![]()
|
|
||||||||
J. Biol. Chem., Vol. 282, Issue 29, 21110-21115, July 20, 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1
2
From the
Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032 China and the
Department of Entomology, University of Maryland, College Park, Maryland 20742
Received for publication, October 11, 2006 , and in revised form, April 24, 2007.
| ABSTRACT |
|---|
|
|
|---|
Mpl1 appressoria is dramatically reduced indicating that lipid droplets are required for solute accumulation. This was linked with the reduced ability to breach insect cuticle so that Mpl1 is a pathogenicity determinant. Blast searches of fungal genomes revealed that perilipin homologs are found only in pezizomycotinal ascomycetes and occur as single copy genes. Expression of Mpl1 in yeast cells, a fungus that lacks a perilipin-like gene, blocked their ability to mobilize lipids during starvation conditions. | INTRODUCTION |
|---|
|
|
|---|
The proteins that mediate lipid storage in fungi are still unknown. In this study we show that the ascomycete Metarhizium anisopliae, a ubiquitous insect pathogen and biocontrol agent (8), produces a single mammalian perilipin homolog we designated as Mpl1 for Metarhizium perilipin-like protein. To demonstrate possible conserved functions, we characterized the Mpl1 gene, asked whether its product participates in the regulation of lipid storage, and investigated its influence on fungal processes such as pathogenicity. Our data suggest that M. anisopliae represents a tractable new model system to study the functions of LDs and identify the components and mechanisms of energy homeostasis.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
GFP Fusion Constructs and Expression—Full-length cDNA of Mpl1 was amplified from a library of genes expressed by M. anisopliae in insect hemolymph (9). The primers PerEF (CTTGGATCCCGGGATGGCTGTCCCTCAGGTCAA) and PerER (CTTGGATCCTTGGCATTGGCATAGACT) were used to introduce BamHI sites at both ends as well as an additional SmaI site at the 5' end. The product was digested with BamHI and then inserted into the BamHI site of pYes2 (Invitrogen) to generate pYes2Per. The GFP gene was amplified from pEGFP (Clontech) with the primers GfpPerF (CCGAGCTCGGATCCCGTACCGGTCGCCACCATG) and GfpPerR (AGGGACAGCCATCCCCTTGTACAGCTCGTCCATGC) by deleting the 3' TAA stop codon (the underlined regions exactly match the terminal regions of pYes2Per after digestion with SmaI). The product was integrated into the SmaI site of plasmid pYes2Per using an in-fusion dry-down PCR cloning kit (Clontech) to generate the plasmid pGfpPer.
To determine whether MPL1 localizes to LDs in a fungus lacking endogenous perilipin-like proteins, Saccharomyces cerevisiae strain INVSc1 (Invitrogen) was transformed with pGfpPer and the transformant grown overnight in SC-U medium plus 2% raffinose. The culture was adjusted to A600 = 0.4 in 2% galactose SC-U medium and incubated at 30 °C, 250 rpm for 12 h.
To ectopically express GFP-tagged MPL1 in its endogenous M. anisopliae environment, the Gfp-Mpl1 fusion product was excised from pGfpPer and inserted into the BamHI site of pBARGPE1 (20) under the control of a constitutive Aspergillus GpdA promoter. The construct was linearized with ScaI and transformed into M. anisopliae protoplasts as described (11).
RT-PCR Analysis of Gene Expression—To monitor gene expression of Mpl1 mycelium from 36-h Sabouraud dextrose broth (SDB), cultures were collected by filtration and washed three times with sterile distilled water. Equal amounts (0.2 g, wet weight) of mycelia were incubated (6 h) in 10 ml of water or water supplemented with 0.1% bean root exudate (25) or 1% cuticle. Mycelia were also incubated in minimal medium (MM, glucose 10 g/liter, NaNO3 6 g/liter, KCl 0.52 g/liter, MgSO4·7H2O 0.52 g/liter, KH2PO4 0.25 g/liter) or in hemolymph of Manduca sexta. For time course studies, conidia were inoculated in SDB for 1–12 h. To identify any inductive relationship with fatty acids, oleic acid (OA, 600 µM) was added to 36-h MM cultures and incubated for 1–12 h. The mycelia were collected for RNA extraction, cDNA conversion, and RT-PCR analysis as described before (11).
Fluorescence Microscopy—Yeast or Metarhizium cells were fixed in 3% formaldehyde in PBS for 20 min and then washed four times with PBS (12). Cells were then stained with either Nile Red (NR, Sigma) or Bodipy (D3922, Invitrogen) to detect neutral lipids. A stock solution of NR (500 µg/ml) was prepared in acetone and diluted to 5–10 µg/ml in PBS. Bodipy was used at 10 µg/ml (stock, 1 mg/ml in ethanol) in PBS and provided a more stable fluorescent signal than NR.
Lipid Quantification—Total lipid quantification was conducted using a phosphoric acid-vanillin method (13). Conidia of both the wild type and mutant were harvested from newly mycosed Manduca larvae, potato dextrose agar (PDA), or PDA plus 600 µM oleic acid. Spore suspensions (0.5 ml containing
1.5 x 108 conidia/ml) were added to glass tubes. To each tube, 2 ml of 18 M H2SO4 was added, and the tubes were boiled in a water bath for 10 min. After cooling (5 min at room temperature), 5 ml of phosphoric acid-vanillin reagent (0.12 g of vanillin, 20 ml of water and the volume adjusted to 100 ml with 85% H3PO4) was added, and the tubes were incubated at 37 °C for 15 min. The samples were centrifuged, and the absorbance of supernatants was measured at 530 nm. A standard curve was generated using triolein (Sigma).
For yeast studies, a single colony of pYes2Per transformed yeast cells was incubated overnight in YPD (1% yeast extract, 2% peptone, and 2% dextrose), YPD plus 600 µM OA, 2% raffinose SC-U, or 2% raffinose SC-U plus OA. Cells harvested from the different media were washed three times, adjusted to A600 = 1.0 with sterile water, and incubated for up to 20 h to induce starvation. The cell concentration was adjusted to A600 = 2.0 and 0.5 ml used for lipid assay. Differences in lipid content between treatments were compared using the Duncan's analysis of variance analysis (SPSS, 11.0.0).
Appressorial Turgor Assay—To examine the potential involvement of MPL1 in this process, appressoria were induced on locust hind wings (14). Appressorial turgor pressure was assayed using serial solutions of PEG-8000 (2–13 g in 10 ml of distilled water) (15). Individual wings were dipped in PEG solutions for 10 min, and the percentage of collapsed appressoria was determined from 300 cells per PEG solution.
Insect Bioassay—Virulence of the wild type and
Mpl1 was assayed against newly emerged 5th instar larvae of M. sexta (16). Conidia were applied either topically by immersion of larvae in an aqueous suspension containing 2 x 107 conidia/ml for 20 s or by injecting the second proleg with 10 µl of an aqueous suspension containing 5 x 106 spores per ml. Each treatment had three replicates with 10 insects each, and the experiments were repeated twice. Mortality was recorded every 12 h.
| RESULTS |
|---|
|
|
|---|
350 amino acids of the N-terminal sequence where the lipid targeting functions reside. Distal to the N-terminal conservations, the proteins diverge to varying degrees (17). The full open reading frame of Mpl1 encodes a protein of 183 amino acids (20.3 kDa with a predicted pI of 8.96). MPL1 is therefore only 35% the size of mouse perilipin A (Per A), but it has a similar overall structure and several conserved regions with its N-terminal sequence (overall sequence similarity E = 1 x 10-5) (Fig. 1A). In particular, like the N terminus of Per A (17, 18), the MPL1 protein contains N-terminal
-strands, three moderately hydrophobic regions (H1, H2, and H3), and an acidic region (129–136 in MPL1) before H2. Also like Per A, MPL1 has multiple phosphorylation sites, including a consensus cAMP-dependent protein kinase phosphorylation site at position 96 in a region conserved with Per A (Fig. 1, A and B).
|
|
Expression Profile and Localization of MPL1—We analyzed Mpl1 expression in time course studies of M. anisopliae grown in different media. RT-PCR analysis demonstrated strong expression of Mpl1 when the fungus was grown in nutrient-rich media (insect hemolymph or SDB) as compared with nutrient-poor media (Fig. 2A). The addition of fatty acids to mammalian cells stimulates lipid accumulation and increases intracellular levels of perilipin (21). Likewise, transcription of Mpl1 by M. anisopliae germlings was up-regulated within 30 min following the addition of oleic acid to minimal medium (MM) (Fig. 2B). Conidia contained many large LDs (Fig. 3A) and demonstrated a strong enrichment of Mpl1 transcripts. Transcription levels decreased during germination (Fig. 2C), and LD numbers dropped by 40% between 6 and 12 h (Fig. S2) as lipid stores are mobilized during germ tube elongation (Fig. 3C). Collectively, these results suggest that Mpl1 regulation parallels lipid storage.
To visualize the intracellular targeting of MPL1 in vivo, we expressed an MPL1-GFP fusion protein in M. anisopliae using the Aspergillus GpdA promoter. We also determined whether LD localization is a general quality of MPL1 by expressing it with the Gal1-inducible promoter in the yeast S. cerevisiae, which is a system that lacks endogenous perilipin-like proteins. Consistent with GFP fusions of mammalian PAT proteins, i.e. perilipin A (22), TIP47 (23), and adipocyte differentiation-related protein (24), N-terminal fusion of MPL1 with GFP did not disrupt the ability of the protein to localize to lipid vesicles. Transformed yeast and Metarhizium cells treated with the neutral lipid stain NR co-localized with the GFP signal confirming that MPL1 is binding to LDs (Fig. 2, D–F). No additional diffuse cytoplasmic signal was seen with either GFP or NR. The expression patterns and the intracellular localization of MPL1 are therefore consistent with the proposal that the protein plays a regulatory role in global triacylglycerol (TAG) storage by acting at the level of LDs.
|
Mpl1 conidia have
2.4-fold fewer LDs than WT (p < 0.05) indicating that knock-out of Mpl1 impairs, but does not abolish, the ability of M. anisopliae to store lipid (Fig. 3B). During germination of WT conidia in minimal medium, the total number of LDs diminishes by 62% indicative of lipid degradation, and the remaining LDs migrate into the germ tube apexes (mean per apex = 3.6 ± 1.1). This distribution of LDs is explainable by fungi being tip growers; the tip is the area of greatest metabolism and where new membranes are being laid down. Relative to the WT, the
Mpl1 germ tubes are thinner and apparently analogous to the "lean" phenotype of perilipin-deficient mice (3) (Fig. 3, C and D). Approximately 50% of
Mpl1 germ tubes lack visible LDs. The remaining germ tubes have up to three LDs. The aggregated, albeit small, clusters of LDs at the poles of
Mpl1 conidia (Fig. 3B) and the successful transportation of residual LDs to their hyphal tips (Fig. 3D) indicate that Mpl1 is not crucially involved in mediating the positioning of droplets in Metarhizium. This contrasts with Drosophila where perilipin regulates transportation of LDs (25). The pattern of LD distribution was also studied during formation of appressoria on locust hind wings. LDs moved into the differentiating hyphal tip so the WT appressoria were enriched in LDs.
Mpl1 appressoria frequently contained no LDs at all (Fig. 3, E and F).
|
Mpl1 mutants have fewer (Fig. 3, G and H).
Because
Mpl1 cell types contain relatively few, if any, LDs, the regulation of lipid homeostasis by MPL1 in Metarhizium was also studied by assaying total levels of intracellular lipids (Fig. 4A). Consistent with an elevated number of LDs, there was >2-fold more lipid in WT conidia relative to
Mpl1 conidia irrespective of whether they were harvested from insect cadavers, PDA, or PDA plus OA. A more dramatic difference in lipid levels (>7-fold) was observed when germinating the WT and
Mpl1 conidia in a minimal medium (Fig. 4A), indicative of rapid depletion of residual stored lipid in the mutant. As OA up-regulates Mpl1 expression (Fig. 2B), Mpl1 activity might adjust storage of lipids when nutrients are available to ensure extended survival when food supply is limiting. However, the 8% increase in lipid content in conidia harvested from PDA plus OA as compared with PDA alone was not statistically significantly (p > 0.05).
|
MPL1 Affects Appressorial Differentiation and Fungal Virulence—The "Cap20" transcript of the Mpl1 homolog in the plant pathogen C. gloeosporioides is present in conidia, expressed during formation of appressoria, and null mutants are not pathogenic to tomatoes (10). To investigate the role of Mpl1 on appressorium formation/function in M. anisopliae, we induced appressorial differentiation on locust hind wings. WT appressorial differentiation typically occurs after nuclear division with a septum being formed between the appressorium and conidial mother cell (Fig. 5A). However, this compartmentalization of germ tubes occurred in only 10% of the mutant germlings (Fig. 5B).
Analysis of appressorial collapse rates in M. anisopliae using serial concentrations of PEG-8000 shows that the loss of Mpl1 results in a dramatic reduction of turgor pressure (Fig. 5C). This suggests that lipolysis of LDs and consequent production of solutes produce turgor in the wild type. Virulence tests using 5th instar larvae of M. sexta revealed a significant reduction of mortality and speed of kill by
Mpl1 as compared with the WT. The mutant failed to achieve 50% mortality before the insects pupated (Fig. 6A). However, when the cuticle was bypassed by injecting spores directly into the hemocoele, the speed of kill by the WT (LT50 = 4.42 days) and the mutant (LT50 = 4.72 days) were not significantly different (p = 1.58, t = 0.13) (Fig. 6B). The results indicate that the lack of Mpl1 affects fungal virulence by reducing mechanical penetration of the host cuticle.
|
| DISCUSSION |
|---|
|
|
|---|
-strands and central three hydrophobic regions that target and anchor Per A to LDs and are critical for TAG storage (17, 18). Phosphorylation of perilipin by cAMP-dependent protein kinase results in the conformational change that initiates lipolysis by hormone-sensitive lipase (29). Consistent with this, MPL1 has multiple phosphorylation sites. The studies we report here demonstrate that MPL1 operates in a perilipin-like manner by localizing to lipid droplets and modulating the rate of hydrolysis. Similar to the lean Per A knock-out mouse under diet control (3), the germ tubes of
Mpl1 are slimmer than those of the wild type Metarhizium (Fig. 3, C and D). This demonstrates that perilipin-like proteins in the most diverse eukaryotes share an ancestral function. It also opens up new perspectives in this field by providing insights into the original functions of these proteins and will facilitate tracing when in the course of evolution the different forms and roles of the perilipin family proteins diverged.
It is interesting that among fungi, homologs (E
10-5) of MPL1 are only present in pezizomycotinal ascomycetes. The pezizomycotinal fungi however include many of the most important and well known animal and plant pathogens. Different lipid-associated proteins have been identified in yeast (21), but the yeast genome does not have a perilipin homolog. Yeast cells expressing Mpl1 were unable to make use of their stored lipids during starvation. It suggests that the yeast has lost, or never acquired, the phosphorylation mechanism for removing perilipin-like proteins to access LDs. The pathways responsible for lipid metabolism in the non-perilipin-producing majority of fungi are clearly worth exploring.
Reflecting general differences between animal and fungal lineages, perilipin-like proteins have also been selected to cope with different tasks as the absence of MPL1 produced unique phenotypes, including reduced appressorial turgor pressure and decreased virulence against an insect host. The appressoria of the rice blast fungus Magnaporthe grisea (26, 27) also take up water to generate turgor for mechanical penetration of the host surface (27). Turgor is generated by accumulation of solutes, particularly the lipid-breakdown product glycerol (27, 28). Besides the accumulation of glycerol, cell compartmentalization is also required in rice blast fungus M. grisea to generate appressorial turgor (27). Our data suggest that the single MPL1 homolog in M. grisea (MGG_11916.5, E = 1.42 x 10-43) could be a candidate for regulating these processes. This may be a general phenomenon among pathogenic ascomycetes as Cap20 mutants of the plant pathogen C. gloeosporioides also have diminished virulence. The authors suggested that although normal looking the mutant appressoria might not be fully functional (10).
The functional demonstration of a role for Mpl1 in virulence to insects is important for understanding the molecular and biochemical basis of pathogenicity and should be relevant to innovating new measures of pest control. In addition, our previous microarray analyses indicated that Mpl1 is up-regulated (>2-fold) in aging fungal sectors, and the degenerated fungus demonstrates decreased levels of cAMP and variable rates of lipid metabolism (30). Collectively, the data suggest that M. anisopliae represents a tractable new model system to study the functions of LDs and identify the components and mechanisms of energy homeostasis and how that relates to other physiological processes, including aging.
| FOOTNOTES |
|---|
* This work was supported by National Science Foundation Grant MCB-0542904 and the National Hi-Tech Research and Development Program of China Grant 2006AA10A212. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. ![]()
The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1 and S2. ![]()
1 To whom correspondence may be addressed. Tel.: 86-21-54924157; Fax: 86-21-54924015; E-mail: cswang{at}sibs.ac.cn. 2 To whom correspondence may be addressed. Tel.: 301-405-5402; Fax: 301314-9290; E-mail: stleger{at}umd.edu.
3 The abbreviations used are: LDs, lipid droplets; PAT, perilipin, adipocyte differentiation-related protein and TIP47; TAG, triacylglycerol; OA, oleic acid; PBS, phosphate-buffered saline; RT, reverse transcription; GFP, green fluorescent protein; PDA, potato dextrose agar; NR, Nile Red; WT, wild type; PEG, polyethylene glycol; Per A, perilipin A. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Wang, Z. Duan, and R. J. St. Leger MOS1 Osmosensor of Metarhizium anisopliae Is Required for Adaptation to Insect Host Hemolymph Eukaryot. Cell, February 1, 2008; 7(2): 302 - 309. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |