Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M702895200 on May 22, 2007

J. Biol. Chem., Vol. 282, Issue 28, 20164-20171, July 13, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/28/20164    most recent
M702895200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsukuma, K. E.
Right arrow Articles by Osborne, T. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsukuma, K. E.
Right arrow Articles by Osborne, T. F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Key Role for Orphan Nuclear Receptor Liver Receptor Homologue-1 in Activation of Fatty Acid Synthase Promoter by Liver X Receptor*

Karen E. Matsukuma{ddagger}1, Li Wang§, Mary K. Bennett{ddagger}, and Timothy F. Osborne{ddagger}2

From the {ddagger}Department of Molecular Biology and Biochemistry School of Biological Sciences and the Center for Diabetes Research and Treatment, University of California, Irvine California 92697-3900 and §Departments of Medicine and Pharmacology, University of Kansas Medical Center, Kansas City, Kansas 66160

Received for publication, April 5, 2007 , and in revised form, May 18, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Liver X receptor (LXR) activates fatty acid synthase (FAS) gene expression through binding to a DR-4 element in the promoter. We show that a distinct nuclear receptor half-site 21 bases downstream of the DR-4 element is also critical for the response of FAS to LXR but is not involved in LXR binding to DNA. This half-site specifically binds liver receptor homologue-1 (LRH-1) in vitro and in vivo, and we show LRH-1 is required for maximal LXR responsiveness of the endogenous FAS gene as well as from promoter reporter constructs. We also demonstrate that LRH-1 stimulation of the FAS LXR response is blocked by the addition of small heterodimer partner (SHP) and that FAS mRNA is overexpressed in SHP knock-out animals, providing evidence that FAS is an in vivo target of SHP repression. Taken together, these findings identify the first direct lipogenic gene target of LRH-1/SHP repression and provide a mechanistic explanation for bile acid repression of FAS and lipogenesis recently reported by others.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Fatty acids subserve a large number of specialized cellular functions including cholesterol esterification, production of lung surfactant, mammary gland secretions, and signaling molecules. Fatty acids are also fundamental components of all biological membranes and the primary biochemical form of energy storage. Despite being a multistep enzymatic process, basic fatty acid biosynthesis in higher eukaryotes is accomplished through the catalytic activities of only two gene products, acetyl-CoA carboxylase (ACC)3 and fatty acid synthase (FAS). ACC catalyzes the first step in which condensation of two acetyl-CoA molecules forms malonyl-CoA; FAS then catalyzes the remaining steps required to produce the fully saturated 16-carbon fatty acid palmitate.

Although ACC is generally considered the rate-limiting enzyme in the fatty acid biosynthetic pathway, in mammals FAS appears to be independently regulated at the transcription level by a large number of nutritional, hormonal, and cellular signals, including insulin (1), fatty acids (2, 3), thyroid hormone (4), sterols (5), oxysterols (6), glucocorticoids (7), growth factors (8), and cyclic AMP (9, 10). Extensive FAS promoter analyses have identified key binding sites for E-box-binding proteins USF1 and 2 (11), sterol regulatory element-binding proteins (SREBPs) (12), thyroid hormone receptor (TR) (13), liver X receptor (LXR) (6), and carbohydrate response element-binding protein (14) as well as for general transcription factors, which play important roles in mediating the cellular response to the various signals (15–17).

Regulation of FAS by oxysterols was reported by Joseph et al. (6) who identified a DR-4-type nuclear receptor response element for the oxysterol-responsive RXR/LXR heterodimer in the FAS promoter. This DR-4 was identified in a region of the FAS promoter that was also shown to be required for TR regulation (13).

On further analysis of the FAS promoter, we identified an additional nuclear receptor half-site 21 bases downstream of the DR-4 element (Fig. 1). The region surrounding this putative nuclear receptor site did not suggest the existence of an additional DR-4-type element. However, because of its proximity to the DR-4, we hypothesized that it might play a role in the activation of FAS by either LXR or TR. In the study reported here, we show that the additional half-site binds the orphan nuclear receptor liver receptor homolog-1 (LRH-1)/fetoprotein transcription factor and that LRH-1 binding to this site specifically augments the LXR response. In contrast, LRH-1 has no effect on thyroid hormone activation of FAS.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—HepG2 human hepatoma cells were obtained from ATCC, cultured in Dulbecco's minimum essential medium (Invitrogen) with penicillin/streptomycin (100 µg/ml), L-glutamine (2 mM), nonessential amino acids (100 µM), sodium pyruvate (1 mM), 5 mM Hepes, pH 7.2, and 10% fetal bovine serum, and maintained at 5% CO2. One day before transfection, cells were plated at a density of 3.5 x 105 cells/well in a 6-well plate in 3 ml of normal culture medium. HEK293T human embryonic kidney cells were obtained from ATCC, cultured in Dulbecco's modified Eagle's medium high glucose (Irvine Scientific) with penicillin/streptomycin (100 µg/ml), L-glutamine (10 mM), nonessential amino acids (100 µM), 5 mM Hepes pH 7.2, and 10% fetal bovine serum, and maintained at 5% CO2. One day before transfection, cells were plated at a density of 3.5 x 105 cells/well in 6-well plates with 3 ml of normal culture medium.

Transient DNA Transfections—12–24 h after plating, cells were transfected by the standard calcium phosphate method as described previously (18). Where indicated, expression vectors for CMX-LXR{alpha} (0.1 µg/well), CMX-RXR{alpha} (0.1 µg/well), CMX-TRbeta (0.4 µg/well), pCI-LRH-1 (0.1–0.5 µg/well), or CMX-SHP (50 ng/well) plus individual luciferase reporters (1 µg/well) and control CMV-beta-galactosidase (1 µg/well) were used. 6–8 h post-transfection, cells were glycerol-shocked for 2 min and then washed 3 times with sterile phosphate-buffered saline. Medium was replaced with defined serum-free medium (Dulbecco's minimum essential medium, penicillin/streptomycin (100 µg/ml), L-glutamine (2 mM), nonessential amino acids (100 µM), 1 mM sodium pyruvate, 5 mM Hepes, pH 7.2, insulin/transferrin/selenite (5 µg/ml; 5 µg/ml; 5 ng/ml) (Sigma), 4% bovine serum albumin (Sigma, A-3803), and 25-hydroxycholesterol (0.1 µg/ml)) plus one or more of the following: dimethyl sulfoxide (Me2SO) (0.1%) as a vehicle control, GW3965 (1 µM), LG268 (100 nM), 22-R-hydroxycholesterol (2.5 µg/ml), T0901317 (1 µM), or T3 (100 nM or 1 µM). Cells were allowed to incubate at 37 °C, 5% CO2 for an additional 36–48 h before harvesting.

Plasmids—The FAS-700/+65 pGL2 luciferase reporter construct was subcloned by PCR from the rat FAS-1594/+65 pGL2 and the FAS-700/+65 MUT1 have been described previously (5, 6). All other FAS mutant reporter constructs were generated using the QuikChange site-directed mutagenesis kit (Stratagene) by replacing the individual half-site sequences with an equal number of adenosine residues. The remaining reporter constructs were generated by PCR amplification and subcloning. pSynTATALuc is a reporter vector containing a minimal promoter region of the hydroxymethylglutaryl-CoA synthase promoter (–28/+39) and has been described previously (19). The SREBP-1c promoter used here contains a sequence from –937/+29 fused to the luciferase coding sequence in pGL2 basic. The following expression vectors were provided by other laboratories: CMX-hTRbeta (Barry Forman), CMX-mLXR{alpha} (Peter Tontonoz), CMX-hRXR{alpha} (Ron Evans and Bruce Blumberg), pCI-LRH-1 (Gregorio Gil), CMX-SHP (David Mangelsdorf).

Enzyme Assays—At the time of harvest cells were washed once with phosphate-buffered saline and then lysed in a reporter lysis buffer (25 mM Gly-Gly, 15 mM MgSO4, 4 mM EGTA, 0.25% Triton). Luciferase activity of the lysates was measured in an Analytical Luminescence MonoLight 2010 luminometer using 20–40 µl of cell extract plus 100 µl of luciferase assay reagent (Promega) and expressed in relative light units. beta-Galactosidase activity was measured by a standard colorimetric assay at 420 nM absorbance using 50–100 µl of cell lysate and 2-nitrophenyl beta-galactopyranoside as the substrate. Luciferase activity for each sample was divided by the beta-galactosidase activity to yield normalized relative light units. -Fold activation was determined by dividing the normalized relative light units for a given sample by the normalized relative light units for the control sample (no activators plus Me2SO). Each transfection was performed at least twice with similar results.

Electrophoretic Mobility Shift Assay—In vitro transcribed and translated LXR{alpha} and RXR{alpha} proteins were generated using the T7 TNT rabbit reticulocyte lysate (Promega). One or two microliters of each translation were added to each binding mixture (containing 10 mM Hepes, pH 7.6, 50 mM NaCl, 2.5 mM MgCl2, 0.1 µg/µl poly(dI:dC), 0.05% (v/v) Nonidet P-40, 10% glycerol) in a final volume of 20 µl. For an electrophoretic mobility shift assay using GST-LRH-1, 20 ng of purified bacterially expressed GST-LRH-1 were added per reaction. A 57-base double-stranded oligo containing the wild type sequence of the three nuclear receptor half-sites was 5' end-labeled using T4 polynucleotide kinase (U. S. Biochemical Corp.) and added to the binding mixtures (1–2 ng/reaction). Binding mixtures were incubated at 4 °C for 1–2 h. Samples were then run on 5% polyacrylamide:bisacrylamide (19:1) gels at room temperature for 1.5 h, fixed in a solution of 10% methanol, 10% acetic acid, and dried onto Whatman No. 3MM chromatography paper at 80 °C for 1 h. Dried gels were exposed to x-ray film for 12–48 h. DNA sequences (one strand from 5'-3' only) were as follows; note that mutant bases are underlined. DNA sequences at all three half-sites were: wild type, KM 42, CTAGCACGATGACCGGTAGTAACCCCGCCTGAGGCGCCCTCCGCCAGGGTCAACGAC; mut 1, KM 44, CTAGCACGAAAAAAGGTAGTAACCCCGCCTGAGGCGCCCTCCGCCAGGGTCAACGAC; mut 2, KM 46, CTAGCACGATGACCGGTAG AAAAACCGCCTGAGGCGCCCTCCGCCAGGGTCAACGAC; mut 3, KM 48, CTAGCACGATGACCGGTAGTAACCCCGCCTGAGGCGCCCTCCGCCAAAAAAAACGAC; mut 1/2, KM 58, CTAGCACGAAAAAAGGTAGAAAAACCGCCTGAGGCGCCCTCCGCCAGGGTCAACGAC; mut 1/3, KM 56, CTAGCACGA AAAAAGGTAGTAACCCCGCCTGAGGCGCCCTCCGCCAAAAAAAACGAC; mut 2/3, KM 54, CTAGCACGATGACCGGTAG AAAAACCGCCTGAGGCGCCCTCCGCCAAAAAAAACGAC; Triple Mut, KM 70, CTAGCACGAAAAAAGGTAGAAAAACCGCCTGAGGCGCCCTCCGCCAAAAAAAACGAC. DNA sequences at the isolated third half-site were: KM 39, CTAGCGCCCTCCGCCAGGGTCAACGACCGCGCTT; MUT 3, KM 96, CTAGCGCCCTCCGCCAGTTTCAACGACCGCGCTT.

Animal Studies—SHP knock-out mice described previously (20) and wild type C57B1/129sv mice were maintained on a normal chow diet. Adult animals were sacrificed, and liver RNA was extracted and analyzed for FAS expression by Q-PCR as described (21).

Chromatin Immunoprecipitation—B6/129 mice (6-week-old male) were purchased from Taconic and allowed to adapt for 2 weeks to a 12-h light/12-h dark cycle and sacrificed at the end of the dark cycle (8 a.m.). Livers from 4 mice were combined and placed in 40 ml of ice-cold phosphate-buffered saline containing a mixture of protease inhibitors (1 µg/ml leupeptin, 1.4 µg/ml pepstatin, and 2 µg/ml phenylmethylsulfonyl fluoride) plus 1 mM EDTA and 1 mM EGTA. The tissue was disrupted in a Tekmar Tissumizer at the lowest setting. Formaldehyde was added from a 37% stock (v/v) to a final concentration of 1%, and samples were rotated on a shaker for 6 min followed by the addition of glycine to a final concentration of 0.125 M. Samples were returned to the shaker for an additional 5 min, and then cells were collected by centrifugation (2000 rpm in Sorvall RC3B) at 4 °C. The cell pellet was washed once with homogenization buffer A (10 mM Hepes, pH 7.6), 25 mM KCl, 1 mM EDTA, 1 mM EGTA, 2 M sucrose, 10% glycerol, 0.15 mM spermine, plus protease inhibitors as above. The final pellet was resuspended in buffer A and homogenized in a Dounce homogenizer with a B pestle to release nuclei. The solution was layered over buffer A and centrifuged in a Beckman ultracentrifuge (1 h at 26,000 rpm, 4 °C), and the nuclear pellet was resuspended in nuclei lysis buffer (1% SDS, 50 mM Tris, pH 7.6, 10 mM EDTA). Nuclei were disrupted using an Ultrasonic model W-220F sonicator for 5 x 10 s to shear chromatin. Chromatin size was checked by agarose electrophoresis to ensure that the average size was between 200 and 500 bp. Aliquots were used in immunoprecipitation experiments with an antibody to LRH-1 (Santa Cruz; sc25389X) and processed for the rest of the chromatin immunoprecipitation protocol as described (22, 23). Final DNA samples were analyzed by quantitative PCR in triplicate with a standard dilution curve of the input DNA performed in parallel. Oligo pairs for the FAS LRH-1 binding region or exon 4 from the YY1 gene used in the Q-PCR are as follows: FAS-700 (5'), ATCCTGGTCTCCAAGGTG; FAS-534 (3'), TAGGCAATAGGGTGATGGG; YY1, (5') TCTGACGAGAGGATTGTGTGGAC; YY1, (3') CTGAAGGGCTTTTCTCCAGTATG.


Figure 1
View larger version (12K):
[in this window]
[in a new window]

  		FIGURE 1.
DNA sequence alignment for the region from–669 to–615 (relative to the mRNA start site) for rat, chicken, and human FAS promoters. The three nuclear receptor half-sites in this region are capitalized and denoted by arrows. The DR-4 and putative LRH-1/fetoprotein transcription factor (FTF) sites are indicated.

 


Figure 2
View larger version (28K):
[in this window]
[in a new window]

  		FIGURE 2.
A, all three nuclear receptor half-sites of the FAS promoter are required for the maximal LXR response. HepG2 cells were transfected with CMX-LXR{alpha}, CMX-RXR{alpha}, and the wild type rat FAS (FASWT)(–700/+65) luciferase reporter or mutant versions containing base-pair changes in the three nuclear receptor half-sites as indicated in the figure (denoted by x's) and CMV beta-galactosidase. Cells were treated with either Me2SO (as a vehicle control) or GW3965, a synthetic LXR agonist (1 µM) for 48 h and then harvested and assayed for luciferase and beta-galactosidase activity. B, LXR{alpha}/RXR{alpha} preferentially bind the FAS DR-4 (half-sites 1 and 2) and not half-site 3. In vitro translated LXR{alpha} and RXR{alpha} proteins were incubated with a 32P-labeled oligonucleotide probe containing the rat FAS three half-sites and processed for an electrophoretic mobility shift assay as described under "Materials and Methods." In lanes 2–9, 200x unlabeled competitor DNA, containing either the wild type sequence or altered versions containing mutations in the various half-sites, was added to the binding mixture as indicated.

 
LRH-1 Knockdown—HepG2 cells were plated in triplicate at 150,000 cells/well in 24-well plates in normal medium. 1–4 h after plating cells were transfected with either 5 nM siRNA molecule specific for LRH-1 (Qiagen HP GenomeWide siRNA catalog SI00056406) or a negative control siRNA sequence (Allstars negative control siRNA) using the HiPerfect transfection reagent (Qiagen). Twenty-four hours after the first transfection, cells were washed once with phosphate-buffered saline and transfected a second time in medium containing defined serum-free medium plus T0901317 (1 µM)or Me2SO (0.1%). After an additional 24 h, cells were washed once with phosphate-buffered saline and then harvested for RNA using Trizol reagent. An equal amount of RNA (0.6–1.0 µg) from each sample was used to prepare cDNAs for quantitative PCR. One microliter of each cDNA synthesis reaction was used as template for Q-PCR using the Bio-Rad iQ5 icycler and the SYBR green fluorophore. Each PCR was run in duplicate. Expression of LRH-1 and FAS was determined, and expression of each gene was normalized to glyceraldehyde-3-phosphate dehydrogenase expression in each PCR run. PCR oligos for FAS, LRH-1, LXR{alpha}, and glyceraldehyde-3-phosphate dehydrogenase are as follows: human (hu) FAS, (5'), AACTCCAAGGACACAGTCACCAT; hu FAS (3'), CAGCTGCTCCACGAACTCAA; hu LRH-1 (5'), CTGATACTGGAACTTTTGAA; hu LRH-1 (3'), CTTCATTTGGTCATCAACCTT; hu LXR{alpha} (5'), GGAGGTACAACCCTGGGAGT; hu LXR{alpha} (3'), AGCAATGAGCAAGGCAAACT; hu glyceral-dehyde-3-phosphate dehydrogenase (5'), GAAGGTGAAGGTCGGAGTC; hu glyceraldehyde-3-phosphate dehydrogenase (3'), GAAGATGGTGATGGGATTTC.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
In our analysis of the FAS promoter, we noted a highly conserved sequence 21 bases downstream of the RXR/LXR response element bearing a strong resemblance to other nuclear receptor half-sites (Fig. 1). To determine whether this sequence played a role in the FAS LXR response, we first compared LXR activation of the wild type FAS promoter to LXR activation of similar reporter constructs containing mutations in each of the three half-sites (Fig. 2A). As expected, mutations of either half-site 1 or 2 (comprising the known LXR DR-4 element) resulted in a significant decrease in LXR activation. Surprisingly, however, mutation of the third half-site alone also resulted in a substantial defect in LXR activation, suggesting that the third half-site played an important and previously unappreciated role in LXR activation of FAS. Furthermore, mutation of all three half-sites simultaneously resulted in the most significant defect. Even with all three sites mutated there was still a 6-fold activation by LXR/RXR. This residual activity is due to LXR induction of SREBP-1c, which subsequently activates the FAS promoter through binding to sites in the proximal promoter (6).

To better understand the mechanism through which the third half-site exerts its effect on LXR activation of FAS, we examined binding of in vitro translated RXR{alpha} and LXR{alpha} proteins to a 32P-labeled DNA probe containing all three nuclear receptor half-sites (Fig. 2B). The addition of both RXR{alpha} and LXR{alpha} proteins resulted in a single band (lane 1) that migrated in parallel with a known RXR{alpha}/LXR{alpha} heterodimer on a consensus DR-4. The addition of a 200-fold excess of unlabeled wild type competitor DNA effectively competed for RXR{alpha}/LXR{alpha} heterodimer binding (lane 2); however, competitor DNAs containing mutations in the first and/or second half-sites (lanes 3, 4, 6–9) were unable to compete significantly for heterodimer binding. In contrast, competitor DNA containing a mutation in the third half-site alone effectively competed for RXR{alpha}/LXR{alpha} heterodimer binding (lane 5). Thus, the third half-site did not play a significant role in RXR{alpha}/LXR{alpha} binding to this region of the promoter despite being an important determinant of the FAS LXR response.


Figure 3
View larger version (32K):
[in this window]
[in a new window]

  		FIGURE 3.
A, recombinant LRH-1 binds to half-site 3 in FAS promoter. Recombinant human LRH-1 was incubated with 32P-labeled oligonucleotide probes containing the rat FAS half-site 3 (FAS 3) or a known LRH-1 binding site from the CYP8B1 promoter and processed for an electrophoretic mobility shift assay as described under "Materials and Methods." Unlabeled competitor (Com.) DNA was added at either a 50- or 100-fold molar excess as indicated above the corresponding lanes. WT corresponds to the same DNA as used for the 32P labeling. M3 corresponds to the same DNA with a mutation in half-site 3, and CYP corresponds to the DNA corresponding to the LRH-1 site from the CYP8B1 promoter. B, LRH-1 binding to FAS promoter in liver chromatin by chromatin immunoprecipitation. Fresh mouse liver tissue was subjected to the chromatin immunoprecipitation protocol described under "Materials and Methods," and chromatin specifically precipitated by either an LRH-1 antibody or a control IgG fraction was analyzed for the presence of the FAS promoter or exon 4 from the YY1 gene as a negative control. Q-PCR reactions were performed in triplicate, and the data are plotted as -fold induced with respect to the signal from the IgG negative control. Error bar represents the mean ± S.E. of triplicate reactions.

 
Two other known LXR target genes, murine CYP7A1 (24) and human CETP (25), require binding of the monomeric nuclear receptor LRH-1 (also known as fetoprotein transcription factor and CYP7A1 promoter binding factor) at a site proximal the LXR element, for efficient LXR activation. To determine whether LRH-1 could bind to the FAS third half-site and potentiate the LXR response of the FAS gene, we first assessed binding of recombinant LRH-1 protein to the FAS third half-site by electrophoretic mobility shift assay (Fig. 3A). Incubation of 20 ng of GST-LRH-1 with the labeled third half-site resulted in a single shifted band (lane 2) that migrated in parallel with GST-LRH-1 bound to a known LRH-1 binding site from the CYP8B1 promoter (lane 10). The addition of a 50- and 200-fold excess of unlabeled competitor DNA containing the wild type third half-site sequence effectively competed for GST-LRH-1 binding to the FAS half-site in a dose-dependent manner (lanes 3 and 4) as did competitor DNA containing the LRH-1 binding site from the CYP8B1 promoter (lanes 7 and 8). In contrast, the addition of competitor DNA containing a mutation in the third half-site did not compete for LRH-1 binding (lanes 5 and 6).

We next investigated direct binding of LRH-1 to the endogenous FAS promoter by chromatin immunoprecipitation in normal mouse liver using an antibody to LRH-1 and oligonucleotides that amplify the relevant region of the FAS promoter (Fig. 3B). Here, there was significant enrichment of the FAS promoter by the LRH-1 antibody relative to an IgG control, and this effect was specific as there was no enrichment of DNA from the YY1 locus analyzed in parallel.

To determine whether LRH-1 might activate the FAS promoter and augment the LXR response, we turned to HEK293T cells because HepG2 cells contain a significant level of endogenous LRH-1. To eliminate any indirect effects mediated through LXR activation of SREBP-1c (an LXR target gene and direct activator of FAS) (Fig. 2 and Refs. 5 and 6), a truncated wild type FAS promoter construct was constructed that contained the three nuclear receptor half-sites but lacked the downstream SREBP recognition motifs (FAS-700/-574) fused to a minimal TATA box containing promoter. This was transfected into HEK293T human embryonic kidney cells with an expression vector for LRH-1 along with the FAS promoter construct containing the three nuclear receptor half-sites (Fig. 4A). Because the RXR/LXR heterodimer is permissive and, thus, can be activated simultaneously by an RXR ligand and an LXR ligand (26), we compared activation of the FAS promoter by a synthetic RXR agonist (LG268), an oxysterol known to activate LXR (22-R-hydroxycholesterol) or both in combination. In the absence of transfected LRH-1, the addition of each ligand or the combination of both resulted in 2–5-fold increases in FAS activation, as is consistent with the FAS being an RXR/LXR target gene. In the presence of transfected LRH-1, however, this modest response increased to 20.5-fold, whereas LXR ligands or LRH-1 alone activated FAS 4.4- and 2.9-fold, respectively. Furthermore, the effect of LRH-1 on the LXR response was specific to FAS, as no such effect was noted on a control promoter construct analyzed in parallel.

To better understand the contribution of each half-site to the LRH-1 potentiation effect, we used mutant versions of this FAS reporter construct containing either a double mutation of both halves of the DR-4 or a mutation in the putative LRH-1 (third) half-site (Fig. 4B). As in the previous experiment, LXR activation of the corresponding wild type FAS promoter was dramatically increased in the presence of LRH-1. Furthermore, the addition of an expression vector for SHP, a novel non-DNA binding nuclear receptor known to be a potent inhibitor of LRH-1 activity in other promoters, significantly blunted this response.


Figure 4
View larger version (24K):
[in this window]
[in a new window]

  		FIGURE 4.
LRH-1 augments the response of the FAS promoter to LXR. A, HEK293T cells were transfected with pCI-LRH-1 (0.1 µg), CMV-beta-galactosidase, and luciferase reporters containing either the rat FAS promoter DNA from –700 to –574 fused to the minimal promoter in the pSynTATALuc vector or the minimal promoter vector pSynTATALuc itself as indicated and detailed under "Materials and Methods." Cells were treated with either Me2SO (DMSO, as a vehicle control), LG268 (100 nM) (a synthetic RXR agonist), 22-R-hydroxy-cholesterol (2.5µg/ml), or both (L + 22R) in combination for 16–18 h and then harvested and assayed for luciferase and beta-galactosidase activity as described under "Materials and Methods." B, cells were transfected as in A with the following modifications. The rat FAS promoter or mutant versions containing base pair changes in the nuclear receptor half-sites were used as indicated. Additionally, TO901317, a synthetic agonist for LXR, was substituted for the 22-R-hydroxycholesterol as indicated (T), and the LG268 was also added as indicated (L). As noted, the expression vector for SHP was also included (50 ng). Wt, wild type. Error bars represent the mean ± S.E. of triplicate reactions.

 


Figure 5
View larger version (18K):
[in this window]
[in a new window]

  		FIGURE 5.
FAS mRNA expression is regulated by LRH-1 and SHP. A, HepG2 cells were transfected with a control (N) or LRH-1 gene specific siRNA construct (L) and treated with or without the synthetic LXR agonist TO901317 as indicated. Cells were harvested for RNA extraction and analyzed for endogenous expression of either FAS or LRH-1 mRNA by Q-PCR as described under "Materials and Methods" (the significant difference for the effect of LXR ligand addition, noted by an asterisk, is associated with a p value of <0.03). B, hepatic FAS RNA from wild type (WT) or SHP knock-out mice fed a chow diet was measured by Q-PCR, and the values for three individual mice per group are presented (#, p = 0.01). Error bars represent the mean ± S.E. of triplicate reactions.

 
The FAS promoter construct containing a mutation in the DR-4 (MUT1/2) was defective for RXR/LXR signaling irrespective of the presence of LRH-1. Importantly, the magnitude of activation by LRH-1 alone on this mutant construct was similar to that seen on the wild type promoter, demonstrating an intact LRH-1 response.

Activation of the promoter construct containing a mutation in the third half-site (MUT 3) by RXR/LXR alone was comparable with that seen on the wild type construct; however, activation by LRH-1 alone was lost as was the concerted activation by both LXR and LRH-1. The residual inhibitory effect of SHP in the absence of the LRH-1 site was likely due to its known ability to inhibit LXR activation (27). Thus, SHP likely inhibits FAS gene expression through interactions with both LRH-1 and LXR.

We next used an siRNA approach to evaluate the effects of specifically reducing endogenous LRH-1 expression on the LXR-mediated induction of FAS in HepG2 cells (Fig. 5A). We used HepG2 cells because an siRNA approach has been used previously to silence LRH-1 gene expression (28). The siRNA specifically reduced endogenous LRH-1 mRNA by 30–50%, which resulted in a significant blunting of the response of FAS to LXR activation. To rule out off-target effects of the siRNA, we also measured mRNA expression of LXR{alpha} in these cells. As expected, the addition of the siRNA did not decrease LXR{alpha} levels.

Although LRH-1 knock-out mice die early in embryogenesis and are, thus, unavailable for study (29), SHP knock-out mice are viable (20). Given that SHP is a potent inhibitor of LRH-1 (24, 30, 31), it follows that if FAS is indeed an LRH-1 target gene, FAS mRNA expression would be elevated in SHP knock-out mice. Consistent with this hypothesis, our animal studies showed that FAS mRNA expression in SHP knockout mice was 6.8-fold higher than in matched wild type controls (Fig. 5B).


Figure 6
View larger version (15K):
[in this window]
[in a new window]

  		FIGURE 6.
A, LRH-1 enhancement of the LXR response is specific to the FAS promoter. HEK293T cells were transfected with pCI-LRH-1, CMX-SHP, CMV-beta-galactosidase, and either SREBP-1c (–937/+29), pGL2, or rFAS-700/+65 as noted in the figure. Cells were treated with either Me2SO (DMSO, as a vehicle control) or TO901317 (1 µM) (a synthetic LXR agonist) for 16–18 h and then harvested and assayed for luciferase and beta-galactosidase activity. B, LRH-1 does not affect the FAS T3 response. HEK293T cells were transfected with CMX-TRbeta, CMX-RXR{alpha}, pCI-LRH-1, CMV-beta-galactosidase, and rat FAS-700/+65 as noted in the figure and under "Materials and Methods." Cells were treated with either Me2SO (as a vehicle control) or T3 (triiodothyronine) (100 nM) for 40 h and then harvested and assayed for luciferase andbeta-galactosidase activity. Error bars represent the mean ± S.E. of triplicate reactions.

 
In a previous report LRH-1 was shown to augment the LXR response of SREBP-1c (43). However, despite localization of the effect to the proximal 300 bases of the SREBP-1c promoter, an LRH-1 site could not be identified, and no binding studies were performed. To determine the effect of LRH-1 on LXR activation of SREBP-1c in our model system, we transfected HEK293T cells with an SREBP-1c promoter fragment encompassing the LXR element and the putative LRH-1 response region in the presence and absence of expression vector for LRH-1 and compared the LXR response with that of the FAS promoter (Fig. 6A). Both SREBP-1c and FAS showed a 3-fold induction by LXR ligand T0901317. However, the addition of increasing amounts of LRH-1 expression vector had no effect on the SREBP-1c LXR response, whereas FAS expression increased 10-fold. Also of note, no change in SREBP-1c activation was observed by LRH-1 alone, whereas FAS activation increased to 3-fold in the presence of transfected LRH-1 alone. Thus, in our system, LRH-1 does not play a direct role in the SREBP-1c LXR response.

The region of the FAS promoter containing the DR-4 has been previously shown to mediate the FAS response to TR (13). Because RXR/LXR and RXR/TR both preferentially bind DR-4 type nuclear receptor elements, we investigated whether LRH-1 binding to the third half-site also played a role in FAS activation by TR and T3. Using HEK293T cells transfected with expression vectors for TRbeta, RXR{alpha}, and LRH-1, we discovered that, although TR and T3 clearly activate the FAS promoter, the FAS T3 response was not enhanced by the addition of increasing amounts of an expression vector for LRH-1 (Fig. 6B). Thus, LRH-1 potentiation of FAS is specific to the RXR/LXR response.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Liver receptor homolog-1 was described as CYP7A1 promoter binding factor, a liver-enriched transcription factor essential for expression of the CYP7A1 gene (32). Interestingly, although a required component of CYP7A1 gene expression, LRH-1 had very little activation potential of its own, and it was subsequently shown to significantly augment the response of the murine CYP7A1 promoter to LXR/oxysterol transactivation (24, 31). These studies also identified the LRH-1 central role in bile acid homeostasis by demonstrating that LRH-1 is a key target of SHP inhibition. LRH-1 is now recognized as an important component in negative feedback regulation of bile acid biosynthesis.

LXR{alpha} was also originally identified as a liver-enriched nuclear receptor (33, 34). It is activated through the binding of oxysterol agonists (35) and is an important regulator of cholesterol homeostasis (36). When cellular cholesterol levels are elevated, oxysterol levels rise and serve as physiologic agonists for LXR (37). In response, the expression of genes involved in cholesterol storage as well as cholesterol metabolism and excretion are activated. Key LXR target genes involved in cholesterol storage include SREBP-1c (35) and FAS (6). LXR target genes involved in cholesterol metabolism and excretion include murine CYP7A1 (38) and ABCA1 (39), ABCG5 and ABCG8 (40), apoE (41), and human CETP (42).

Because the identification of LRH-1 as a key factor for the LXR/oxysterol response of murine CYP7A1, the LXR responses of two other genes have been shown to be augmented by LRH-1: human CETP (25) and mouse SREBP-1c (43). CETP plays an important role in balancing human lipoprotein metabolism, and SREBP-1c is a key transcription factor responsible for orchestrating the lipogenic gene program (44).

The LXR and LRH-1 sites are conserved in the human, mouse, and chicken FAS promoters (Fig. 1). In contrast, the LXR site is not present in the human CYP7A1 gene (45), and the mouse genome does not encode a functional CETP gene. Thus, FAS is unique in that activation by both LXR and LRH-1 is conserved across species.

In our studies the LXR response of the SREBP-1c promoter was not altered by LRH-1 (Fig. 6). The LRH-1-responsive elements in murine CYP7A1, human CETP, and human and murine FAS are within 50 bases of the LXR response element. The SREBP-1c promoter used here contains several hundred base pairs surrounding the LXR site. Thus, it is unlikely that the lack of response is due to not using a large enough promoter fragment in the assay. It is possible, however, that the lack of LRH-1 responsiveness of the SREBP-1c promoter in our studies is due to the absence of some transcription factor in HEK293T cells that is present in the primary hepatocytes and cultured hepatoma cells used in the previous study. Alternatively, the effect on the SREBP-1c promoter might be indirect and/or require higher levels of LRH-1 than is required for the direct effect on the FAS promoter.

Why a distinct subset of LXR target genes depends upon LRH-1 for efficient activation in the presence of oxysterols is a compelling question. Because LRH-1 is selectively expressed in a handful of tissues, it has been postulated that the requirement for LRH-1 may allow for tissue specificity of the LXR/oxysterol response (24). In support of this hypothesis, CYP7A1, CETP, SREBP-1c, and FAS are all expressed at high levels in the liver but in a fairly restricted pattern in most other tissues. Interestingly, this group of LXR target genes is also sensitive to bile acid repression through SHP inhibition. Thus, regulation of a subset of LXR target genes involved in cholesterol metabolism by LRH-1 also provides an effective mechanism for selectively coupling their expression to bile acid homeostasis.

A recent report implicated FXR-mediated bile acid regulation of lipogenesis as the mechanism behind the triglyceride-lowering effect of bile acids (43). In this study supplementing the chow diet of mice with cholic acid for 1 day resulted in a significant increase in SHP mRNA and a corresponding decrease in SREBP-1c mRNA levels (43). Expression of FAS (as well as several other lipogenic genes) also declined and was attributed to the decrease in SREBP-1c. They further analyzed the SREBP-1c promoter and noted a SHP-dependent decrease in promoter activation, thus providing a straightforward mechanism for bile acid repression of triglyceride synthesis.

In another study, Moschetta et al. (46) demonstrated that FAS expression is increased in FXR knock-out animals where expression of SHP is very low compared with wild type controls, suggesting as our data also does (Fig. 5) that FAS is under tonic SHP inhibition. Because SREBP-1c levels were increased in the FXR knock-out mice, the elevation of FAS was attributed to the indirect effect of elevated SREBP-1c. It is important to note that unlike FXR knock-out animals, chow-fed SHP knock-out animals have normal SREBP-1c levels (20) and yet have elevated FAS expression (Fig. 5). Because SREBP-1c levels were altered in both this study and by Moschetta et al. (46), it was not possible to determine whether there was also a direct effect of SHP on FAS transcription.

In our study we have identified an LRH-1 site in the FAS promoter that is involved both in potentiation of the LXR response as well as in transcriptional repression by SHP. Our data taken all together establishes FAS as the first direct lipogenic gene target for LRH-1 and reveals that SHP repression of lipogenesis occurs both directly at the FAS promoter and indirectly by modulating SREBP-1c levels (43).

When the synthetic LXR agonist T0901317 was first evaluated, it was shown to potently induce hepatic FAS mRNA and increase serum triglyceride levels when administered to mice over 3 days. This was recognized to be due to activation of FAS by direct effects of LXR. However, by 7 days of treatment with T0901317 in this study, both serum triglycerides and hepatic FAS (but not SREBP-1c) mRNA levels returned to pretreatment levels (6). Although a mechanism for this biphasic response was not understood at the time, our data identifying FAS as a gene target of LRH-1/SHP regulation now predicts this result. The addition of T0901317 would initially increase expression of LXR target genes including FAS, SREBP-1c, and CYP7A1. As a result, both triglyceride synthesis and bile acid synthesis (in rodents) are stimulated. When signaling through the LXR pathway is allowed to continue over 7 days, elevated flux of cholesterol into bile acids eventually triggers expression of SHP and other FXR target genes. In this case FAS would be subject to SHP repression, which would limit hepatic fatty acid biosynthesis and triglyceride accumulation. In this way, uncontrolled LXR-induced lipogenesis is effectively kept in check.

Interestingly, in a companion study, we showed that the nuclear receptor half-site in the FAS promoter that binds LRH-1 is the 5' half of a nuclear receptor IR-1 element that directly binds the FXR/RXR heterodimer and stimulates FAS in response to bile acids (23). Although the precise rationale for the overlapping nuclear receptor sites is impossible to determine definitively, it is interesting to note that, whereas LRH-1 binding to this site would in effect make FAS sensitive to bile acid-induced repression by SHP, FXR/RXR binding to this site would induce FAS expression under conditions of elevated bile acids. Ironically, the opposing effects of bile acids on FAS promoter activation may actually be adaptive. When cholesterol levels are elevated, oxysterol levels increase and result in elevated signaling through the LXR pathway. FAS expression increases under these conditions to facilitate esterification of cholesterol. In this way, the initiating stimulus (e.g. excess cholesterol) turns on the biochemical pathway that mitigates its toxic effects. When bile acid flux is acutely elevated, bile acid-mediated up-regulation of SHP results in a drop in FAS (and CYP7A1) due to inhibition of LRH-1 even in the presence of activating oxysterol ligands for LXR. SHP inhibition of CYP7A1 blocks de novo biosynthesis of bile acids, thus preventing further bile acid accumulation. However, if bile acid flux remains elevated, chronic repression of bile acid biosynthesis eventually leads to accumulation of cholesterol. This prediction is supported by Watanabe et al. (43), who reported an increase in hepatic cholesterol levels in mice fed 0.5% cholic acid for 3 weeks. Although inhibition of bile acid biosynthesis is favorable for minimizing the toxic effects of bile acids, increased fatty acid biosynthesis is necessary under these conditions to esterify the excess cholesterol no longer permitted to enter the bile acid biosynthetic pathway. Thus, bile acid activation of FAS (via direct FXR/RXR binding to the IR-1) provides an SHP-independent mechanism for re-initiation of cholesterol esterification in the context of chronically elevated bile acids.


   FOOTNOTES
 
* This work was supported in part by National Institutes of Health Grants HL48044 and DK 71021 (to T. O.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

This is dedicated to the memory of Professor Edward K. Wagner who passed away while the original manuscript was being prepared. Back

1 Supported by fellowships from the Achievement Rewards for College Scientists Foundation and the American Diabetes Association. A member of the Medical Scientist Training Program in the University of California Irvine School of Medicine. Back

2 To whom correspondence should be addressed. Tel.: 949-824-2979; Fax: 949-824-8551; E-mail: tim.osborne{at}uci.edu.

3 The abbreviations used are: ACC, acetyl coenzyme A carboxylase; FAS, fatty acid synthase; LXR, liver X receptor; TR, thyroid hormone receptor; RXR, retinoid X receptor; SHP, small heterodimer partner; LRH, liver receptor homologue; SREBP, sterol regulatory element-binding protein; CETP, cholesterol ester transfer protein; Q-PCR, quantitative PCR; GST, glutathioneS-transferase; siRNA, small interfering RNA; CMV, cytomegalovirus; CMX, cytomegalovirus X. Back


   ACKNOWLEDGMENTS
 
We thank Drs. Bruce Blumberg, Ronald Evans, Barry Forman, Gregorio Gil, David Mangelsdorf, and Peter Tontonoz for plasmid reagents and Timothy Willson for the GW3965. We also thank Peter Tontonoz for suggestions during the early stages of this work and Tae Il Jeon for assistance with the RNAi experiments.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wilson, S. B., Back, D. W., Morris, S. M., Jr., Swierczynski, J., and Goodridge, A. G. (1986) J. Biol. Chem. 261, 15179–15182[Abstract/Free Full Text]
  2. Moon, Y. S., Latasa, M. J., Griffin, M. J., and Sul, H. S. (2002) J. Lipid Res. 43, 691–698[Abstract/Free Full Text]
  3. Clarke, S. D., Armstrong, M. K., and Jump, D. B. (1990) J. Nutr. 120, 225–231[Abstract/Free Full Text]
  4. Stapleton, S. R., Mitchell, D. A., Salati, L. M., and Goodridge, A. G. (1990) J. Biol. Chem. 265, 18442–18446[Abstract/Free Full Text]
  5. Bennett, M. K., Lopez, J. M., Sanchez, H. B., and Osborne, T. F. (1995) J. Biol. Chem. 270, 25578–25583[Abstract/Free Full Text]
  6. Joseph, S. B., Laffitte, B. A., Patel, P. H., Watson, M. A., Matsukuma, K. E., Walczak, R., Collins, J. L., Osborne, T. F., and Tontonoz, P. (2002) J. Biol. Chem. 277, 11019–11025[Abstract/Free Full Text]
  7. Lu, Z., Gu, Y., and Rooney, S. A. (2001) Biochim. Biophys. Acta 1532, 213–222[Medline] [Order article via Infotrieve]
  8. Swinnen, J. V., Heemers, H., Deboel, L., Foufelle, F., Heyns, W., and Verhoeven, G. (2000) Oncogene 19, 5173–5181[CrossRef][Medline] [Order article via Infotrieve]
  9. Rangin, V. S., Oskouian, B., and Smith, S. (1996) J. Biol. Chem. 271, 2307–2312[Abstract/Free Full Text]
  10. Paulauskis, J. D., and Sul, H. S. (1989) J. Biol. Chem. 264, 574–577[Abstract/Free Full Text]
  11. Wang, D., and Sul, H. S. (1997) J. Biol. Chem. 272, 26367–26374[Abstract/Free Full Text]
  12. Maganña, M. M., and Osborne, T. F. (1996) J. Biol. Chem. 271, 32689–32694[Abstract/Free Full Text]
  13. Xiong, S., Chirala, S. S., Hsu, M. H., and Wakil, S. J. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 12260–12265[Abstract/Free Full Text]
  14. Ishii, S., Iizuka, K., Miller, B. C., and Uyeda, K. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 15597–15602[Abstract/Free Full Text]
  15. Maganña, M. M., Koo, S. H., Towle, H. C., and Osborne, T. F. (2000) J. Biol. Chem. 275, 4726–4733[Abstract/Free Full Text]
  16. Rolland, V., Liepvre, X. L., Jump, D. B., Lavau, M., and Dugail, I. (1996) J. Biol. Chem. 271, 21297–21302[Abstract/Free Full Text]
  17. Oskouian, B., Rangan, V. S., and Smith, S. (1996) Biochem. J. 317, 257–265[Medline] [Order article via Infotrieve]
  18. Yieh, L., Sanchez, H. B., and Osborne, T. F. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 6102–6106[Abstract/Free Full Text]
  19. Sanchez, H. B., Yieh, L., and Osborne, T. F. (1995) J. Biol. Chem. 270, 1161–1169[Abstract/Free Full Text]
  20. Wang, L., Lee, Y. K., Bundman, D., Han, Y., Thevananther, S., Kim, C. S., Chua, S. S., Wei, P., Heyman, R. A., Karin, M., and Moore, D. D. (2002) Dev. Cell 2, 721–731[CrossRef][Medline] [Order article via Infotrieve]
  21. Wang, L., Han, Y., Kim, C. S., Lee, Y. K., and Moore, D. D. (2003) J. Biol. Chem. 278, 44475–44481[Abstract/Free Full Text]
  22. Bennett, M., Toth, J. I., and Osborne, T. F. (2004) J. Biol. Chem. 279, 37360–37367[Abstract/Free Full Text]
  23. Matsukuma, K. E., Bennett, M. K., Huang, J., Wang, L., Gil, G., and Osborne, T. F. (2006) J. Lipid Res. 47, 2754–2761[Abstract/Free Full Text]
  24. Lu, T. T., Makishima, M., Repa, J. J., Schoonjans, K., Kerr, T. A., Auwerx, J., and Mangelsdorf, D. J. (2000) Mol. Cell 6, 507–515[CrossRef][Medline] [Order article via Infotrieve]
  25. Luo, Y., Liang, C. P., and Tall, A. R. (2001) J. Biol. Chem. 276, 24767–24773[Abstract/Free Full Text]
  26. Willy, P. J., and Mangelsdorf, D. J. (1997) Genes Dev. 11, 289–298[Abstract/Free Full Text]
  27. Brendel, C., Schoonjans, K., Botrugno, O. A., Treuter, E., and Auwerx, J. (2002) Mol. Endocrinol. 16, 2065–2076[Abstract/Free Full Text]
  28. Venteclef, N., Smith, J. C., Goodwin, B., and Delerive, P. (2006) Mol. Cell. Biol. 26, 6799–6807[Abstract/Free Full Text]
  29. Pare, J. F., Malenfant, D., Courtemanche, C., Jacob-Wagner, M., Roy, S., Allard, D., and Belanger, L. (2004) J. Biol. Chem. 279, 21206–21216[Abstract/Free Full Text]
  30. Datta, S., Wang, L., Moore, D. D., and Osborne, T. F. (2006) J. Biol. Chem. 281, 807–812[Abstract/Free Full Text]
  31. Goodwin, B., Jones, S. A., Price, R. R., Watson, M. A., McKee, D. D., Moore, L. B., Galardi, C., Wilson, J. G., Lewis, M. C., Roth, M. E., Maloney, P. R., Willson, T. M., and Kliewer, S. A. (2000) Mol. Cell 6, 517–526[CrossRef][Medline] [Order article via Infotrieve]
  32. Nitta, M., Ku, S., Brown, C., Okamoto, A. Y., and Shan, B. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 6660–6665[Abstract/Free Full Text]
  33. Apfel, R., Benbrook, D., Lernhardt, E., Ortiz, M. A., Salbert, G., and Pfahl, M. (1994) Mol. Cell. Biol. 14, 7025–7035[Abstract/Free Full Text]
  34. Willy, P. J., Umesono, K., Ong, E. S., Evans, R. M., Heyman, R. A., and Mangelsdort, D. J. (1995) Genes Dev. 9, 1033–1045[Abstract/Free Full Text]
  35. Repa, J. J., Liang, G., Ou, J., Bashmakov, Y., Lobaccaro, J. M., Shimomura, I., Shan, B., Brown, M. S., Goldstein, J. L., and Mangelsdorf, D. J. (2000) Genes Dev. 14, 2819–2830[Abstract/Free Full Text]
  36. Peet, D. J., Turley, S. D., Ma, W., Janowski, B. A., Lobaccard, J.-M. A., Hammer, R. E., and Mangelsdorf, D. J. (1998) Cell 93, 693–704[CrossRef][Medline] [Order article via Infotrieve]
  37. Chen, W., Chen, G., Head, D. L., Mangelsdorf, D. J., and Russell, D. W. (2007) Cell Metab. 5, 73–79[CrossRef][Medline] [Order article via Infotrieve]
  38. Lehmann, J. M., Kliewer, S. A., Moore, L. B., Smith-Oliver, T. A., Oliver, B. B., Winegar, D. A., Blanchard, D. E., Spencer, T. A., and Willson, T. M. (1997) J. Biol. Chem. 272, 3137–3140[Abstract/Free Full Text]
  39. Repa, J. J., Turley, S. D., Lobaccaro, J. A., Medina, J., Li, L., Lustig, K., Shan, B., Heyman, R. A., Dietschy, J. M., and Mangelsdorf, D. J. (2000) Science 289, 1524–1529[Abstract/Free Full Text]
  40. Repa, J. J., Berge, K. E., Pomajzl, C., Richardson, J. A., Hobbs, H., and Mangelsdorf, D. J. (2002) J. Biol. Chem. 277, 18793–18800[Abstract/Free Full Text]
  41. Mak, P. A., Laffitte, B. A., Desrumaux, C., Joseph, S. B., Curtiss, L. K., Mangelsdorf, D. J., Tontonoz, P., and Edwards, P. A. (2002) J. Biol. Chem. 277, 31900–31908[Abstract/Free Full Text]
  42. Luo, Y., and Tall, A. R. (2000) J. Clin. Investig. 105, 513–520[Medline] [Order article via Infotrieve]
  43. Watanabe, M., Houten, S. M., Wang, L., Moschetta, A., Mangelsdorf, D. J., Heyman, R. A., Moore, D. D., and Auwerx, J. (2004) J. Clin. Investig. 113, 1408–1418[CrossRef][Medline] [Order article via Infotrieve]
  44. Osborne, T. F. (2000) J. Biol. Chem. 275, 32379–32382[Free Full Text]
  45. Goodwin, B., Watson, M. A., Kim, H., Miao, J., Kemper, J. K., and Kliewer, S. A. (2003) Mol. Endocrinol. 17, 386–394[Abstract/Free Full Text]
  46. Moschetta, A., Bookout, A. L., and Mangelsdorf, D. J. (2004) Nat. Med. 10, 1352–1358[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
S. Bhatnagar, H. A. Damron, and F. B. Hillgartner
Fibroblast Growth Factor-19, a Novel Factor That Inhibits Hepatic Fatty Acid Synthesis
J. Biol. Chem., April 10, 2009; 284(15): 10023 - 10033.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
M. I. Lefterova, Y. Zhang, D. J. Steger, M. Schupp, J. Schug, A. Cristancho, D. Feng, D. Zhuo, C. J. Stoeckert Jr., X. S. Liu, et al.
PPAR{gamma} and C/EBP factors orchestrate adipocyte biology via adjacent binding on a genome-wide scale
Genes & Dev., November 1, 2008; 22(21): 2941 - 2952.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
Y. Kamei, S. Miura, T. Suganami, F. Akaike, S. Kanai, S. Sugita, A. Katsumata, H. Aburatani, T. G. Unterman, O. Ezaki, et al.
Regulation of SREBP1c Gene Expression in Skeletal Muscle: Role of Retinoid X Receptor/Liver X Receptor and Forkhead-O1 Transcription Factor
Endocrinology, May 1, 2008; 149(5): 2293 - 2305.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
N. Venteclef, A. Haroniti, J.-J. Tousaint, I. Talianidis, and P. Delerive
Regulation of Anti-atherogenic Apolipoprotein M Gene Expression by the Orphan Nuclear Receptor LRH-1
J. Biol. Chem., February 15, 2008; 283(7): 3694 - 3701.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/28/20164    most recent
M702895200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsukuma, K. E.
Right arrow Articles by Osborne, T. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsukuma, K. E.
Right arrow Articles by Osborne, T. F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement