieve]
  14. Brown, J. R., and Sanseau, P. (2005) Drug Discov. Today 10, 595-601[CrossRef][Medline] [Order article via Infotrieve]
  15. Poy, M. N., Eliasson, L., Krutzfeldt, J., Kuwajima, S., Ma, X., Macdonald, P. E., Pfeffer, S., Tuschl, T., Rajewsky, N., Rorsman, P., and Stoffel, M. (2004) Nature 432, 226-230[CrossRef][Medline] [Order article via Infotrieve]
  16. Plaisance, V., Abderrahmani, A., Perret-Menoud, V., Jacquemin, P., Lemaigre, F., and Regazzi, R. (2006) J. Biol. Chem. 281, 26932-26942[Abstract/Free Full Text]
  17. Krek, A., Grun, D., Poy, M. N., Wolf, R., Rosenberg, L., Epstein, E. J., MacMenamin, P., da Piedade, I., Gunsalus, K. C., Stoffel, M., and Rajewsky, N. (2005) Nat. Genet. 37, 495-500[CrossRef][Medline] [Order article via Infotrieve]
  18. Gauthier, B. R., and Wollheim, C. B. (2006) Nat. Med. 12, 36-38[CrossRef][Medline] [Order article via Infotrieve]
  19. Sempere, L. F., Freemantle, S., Pitha-Rowe, I., Moss, E., Dmitrovsky, E., and Ambros, V. (2004) Genome Biol. 5, R13[CrossRef][Medline] [Order article via Infotrieve]
  20. Edlund, H. (2002) Nat. Rev. Genet. 3, 524-532[CrossRef][Medline] [Order article via Infotrieve]
  21. Sund, N. J., Vatamaniuk, M. Z., Casey, M., Ang, S. L., Magnuson, M. A., Stoffers, D. A., Matschinsky, F. M., and Kaestner, K. H. (2001) Genes Dev. 15, 1706-1715[Abstract/Free Full Text]
  22. Lee, C. S., Sund, N. J., Vatamaniuk, M. Z., Matschinsky, F. M., Stoffers, D. A., and Kaestner, K. H. (2002) Diabetes 51, 2546-2551[Abstract/Free Full Text]
  23. Lantz, K. A., Vatamaniuk, M. Z., Brestelli, J. E., Friedman, J. R., Matschinsky, F. M., and Kaestner, K. H. (2004) J. Clin. Investig. 114, 512-520[CrossRef][Medline] [Order article via Infotrieve]
  24. Wang, H., Gauthier, B. R., Hagenfeldt-Johansson, K. A., Iezzi, M., and Wollheim, C. B. (2002) J. Biol. Chem. 277, 17564-17570[Abstract/Free Full Text]
  25. Accili, D., and Arden, K. C. (2004) Cell 117, 421-426[CrossRef][Medline] [Order article via Infotrieve]
  26. Griffiths-Jones, S. (2004) Nucleic Acids Res. 32, D109-D111[Abstract/Free Full Text]
  27. Enright, A. J., John, B., Gaul, U., Tuschl, T., Sander, C., and Marks, D. S. (2003) Genome Biol. 5, R1[CrossRef][Medline] [Order article via Infotrieve]
  28. Cheng, A. M., Byrom, M. W., Shelton, J., and Ford, L. P. (2005) Nucleic Acids Res. 33, 1290-1297[Abstract/Free Full Text]
  29. Emmanouilidou, E., Teschemacher, A. G., Pouli, A. E., Nicholls, L. I., Seward, E. P., and Rutter, G. A. (1999) Curr. Biol. 9, 915-918[CrossRef][Medline] [Order article via Infotrieve]
  30. Ravier, M., and Rutter, G. (2007) in Methods in Molecular Biology (Ward, A., and Tosh, D., eds) Humana Press Inc., Totowa, NJ, in press
  31. Miyazaki, J., Araki, K., Yamato, E., Ikegami, H., Asano, T., Shibasaki, Y., Oka, Y., and Yamamura, K. (1990) Endocrinology 127, 126-132[Abstract/Free Full Text]
  32. Hohmeier, H. E., Mulder, H., Chen, G., Henkel-Rieger, R., Prentki, M., and Newgard, C. B. (2000) Diabetes 49, 424-430[Abstract]
  33. Merglen, A., Theander, S., Rubi, B., Chaffard, G., Wollheim, C. B., and Maechler, P. (2004) Endocrinology 145, 667-678[Abstract/Free Full Text]
  34. Schmittgen, T. D., Jiang, J., Liu, Q., and Yang, L. (2004) Nucleic Acids Res. 32, e43[Abstract/Free Full Text]
  35. Varadi, A., Ainscow, E. K., Allan, V. J., and Rutter, G. A. (2002) J. Cell Sci. 115, 4177-4189[Abstract/Free Full Text]
  36. Pouli, A. E., Kennedy, H. J., Schofield, J. G., and Rutter, G. A. (1998) Biochem. J. 331, 669-675[Medline] [Order article via Infotrieve]
  37. Fisher, R. J., and Burgoyne, R. D. (1999) Pflugers Arch. 437, 754-762[CrossRef][Medline] [Order article via Infotrieve]
  38. Ang, S. L., Wierda, A., Wong, D., Stevens, K. A., Cascio, S., Rossant, J., and Zaret, K. S. (1993) Development 119, 1301-1315[Abstract]
  39. Duncan, S. A., Navas, M. A., Dufort, D., Rossant, J., and Stoffel, M. (1998) Science 281, 692-695[Abstract/Free Full Text]
  40. Kaestner, K. H. (2000) Trends Endocrinol. Metab. 11, 281-285[CrossRef][Medline] [Order article via Infotrieve]
  41. Lantz, K. A., and Kaestner, K. H. (2005) Clin. Sci. (Lond.) 108, 195-204[Medline] [Order article via Infotrieve]
  42. Puigserver, P., and Rodgers, J. T. (2006) Nat. Med. 12, 38-39[CrossRef][Medline] [Order article via Infotrieve]
  43. Wu, K. L., Gannon, M., Peshavaria, M., Offield, M. F., Henderson, E., Ray, M., Marks, A., Gamer, L. W., Wright, C. V., and Stein, R. (1997) Mol. Cell. Biol. 17, 6002-6013[Abstract]
  44. Ben-Shushan, E., Marshak, S., Shoshkes, M., Cerasi, E., and Melloul, D. (2001) J. Biol. Chem. 276, 17533-17540[Abstract/Free Full Text]
  45. Aguilar-Bryan, L., and Bryan, J. (1999) Endocr. Rev. 20, 101-135[Abstract/Free Full Text]
  46. Miki, T., Nagashima, K., and Seino, S. (1999) J. Mol. Endocrinol. 22, 113-123[Abstract]
  47. Cook, D. L., Satin, L. S., Ashford, M. L., and Hales, C. N. (1988) Diabetes 37, 495-498[Abstract]
  48. Hattersley, A. T., and Ashcroft, F. M. (2005) Diabetes 54, 2503-2513[Abstract/Free Full Text]
  49. Ravier, M. A., Eto, K., Jonkers, F. C., Nenquin, M., Kadowaki, T., and Henquin, J. C. (2000) J. Biol. Chem. 275, 1587-1593[Abstract/Free Full Text]
  50. Lonze, B. E., and Ginty, D. D. (2002) Neuron 35, 605-623[CrossRef][Medline] [Order article via Infotrieve]
  51. Zhang, X., Odom, D. T., Koo, S. H., Conkright, M. D., Canettieri, G., Best, J., Chen, H., Jenner, R., Herbolsheimer, E., Jacobsen, E., Kadam, S., Ecker, J. R., Emerson, B., Hogenesch, J. B., Unterman, T., Young, R. A., and Montminy, M. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 4459-4464[Abstract/Free Full Text]
  52. Petersen, H. V., Serup, P., Leonard, J., Michelsen, B. K., and Madsen, O. D. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10465-10469[Abstract/Free Full Text]
  53. Safayhi, H., Haase, H., Kramer, U., Bihlmayer, A., Roenfeldt, M., Ammon, H. P., Froschmayr, M., Cassidy, T. N., Morano, I., Ahlijanian, M. K., and Striessnig, J. (1997) Mol. Endocrinol. 11, 619-629[Abstract/Free Full Text]
  54. Conaco, C., Otto, S., Han, J. J., and Mandel, G. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 2422-2427[Abstract/Free Full Text]
  55. Henquin, J. C. (2000) Diabetes 49, 1751-1760[Abstract]
  56. Rutter, G. A. (2004) Diabetologia 47, 1861-1872[CrossRef][Medline] [Order article via Infotrieve]
  57. Bartel, D. P., and Chen, C. Z. (2004) Nat. Rev. Genet. 5, 396-400[Medline] [Order article via Infotrieve]
  58. Calin, G. A., Dumitru, C. D., Shimizu, M., Bichi, R., Zupo, S., Noch, E., Aldler, H., Rattan, S., Keating, M., Rai, K., Rassenti, L., Kipps, T., Negrini, M., Bullrich, F., and Croce, C. M. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 15524-15529[Abstract/Free Full Text]
  59. Lu, J., Getz, G., Miska, E. A., Alvarez-Saavedra, E., Lamb, J., Peck, D., Sweet-Cordero, A., Ebert, B. L., Mak, R. H., Ferrando, A. A., Downing, J. R., Jacks, T., Horvitz, H. R., and Golub, T. R. (2005) Nature 435, 834-838[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 CJASNHome page
M. Kato, L. Arce, and R. Natarajan
MicroRNAs and Their Role in Progressive Kidney Diseases
Clin. J. Am. Soc. Nephrol., July 1, 2009; 4(7): 1255 - 1266.
[Abstract] [Full Text] [PDF]

Home page
 RNAHome page
X. Tang, L. Muniappan, G. Tang, and S. Ozcan
Identification of glucose-regulated miRNAs from pancreatic {beta} cells reveals a role for miR-30d in insulin transcription
RNA, February 1, 2009; 15(2): 287 - 293.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
M. D. Walker
Role of MicroRNA in Pancreatic {beta}-Cells: Where More Is Less
Diabetes, October 1, 2008; 57(10): 2567 - 2568.
[Full Text] [PDF]

Home page
 DiabetesHome page
A. El Ouaamari, N. Baroukh, G. A. Martens, P. Lebrun, D. Pipeleers, and E. van Obberghen
miR-375 Targets 3'-Phosphoinositide-Dependent Protein Kinase-1 and Regulates Glucose-Induced Biological Responses in Pancreatic {beta}-Cells
Diabetes, October 1, 2008; 57(10): 2708 - 2717.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
P. Lovis, E. Roggli, D. R. Laybutt, S. Gattesco, J.-Y. Yang, C. Widmann, A. Abderrahmani, and R. Regazzi
Alterations in MicroRNA Expression Contribute to Fatty Acid-Induced Pancreatic {beta}-Cell Dysfunction
Diabetes, October 1, 2008; 57(10): 2728 - 2736.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
M. D. Nitert, C. L F Nagorny, A. Wendt, L. Eliasson, and H. Mulder
CaV1.2 rather than CaV1.3 is coupled to glucose-stimulated insulin secretion in INS-1 832/13 cells
J. Mol. Endocrinol., July 1, 2008; 41(1): 1 - 11.
[Abstract] [Full Text] [PDF]

Home page
 Toxicol SciHome page
A. Hudder and R. F. Novak
miRNAs: Effectors of Environmental Influences on Gene Expression and Disease
Toxicol. Sci., June 1, 2008; 103(2): 228 - 240.
[Abstract] [Full Text] [PDF]

Home page
 Stem CellsHome page
U. Lakshmipathy and R. P. Hart
Concise Review: MicroRNA Expression in Multipotent Mesenchymal Stromal Cells
Stem Cells, February 1, 2008; 26(2): 356 - 363.
[Abstract] [Full Text] [PDF]

Home page
 RNAHome page
X. Tang, J. Gal, X. Zhuang, W. Wang, H. Zhu, and G. Tang
A simple array platform for microRNA analysis and its application in mouse tissues
RNA, October 1, 2007; 13(10): 1803 - 1822.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/27/19575    most recent
M611841200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baroukh, N.
Right arrow Articles by Van Obberghen, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baroukh, N.
Right arrow Articles by Van Obberghen, E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement