JBC Transcription and Nuclear Factor Monoclonals

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M611041200 on May 24, 2007

J. Biol. Chem., Vol. 282, Issue 29, 21551-21560, July 20, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/29/21551    most recent
M611041200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wei, F.
Right arrow Articles by Atchison, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wei, F.
Right arrow Articles by Atchison, M. L.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Sumoylation of Oct4 Enhances Its Stability, DNA Binding, and Transactivation*

Fang Wei{ddagger}, Hans R. Schöler§, and Michael L. Atchison{ddagger}1

From the {ddagger}Department of Animal Biology, Mari Lowe Center for Comparative Oncology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104 and §Max Planck Institute of Molecular Biomedicine, Röntgenstrasse 20, D-48149 Münster, Germany

Received for publication, November 30, 2006 , and in revised form, May 7, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Transcription factor Oct4 is a master regulator affecting the fate of pluripotent stem cells and germ cell precursors. Oct4 expression is tightly regulated, and small changes in expression level can have dramatic effects on differentiation or oncogenesis. Post-translational modifications including phosphorylation and ubiquitination have been reported to regulate Oct4 transcriptional activity. Here we show that Oct4 is a target for small ubiquitin-related modifier (SUMO)-1 modification in vivo and in vitro. Sumoylation of Oct4 occurs at a single lysine, Lys118, located at the end of the amino-terminal transactivation domain and next to the Pit1-Oct-Unc86 (POU) DNA binding domain. SUMO-1 and Oct4 colocalize at several promoter sequences in vivo, and a fraction of Oct4 molecules colocalized with SUMO-1 in nuclear aggregates. Sumoylation of Oct4 led to significantly increased Oct4 stability and increased DNA binding. In addition, SUMO-1 cotransfection led to augmented Oct4 transactivation potential that was reduced when the Oct4 sumoylation target site was mutated. Therefore, sumoylation of Oct4 results in increased stability, DNA binding, and transactivation and provides an important mechanism to regulate Oct4 activity.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Oct4 (also termed Oct3, Oct3/4, or POU5F1) is critical for mammalian embryonic development and for embryonic stem cell pluripotency (1-4). Oct4 expression correlates with the undifferentiated phenotype in embryonic stem (ES)2 cells and is needed for maintaining pluripotency in ES cells and later for germ cell viability (5-7). Oct4 expression begins around the four- to eight-cell stage and ceases as cells differentiate into various lineages (2, 8-10), although expression persists in germ cell precursors of adult mice (4, 9, 11).

The level of Oct4 expression is crucial for determining the development of distinct cell fates of ES cells. If expressed at wild-type levels, Oct4 maintains the pluripotent phenotype of ES cells. However, if expressed 2-fold higher than normal, rather than maintaining pluripotency, cells differentiate into endoderm and mesoderm. On the other hand, lower than normal levels cause cells to differentiate into trophectoderm (6). In addition, only 1.5-fold elevated expression of Oct4 in germ cells leads to development of gonadal tumors (12, 13). Therefore, very small changes in the expression level of Oct4 can have significant impact on cell fate and growth properties. The Oct4 gene is regulated by a proximal enhancer that directs epiblast-specific expression and a distal enhancer that drives Oct4 expression in preimplantation embryos and migratory and postmigratory primordial germ cells but not in epiblast cells (4). The upstream promoter sequences of human, bovine, and murine Oct4 orthologs contain four conserved regions (CR1 to CR4) with 66-94% conservation (14).

Oct4 is a member of the POU transcription factor family and can activate or repress the expression of target genes through binding to an octameric DNA sequence motif (8). Oct4 dimers can also bind in two configurations to octamer sequences dubbed either palindromic Oct factor recognition element (PORE) or more PORE (MORE) elements (15, 16). A variety of genes are regulated by Oct4, and chromatin immunoprecipitation (ChIP) on chip approaches showed that Oct4 is associated with 623 promoter regions in ES cells (17). Interestingly Oct4 was bound to both active and inactive promoters suggesting that it is important for both activating genes needed for pluripotency while at the same time repressing genes that might induce lineage differentiation. The ability to activate transcription in one context while repressing in another is likely due to either interactions with other transcription factors bound at promoters or Oct4 post-translational modifications that might modify its activity. Sox2 is one transcription factor that binds to DNA in association with Oct4, and based on conserved sequence comparisons, a composite Oct-Sox2 element was defined (18, 19).

Although Oct4 DNA binding can be influenced by interactions with other proteins (such as Sox2), its function can also be regulated by post-translational modifications. Differential phosphorylation of Oct4 in 293 and HeLa cells was suggested to affect transactivation ability of the Oct4 carboxyl-terminal transactivation domain (20). WWP2 was found to be an E3 ubiquitin ligase for Oct4 ubiquitination, and this activity can suppress Oct4 transcriptional activity (21). Small ubiquitin-related modifier (SUMO) modification (sumoylation) is another type of post-translational modification that might regulate Oct4 function. An increasing number of proteins important for regulating gene expression have been found to be reversibly modified by SUMO (22). The consensus SUMO acceptor site consists of the sequence {psi}KX(E/D) where {psi} is a large hydrophobic amino acid, K is the site of conjugation through the lysine {epsilon}-amino group covalently linked to SUMO, X represents any amino acid, and E/D represent glutamic acid and aspartic acid, respectively (23). The sumoylation machinery requires a SUMO substrate, the heterodimeric E1-activating enzyme Aos1/Uba2, the E2-conjugating enzyme Ubc9, and an E3 ligase. SUMO is first activated by the E1-activating enzyme, subsequently transferred to Ubc9, and then conjugated to substrates catalyzed by the E3 ligase (22).

Four SUMO homologs have been described in mammals. SUMO-1 shares 18% sequence identity with ubiquitin. SUMO-2 and SUMO-3 are ~50% identical in sequence to SUMO-1 and differ from each other by only three amino-terminal residues. The recently described SUMO-4 has an 86% amino acid homology with SUMO-2 but is expressed mainly in the kidney (24). SUMO-1, SUMO-2, and SUMO-3 appear to modify both common as well as unique substrates. In contrast to ubiquitination, sumoylation does not target a protein for degradation. Instead sumoylation appears to regulate transcription, nucleocytoplasmic transport, protein stability, protein activity, or protein-protein interactions.

We analyzed the mouse Oct4 protein sequence and found three putative SUMO acceptor sites. Two of these sites are conserved in mouse and human Oct4 homologs. Because small changes in Oct4 expression level can have very large influences on cell function and growth properties, it was of considerable interest whether Oct4 was sumoylated and how this might influence Oct4 function. Here we show that transcription factor Oct4 can be sumoylated with SUMO-1 on Oct4 lysine 118 both in vitro and in vivo. This sumoylation enhances Oct4 stability, DNA binding, and transactivation function. Thus, covalent linkage to SUMO-1 represents a mechanism that can regulate Oct4 activity.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
DNA Constructs—Constructs expressing full-length Oct4 driven by the CMV promoter were described previously (20, 25). Oct4 single amino acid substitutions K118R, K215R and K244R and the triple mutation K118R/K215R/K244R (3KR) were constructed using the QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's instructions. For in vitro transcription and translation, the Oct4 wild-type and mutant constructs (K118R and K118R/K215R/K244R) were prepared by ligating EcoRI/XbaI PCR fragments into EcoRI/XbaI sites of plasmid pcDNA3-FLAG. All constructs were verified by nucleic acid sequencing. Plasmids pFLAG-SUMO-1, pFLAG-SUMO-2, and pHA-Ubc9 were kindly provided by Kyoungsook Park (Sungkyunkwan University). The 6W-37tk-luc, 6xPORE-37tk-luc, and 6xMORE-37tk-luc constructs were described previously (16).

Antibodies—Polyclonal antibodies goat anti-Oct4 (sc-8628) and rabbit anti-Oct4 (sc-9081) and anti-SUMO-1 (sc-9060) were purchased from Santa Cruz Biotechnology. Anti-beta-actin (4967) was purchased from Cell Signaling Technology.

Cell Culture, Transfection, Immunoblotting, and Immunoprecipitation—NIH3T3 and 293 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, penicillin, and streptomycin. P19 mouse embryonal carcinoma cells were cultured in {alpha}-minimum essential medium supplemented with 2.5% fetal bovine serum and 7.5% newborn calf serum. NIH3T3 cells were transfected using the Effectene (Qiagen) method following the manufacturer's instructions. For 293 cells, transient transfection experiments were performed by electroporation at 250 V, 1180 microfarads using an Invitrogen Cell Porator. Transient transfection of P19 cells was performed using Lipofectamine 2000 reagent (Invitrogen). For coimmunoprecipitation, whole-cell lysates were extracted in RIPA buffer (50 mM Tris, pH 7.6, 150 mM NaCl, 2 mM EDTA, 1% Nonidet P-40) supplemented with 0.1 mM phenylmethylsulfonyl fluoride, 1x mammalian protease inhibitor mixture (Sigma), and 20 mM N-ethylmaleimide. For immunoprecipitation under denaturing conditions, cells were boiled for 10 min in 1% SDS-containing Tris-buffered saline (TBS; 50 mM Tris base, pH 7.6, 0.9% NaCl) followed by sonication and 18-fold dilution with TBS containing 1% Triton X-100. Cell lysates (250-500 µg) were immunoprecipitated with 40 µl of EZviewTM Red anti-FLAG® M2 affinity gel (F2426, Sigma) according to the manufacturer's instructions. Immunoreactive proteins were visualized using the ECL kit (Amersham Biosciences) or otherwise indicated by SuperSignal West Pico Chemiluminescent Substrate (34080, Pierce) following the manufacturer's protocol.

In Vitro Sumoylation Assay—Sumoylation reactions were performed using the Boston Biochemical sumoylation kit (K-710). Each reaction contained a total volume of 10 µl with 3 µl of 35S-labeled protein from in vitro transcription and translation reactions, 100 ng of E1 (SAE1/SAE2), 1 µg of E2 (Ubc9), and 500 ng of SUMO-1 (unless otherwise stated) in sumoylation buffer (50 mM Hepes, pH 8.0, 1 mM dithiothreitol, 100 mM NaCl, 1 mM MgCl2, 2 mM ATP). Reactions were incubated for 60 min at 37 °C and stopped by adding SDS-PAGE sample buffer and boiling for 5 min. Gels were dried and exposed to Eastman Kodak Co. x-ray film.

Indirect Immunofluorescence Assay—Cells transfected on coverslips were fixed in 3% paraformaldehyde for 20 min at room temperature. Cells were permeabilized in immunofluorescence buffer (0.2% fish skin gelatin, 0.2% Triton X-100 in phosphate-buffered saline) for 5 min followed by a 1-h incubation in immunofluorescence buffer with primary antibodies (goat anti-Oct4 and rabbit anti-SUMO-1) at 1:80 dilution. Cells were washed three times in phosphate-buffered saline. Fluorescently labeled Alexa Fluor 488 anti-rabbit and Alexa Fluor 594 anti-goat (Molecular Probes, Eugene, OR) were used as secondary antibodies for 30 min. Coverslips were washed in phosphate-buffered saline and mounted on glass slides using VECTASHIELD mounting medium (Vector Laboratories). Fluorescence confocal microscopy was performed using a Leica TCS SL system.

Stability Assays—3T3 cells were transfected with either CMV-Oct4, CMV-Oct4-K118R mutants, or CMV-Oct4 with FLAG-SUMO-1. P19 cells were transfected with FLAG-SUMO-1 and HA-Ubc9. After 24 h, cells from the same transfection were pooled and split into 10-cm plates to make transfection efficiencies the same in each plate. After an additional 24 h, 100 µg/ml cycloheximide (C4859, Sigma) was added to each plate, and cells were subsequently harvested at the indicated times. Equal amounts of total proteins from each treatment were taken to perform Western blot or immunoprecipitation.

Luciferase Reporter Assay—The total amount of DNA per plate was equalized to 25 µg with carrier plasmid. 48 h after transfection, cells were washed with phosphate-buffered saline and lysed in 250 mM Tris-HCl, pH 7.8, 1 mM DTT through three cycles of freezing and thawing as described previously (16). Approximately 1/20 volume of the crude lysate was used to measure the luciferase and beta-galactosidase activities in standard assays.

Elution of Proteins from SDS-Polyacrylamide Gels—1 mg of FLAG-SUMO-1- and Oct4-cotransfected NIH3T3 cell extract was immunoprecipitated with anti-FLAG beads, and eluted proteins were run on a 12% SDS-polyacrylamide gel. The gel was cut into five slices separating different molecular mass proteins. Elution and recovery of proteins was performed as described previously (26). Briefly proteins were eluted by incubating gel slices for 24 h at room temperature in elution buffer (50 mM Tris, pH 7.4, 0.1 mM EDTA, 0.1% SDS, 0.5 mM DTT, 100 mM NaCl). 20 µg of bovine serum albumin was added to each fraction, and proteins were precipitated by addition of 5 volumes of acetone at -20 °C overnight. Pellets were washed with 100% ethanol, dried, and resuspended in 20 mM Hepes, pH 7.9, 0.5 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, 10% glycerol, 0.1% Nonidet P-40.

Electrophoretic Mobility Shift Assays (EMSAs)—Purified proteins were incubated with 10,000 cpm 32P-end-labeled DNA probe in 10 mM Hepes, pH 7.8, 5 mM MgCl2, 50 mM KCl, 0.5 mM DTT, 9% glycerol, 0.2 µg of poly(dI-dC) at room temperature for 30 min. Electrophoresis was performed on 4% nondenaturing polyacrylamide gels prerun for 30 min. The oligonucleotide probe was 5'-ctgactcctgccttcagggtATGCAAATtattaagtctcgag-3'.

Chromatin Immunoprecipitation—ChIP was carried out as described previously (27). Briefly cells were fixed in 1.1% formaldehyde for 10 min at 37 °C, and cross-linking was stopped by addition of glycine. After sonication, samples were diluted and immunoprecipitated using anti-Oct4 or anti-SUMO-1 antibody. Preimmune control ChIPs with the same amount of chromatin were performed with 5 µg of goat IgG (005-000-003, The Jackson Laboratory) and/or rabbit IgG (011-000-003, The Jackson Laboratory). The primers used for PCR are as follows: Oct4 promoter as indicated in Ref. 18, region 4 (mouse Pou5f1), -2098/-1928, GGAACTGGGTGTGGGGAGGTTGTA and AGCAGATTAAGGAAGGGCTAGGACGAGAG; Pax6 promoter, -1271/-1047, AGAGGGAGCATCCAATCGG and CTCCTCACTGGCCCATTAGC; Neurog1 promoter, -833/-1024, CGGTAATTACGGGCACGCT and AGTACGGCGCGCAACAA T; Ig{kappa} 3'-enhancer, AGTACGGCGCGCAACAAT and CTTGAAAGGGTGTGGAGTGCACCA. For all ChIP experiments, quantitative PCR analyses were performed in real time using the Roche Applied Science LightCycler 1.5 and repeated at least three times. Relative -fold enrichment was calculated based on quantitative PCR of the preimmune ChIP sample in the same region. For P19 sequential ChIP, a second immunoprecipitation was performed using chromatin samples eluted from the agarose beads of the first ChIP by 10 mM DTT in 37 °C for 30 min twice. Relative enrichment of each region was shown as a percentage of input. For differentiation of P19 cells prior to ChIP, cells were plated either in the presence or absence of 0.3 mM retinoic acid (R2625, Sigma) in antibiotic-free {alpha}-minimum essential medium for 4 days with one passage.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Oct4 Can Be Sumoylated in Vivo and in Vitro—Oct4 expression levels are important for controlling cell differentiation and pluripotency. Because sumoylation can control numerous protein functions, we sought to explore the possible sumoylation of Oct4. Comparison of the Oct4 amino acid sequence with the sumoylation consensus motif revealed three putative sumoylation sites (lysines 118, 215, and 244; see Fig. 1A). Mouse Oct4 motifs 117VKLE120 and 214CKSE217 are conserved in human Oct4 as well as in several other mammalian species. Potential sumoylation motif 243LKCP247, however, was only observed in mouse. To determine whether Oct4 could be sumoylated in vivo, NIH3T3 cells were transfected with an expression vector encoding Oct4 with increasing amounts of FLAG-tagged SUMO-1 expression plasmid. After 2 days cells were harvested in the presence of N-ethylmaleimide to prevent desumoylation, and samples were subjected to Western blot analyses with Oct4 antibody. In addition to native Oct4 migrating at about 40 kDa, a slower migrating anti-Oct4-reactive band of about 90 kDa was recognized (Fig. 1B). The intensity of this band increased with increasing FLAG-SUMO-1 expression (Fig. 1B).

To determine whether the 90-kDa form represented Oct4 molecules conjugated to SUMO-1, lysates were immunoprecipitated with anti-FLAG beads, and samples were subsequently analyzed by Western blot with anti-Oct4 antibody (Fig. 1C). Indeed the 90-kDa band was readily detected suggesting that it represents sumoylated Oct4. Surprisingly a band was also detected at 40 kDa (Fig. 1C, lanes 2 and 4). This band co-migrated with native Oct4 (data not shown) and appears to be due to interaction of Oct4 with a distinct sumoylated protein within the cell or SUMO-1 through noncovalent binding because it was not observed in samples that were isolated under denaturing conditions prior to immunoprecipitation (Fig. 1D, lane 2). On the contrary, the 90-kDa band was still detected under these conditions (Fig. 1D, lane 2). When N-ethylmaleimide was absent in the lysis buffer, both the 40- and 90-kDa anti-Oct4-reactive bands were reduced (data not shown) consistent with the 90-kDa band representing sumoylated Oct4 and the 40-kDa band representing Oct4 isolated by interaction with another sumoylated protein or SUMO-1. Similar results were observed in 293 cells (data not shown). When Oct4 was cotransfected with a plasmid expressing FLAG-SUMO-2, little sumoylated product was observed, and only the 40-kDa band representing native Oct4 interacting with the unknown sumoylated product was detected (Fig. 1C, lane 4). Therefore, our results strongly suggest that Oct4 can be covalently modified in vivo by SUMO-1 but not by SUMO-2.

To examine whether endogenous Oct4 could be sumoylated, we transfected FLAG-SUMO-1 alone or with HA-Ubc9 into embryonic carcinoma cell line P19. After immunoprecipitation with anti-FLAG affinity beads and Western blot with anti-Oct4 antibodies, the slow migrating band was observed in FLAG-SUMO-1- and HA-Ubc9-cotransfected samples (Fig. 2A) indicating that endogenous Oct4 can be sumoylated in P19 cells. We also performed ChIP experiments to detect endogenous Oct4 and SUMO-1 on specific DNA target sequences in P19 embryonal carcinoma cells (Oct4, Pax6, and Neurog1 promoters) (Fig. 2B). SUMO-1 was observed on all three promoters as was Oct4, whereas neither was detected at the immunoglobulin {kappa} 3'-enhancer, which fails to bind Oct4. To determine whether Oct4 and SUMO-1 are present together at the tested promoter regions, extracts immunoprecipitated with anti-Oct4 antibodies were then subjected to a second round of ChIP using SUMO-1 antibody. As shown in Fig. 2C, sequential ChIP with Oct4 followed by SUMO-1 antibodies showed that Oct4 and SUMO-1 bound together to the promoter regions. If SUMO-1 association with DNA is due to the presence of sumoylated Oct4, SUMO-1 should be lost after treatment of P19 cells with retinoic acid because this results in down-regulation of Oct4. Indeed as expected, retinoic acid treatment of P19 cells resulted in loss of Oct4 and SUMO-1 from each promoter, although loss at the Pax6 promoter was most easily visualized (Fig. 2D). Western blot of cell lysates confirmed that Oct4 was lost after retinoic acid treatment (Fig. 2E).


Figure 1
View larger version (31K):
[in this window]
[in a new window]

  		FIGURE 1.
Oct4 can be sumoylated in vivo. A, map of the Oct4 protein showing location of the amino-terminal transcriptional activation domain (N-TAD), POUs, POUh, and carboxyl-terminal transactivation (C-TAD) domains. Locations of the three lysines in mouse Oct4 that lie in possible sumoylation sites are indicated (Lys118, Lys215, and Lys244). In the lower panel, sequences surrounding sumoylated lysine 118 in mouse Oct4 (mOct4) are indicated with comparison with the human Oct4 (hOct4) sequence below. The asterisk denotes the lysine residue that is sumoylated in vivo and in vitro. B, CMV-Oct4 was cotransfected with FLAG-SUMO-1 expression vector into NIH3T3 cells, and cell lysates were subjected to Western blot with Oct4 antibodies. Western blot with anti-beta-actin was used as a loading control. C, NIH3T3 cells were cotransfected with CMV-Oct4 and either FLAG-SUMO-1 or FLAG-SUMO-2 expression vectors. Lysates were prepared under nondenaturing conditions, and samples were immunoprecipitated with anti-FLAG affinity beads and then subjected to Western blot with anti-Oct4 antibody (top panel), or total lysate was subjected to Western blot with anti-Oct4 antibody (bottom panel). D, NIH3T3 cells were cotransfected with the plasmids shown above each lane, and lysates were harvested under denaturing conditions prior to immunoprecipitation with anti-FLAG affinity beads followed by Western blot with anti-Oct4 antibodies as diagrammed in the upper panel. Positions of sumoylated Oct4 (SuOct4) and native Oct4 are indicated. IB, immunoblot; IP, immunoprecipitate; WT, wild type.

 
We next asked whether SUMO-1 modification of Oct4 could also occur in vitro. 35S-Labeled in vitro transcribed and translated Oct4 protein was incubated in the presence of SUMO-1, E1, and E2 enzymes in a buffer containing an ATP regeneration system. As seen in Fig. 3A, an additional band of slower mobility was observed when all proteins required for sumoylation were present (lane 2). This band was absent in reactions in which SUMO-1 was omitted (Fig. 3A, lane 3). We conclude that Oct4 is a substrate for sumoylation by SUMO-1 both in vivo and in vitro.

Oct4 Is Sumoylated on Lysine 118—As mentioned above, Oct4 contains three possible sumoylation sites: lysine 118, lysine 215, and lysine 244. To ascertain which lysine was subject to sumoylation, constructs containing lysine to arginine mutations at positions 118, 215, or 244 or at all three lysines (K118R, K215R, K244R, and 3KR, respectively) were prepared and tested in either in vitro sumoylation assays or in vivo cotransfection assays. Although wild-type Oct4 was readily sumoylated in vitro (Fig. 3A, lanes 1-3), neither the K118R mutant nor the 3KR triple mutant was conjugated with SUMO-1 (Fig. 3A, lanes 4-9). Thus, Oct4 lysine 118 appears to be a major sumoylation site. We next transfected NIH3T3 cells with plasmids expressing FLAG-SUMO-1 and either wild-type Oct4 or Oct4 mutants K118R, K215R, K224R, or 3KR. Mutation of lysine 118 to arginine completely abolished the appearance of the 90-kDa band (Fig. 3B, lanes 3 and 4). Similarly mutation of all three lysines (3KR) resulted in loss of the 90-kDa band (Fig. 3B, lanes 9 and 10). On the other hand, the 90-kDa band persisted with the K215R and K244R mutants (lanes 5-8). Interestingly the lower 40-kDa native Oct4 band was reduced with each mutant except the K215R mutant suggesting that the Lys118 and Lys244 (as well as 3KR) mutant forms of Oct4 interact somewhat less strongly with the unknown sumoylated protein in vivo. Taken together, our data indicate that lysine 118 is the major sumoylation site both in vivo and in vitro. Consistent with this, no Oct4 antibody-reactive bands were observed when cells were transfected with the K118R or 3KR mutants and lysates were prepared under denaturing conditions prior to immunoprecipitation (Fig. 1D, lanes 4-7).

Sumoylation Does Not Alter Gross Subnuclear Localization of Oct4—In a number of cases, sumoylation was shown to alter the subcellular localization of proteins promyelocytic leukemia (PML, Sp100, and p53, for instance) (23, 28). To investigate whether sumoylation of Oct4 could affect its intracellular localization, we expressed either Oct4, Oct4 K118R, or Oct4 3KR in NIH3T3 cells. Two days after transfection cells were subjected to indirect immunofluorescence assay with anti-Oct4 antibodies. As expected, wild-type Oct4 was localized to the nucleus in a diffuse but slightly punctate pattern (Fig. 4, top left panel). Similar patterns were observed with the K118R and 3KR mutants indicating that gross Oct4 localization was not significantly affected by mutation of the Oct4 SUMO-1 target site (Fig. 4, left panels). Staining with an anti-SUMO-1 antibody revealed a punctate nuclear pattern of staining (Fig. 4, middle panels). Merging of the Oct4 and SUMO-1 staining patterns showed that a subfraction of wild-type Oct4 and a subfraction of Oct4 K118R mutant proteins colocalized with a subfraction of intranuclear SUMO-1 (Fig. 4, right panels). These results indicate that a portion of Oct4 and SUMO-1 molecules colocalize in the nucleus, and this colocalization does not require that Oct4 itself be sumoylated. Interestingly a much smaller percentage of Oct4 3KR mutant protein colocalized with SUMO-1 compared with wild-type Oct4 (Fig. 4, bottom right panel). This is consistent with our immunoprecipitation studies (Fig. 3B) showing that the Oct4 3KR mutant does not interact as efficiently with the unknown sumoylated protein in vivo. In summary, our data show that Oct4 and SUMO-1 colocalize in the cell, but covalent SUMO-1 conjugation to Oct4 is not needed for this colocalization.


Figure 2
View larger version (45K):
[in this window]
[in a new window]

  		FIGURE 2.
Endogenous Oct4 can be sumoylated. A, P19 cells were transfected with FLAG-SUMO-1 in the presence or absence of HA-Ubc9, and cell lysates were immunoprecipitated with anti-FLAG affinity beads and then subjected to Western blot with anti-Oct4 antibody. Locations of sumoylated Oct4 and unmodified Oct4 are indicated by arrows. B, SUMO-1 and Oct4 colocalize on promoters. P19 cell chromatin was immunoprecipitated with anti-Oct4 or anti-SUMO-1 antibody and then subjected to PCR with primers that amplify Oct4, Pax6, and Neurog1 promoters. The Ig{kappa} 3'-enhancer served as negative control. Input was diluted 1000-fold. C, sequential ChIP was performed first with anti-Oct4 antibody or goat IgG followed by a second ChIP with anti-SUMO-1 antibody or rabbit IgG. Real time PCR was performed using Oct4, Pax6, and Neurog1 promoter-specific primers. D, down-regulation by Oct4 results in loss of SUMO-1 association with promoters. P19 cells were differentiated by treatment with retinoic acid (RA) for 96 h. ChIP assays followed by real time PCR were then performed for binding of Oct4 and SUMO-1 to the Oct4, Pax6, and Neurog1 promoters. E, retinoic acid results in down-regulation of Oct4. Western blot of Oct4 in untreated or retinoic acid-treated P19 cells is shown. IB, immunoblot; IP, immunoprecipitate. Error bars show the standard deviation from the mean.

 
Sumoylation Stabilizes Oct4—In our transfection experiments, we observed increased Oct4 levels as the dosage of SUMO-1-cotransfected plasmid was increased (Fig. 1B). This suggested that either 1) sumoylation of Oct4 increases Oct4 stability, 2) Oct4 is stabilized by interaction with a sumoylated protein, or 3) overexpression of SUMO-1 generally increases protein stability. Because there was no difference in control beta-actin protein levels in each sample (Fig. 1B), the third option seemed unlikely. Stability of Oct4 could be very important because a 50% increase in Oct4 levels can lead to tumors in vivo (12, 13). To determine whether SUMO-1 modification functionally stabilized Oct4, we first compared the stability of wild-type Oct4 with that of the K118R mutant. NIH3T3 cells were transfected with wild-type Oct4 or the K118R mutant and then treated with cycloheximide to stop new protein synthesis. Cells were harvested at various times, and levels of Oct4 were measured by Western blot. Interestingly both proteins showed very similar half-lives of 6-8 h (Fig. 5, A and B). However, because only a very small percentage of the Oct4 in the cell is sumoylated at any one time, this approach would likely not detect a possible stabilization of sumoylated Oct4.

To test this more directly, we transfected NIH3T3 cells with Oct4 and FLAG-SUMO-1 expression plasmids. After transfection, cells were treated with cycloheximide as above and then harvested at various times. Cell lysates were either blotted for total Oct4 levels directly or first immunoprecipitated with anti-FLAG affinity beads to isolate sumoylated or SUMO-associated Oct4 protein prior to Western blot with Oct4 antibodies. This approach showed striking differences. Although the total Oct4 protein showed a decay similar to that observed in the first experiments, the sumoylated Oct4 and the SUMO-associated Oct4 showed a vastly more stable phenotype (Fig. 5, C and D). At 16 h, 80% of these proteins remained compared with only 10-20% of the total Oct4 protein. Therefore, both sumoylated Oct4 and Oct4 that is noncovalently interacting with a SUMO-1-containing protein are considerably more stable than non-sumoylated Oct4. These data demonstrate that SUMO-1 modification of Oct4 results in protein stabilization in vivo. In addition, unsumoylated Oct4 can be equally stabilized by interaction with an unknown protein that is conjugated with SUMO-1.


Figure 3
View larger version (53K):
[in this window]
[in a new window]

  		FIGURE 3.
Oct4 is sumoylated on lysine 118 both in vitro and in vivo. A, in vitro sumoylation assays. In vitro translated (IVT) wild-type Oct4 (WT) or mutants K118R or 3KR were incubated with the reagents shown above each lane for in vitro sumoylation assays. The positions of native Oct4 and sumoylated Oct4 (SuOct4) are shown by arrows on the right. B, in vivo sumoylation assays in transfected cells. NIH3T3 cells were transfected with the expression plasmids shown above each lane followed by immunoprecipitation with anti-FLAG affinity beads and Western blot with Oct4 antibodies. The positions of native Oct4 and sumoylated Oct4 (SuOct4) are shown by arrows on the right. IB, immunoblot; IP, immunoprecipitate.

 
We also tested endogenous Oct4 stability in P19 cells. FLAG-SUMO-1 and Ubc9 were cotransfected to P19 cells, and 48 h after transfection cells were treated with cycloheximide and harvested at various times. Cell lysates were either blotted for total Oct4 levels directly or first subjected to immunoprecipitation with anti-FLAG affinity beads prior to Western blot (Fig. 5E). The total endogenous Oct4 protein showed a decay in P19 cells similar to that observed for the exogenous Oct4 protein in 3T3 cells. In addition, in P19 cells sumoylated Oct4 and the SUMO-associated Oct4 showed a more stable phenotype similar to the results in NIH3T3 cells. At 8 h, more than 70% of these proteins remained, whereas only 40% of total Oct4 remained (Fig. 5F).


Figure 4
View larger version (112K):
[in this window]
[in a new window]

  		FIGURE 4.
A fraction of Oct4 and SUMO-1 molecules colocalize in vivo. NIH3T3 cells were cotransfected with either CMV-Oct4, CMV-Oct4-K118R, or CMV-Oct4-3KR and FLAG-SUMO-1 expression plasmid. After 2 days cells were subjected to immunofluorescence assays with anti-Oct4 (left panels) and anti-SUMO-1 (middle panels) antibodies. Signals are merged in the right panels.

 
Sumoylation of Oct4 Enhances Its DNA Binding—The site of SUMO modification, lysine 118, is located in the Oct4 amino terminus just outside the Oct4 DNA binding domain. We were interested in knowing whether conjugation of SUMO-1 would affect Oct4 DNA binding ability. To test this, we needed to purify sumoylated Oct4 from native Oct4. Wild-type Oct4 or the K118R mutant was cotransfected with FLAG-SUMO-1 into NIH3T3 cells. Cell extracts were immunoprecipitated by FLAG affinity gel and then fractionated by SDS-PAGE. The gel was sliced into five different size range slices, proteins were eluted, and the eluted proteins were then assayed for DNA binding by EMSA with a probe containing an octamer sequence (summarized in Fig. 6A). Fractions 2 and 7 (37-50 kDa) should contain proteins of the size expected for unmodified wild-type Oct4 or mutant Oct4 K118R. As expected, these fractions yielded the anticipated EMSA complexes (Fig. 6B, lanes 2 and 7). The 75-100-kDa fraction 4 from the wild-type sample should contain SUMO-modified Oct4. This fraction yielded an EMSA complex as expected, and the corresponding fraction from the Oct4 K118R mutant, which cannot be sumoylated, generated a very weak protein-DNA complex (Fig. 6B, compare fractions 4 and 9). Quite surprisingly, the wild-type Oct4 and the sumoylated Oct4 complexes yielded equal intensities by EMSA (Fig. 6B, fractions 2 and 4), yet Western blots showed at least 3-fold less protein in the sumoylated Oct4 fraction compared with unmodified Oct4 (Fig. 6, C and D). To compare Oct4 and sumoylated Oct4 affinities, we performed competition assays with unlabeled oligonucleotides (Fig. 6E). Approximately 2-3-fold more cold probe was required to compete binding of sumoylated Oct4 than of unsumoylated Oct4. Therefore, sumoylated Oct4 binds to DNA more efficiently than it binds to unmodified Oct4.

SUMO-1 Modification Enhances Oct4-dependent Transactivation—It was of interest to determine whether the conjugation of SUMO-1 to Oct4 also affected its transactivation capacity. Oct4 can bind to octamer sequences in a monomer manner or to PORE and MORE sequences in alternate dimer conformations. To determine whether there was any difference in sumoylated Oct4 activity by different Oct4 binding sites, luciferase reporters containing the minimal thymidine kinase promoter linked to six copies of either the octamer monomer binding sequence (6W-37tk-luc), the PORE binding sequence (6xPORE-37tk-luc), or the MORE binding sequence (6xMORE-37tk-luc) were transfected into 293 cells with wild-type Oct4 in the absence or presence of increasing amounts of FLAG-SUMO-1 expression vector. Interestingly FLAG-SUMO-1 expression enhanced luciferase activity from the 6W reporter up to 2-fold above that with Oct4 protein alone (Fig. 7A). On the contrary, increasing amounts of FLAG-SUMO-2 cotransfected with 6W-37tk-luc reporter did not enhance the transcriptional activity of Oct4 (Fig. 7B). Similar SUMO-1 results were obtained with PORE and MORE binding site reporters (Fig. 7, C and D). When the same experiments were performed with either the Oct4 K118R or 3KR mutant, SUMO-1 coexpression had little impact on transactivation of the 6W and PORE reporters (Fig. 7, A and C), although some activation was observed with the MORE reporter at the highest level of SUMO-1 expression (Fig. 7D). This suggests that Oct4 dimers bound to DNA in the MORE configuration are able to weakly respond to SUMO-1 cotransfection whether Oct4 was wild-type or mutated. We also asked whether SUMO modification could influence transcriptional activity of endogenous Oct4. FLAG-SUMO-1 or FLAG-SUMO-2 and HA-Ubc9 were cotransfected into P19 cells with 6W-37tk-luc, PORE-37tk-luc, or MORE-37tk-luc reporters (Fig. 7E). SUMO-1 and Ubc9 increased endogenous Oct4 transcriptional activity 2-fold on the 6W-37tk-luc reporter and 1.6-fold on both PORE-37tk-luc and MORE-37tk-luc reporters, whereas SUMO-2 cotransfected with Ubc9 showed little effect. In summary, our data suggest that sumoylation of Oct4 increases its ability to activate transcription on multiple promoters.


Figure 5
View larger version (53K):
[in this window]
[in a new window]

  		FIGURE 5.
Oct4 stability is increased by sumoylation or by interaction with a sumoylated protein in vivo. A, NIH3T3 cells were transfected with either CMV-Oct4 or CMV-Oct4-K118R, after 2 days cycloheximide (CHX) was added, and cells were subsequently harvested at the times indicated above each lane. Cell lysates were Western blotted with anti-Oct4 or anti-beta-actin antibodies as indicated on the right. B, data from A are shown in graph form with S.D. C, NIH3T3 cells were transfected with CMV-Oct4 and FLAG-SUMO-1 expression plasmids, after 2 days cycloheximide was added, and cells were subsequently harvested at the times listed above each lane. Cell lysates were either left untreated (middle and bottom panels) or immunoprecipitated with anti-FLAG affinity beads (top panel). Samples were then subjected to Western blot with anti-Oct4 antibodies (top and middle panels) or anti-beta-actin antibodies (bottom panel). In the top panel the positions of sumoylated Oct4 (SuOct4) and native Oct4 (Oct4) are indicated. D, the data from C are presented in graph form with S.D. E, P19 cells were transfected with HA-Ubc9 and FLAG-SUMO-1 expression plasmids, and transfected cells were treated with cycloheximide for various times. Cell extracts were either left untreated (middle and bottom panels) or immunoprecipitated with anti-FLAG affinity beads (top panel). Western blot of samples was visualized by SuperSignal West Pico Chemiluminescent Substrate. F, data from E are shown in graph form with S.D. IB, immunoblot; IP, immunoprecipitate; RD, relative density. Error bars show the standard deviation from the mean.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Small changes in Oct4 expression level can have significant impact on developmental cell fate and growth properties of ES and embryonal carcinoma cells. Modifications that affect Oct4 stability, DNA binding, or transactivation potential could significantly impact early embryonic development or germ cell differentiation. Sumoylation has recently emerged as a mechanism for modulating function of transcription activators. Oct4 contains three lysines, Lys118, Lys215, and Lys244, that lie within typical consensus sumoylation motifs ({psi}KX(E/D)). We found that Oct4 is modified by the addition of SUMO-1 (but not SUMO-2) and that lysine 118 is the principle sumoylation target site in vitro and in vivo.We found that sumoylation of Oct4 resulted in significantly increased Oct4 stability, Oct4 DNA binding, and Oct4 transactivation. The mechanism of these changes in Oct4 behavior are not likely to be due to altered protein localization within the cell. Although sumoylation can alter intracellular localization of target proteins, we found no evidence of gross changes in Oct4 intranuclear localization when comparing wild type and sumoylation target site mutants. However, because only a small fraction of Oct4 is sumoylated at any one time in vivo, we cannot exclude the possibility that sumoylation can alter Oct4 localization.


Figure 6
View larger version (51K):
[in this window]
[in a new window]

  		FIGURE 6.
Sumoylation of Oct4 enhances DNA binding activity. A, scheme of purification of Oct4 and sumoylated Oct4 (SuOct4) proteins. B, proteins eluted from gel slices were assayed by EMSA with an octamer probe. The molecular mass range for each gel slice is shown above the lanes. Lanes 1-5 show experiments with wild-type Oct4, and lanes 6-10 were performed with the Oct4 K118R mutant. The lower panel shows a Western blot of proteins eluted from different fractions with Oct4 antibodies. C, unmodified and SUMO-1-modified Oct4 from fractions 2 and 4 were evaluated by Western blot with Oct4 antibodies and quantitated (D). E, unmodified and SUMO-1-modified Oct4 samples were assayed by EMSA in the presence of increasing quantities (ng) of unlabeled competitor. IB, immunoblot; RD, relative density.

 
Sumoylation can potentially regulate target protein stability, and the increased in vivo stability of Oct4 in response to sumoylation is intriguing. This increased stability was equally true when unsumoylated Oct4 interacted with a thus far uncharacterized sumoylated protein in vivo. Therefore, sumoylation of either Oct4 or an Oct4-interacting protein leads to a substantial increase in Oct4 half-life. This is likely to represent an important regulatory mechanism because Oct4 is a transcription factor in which slight differences in expression level can cause significant differences in differentiation state. This regulatory mechanism could also relate to the oncogenic potential observed in gonadal stromal cells when Oct4 is only expressed at 150% of wild-type levels (12). Because Oct4 inactivation can induce regression of malignant tumors, sumoylation could be a target for therapy against gonadal tumors caused by elevated Oct4 levels.

During embryonic development, transient up-regulation of Oct4 expression triggers the formation of primitive endoderm. Whether this up-regulation is caused by increased Oct4 stability due to sumoylation of Oct4 is unclear. However, the SUMO E2 enzyme Ubc9 is essential for embryonic viability (29). Ubc9inv/inv embryos only successfully develop to the blastocyst stage. In vitro cultured Ubc9inv/inv blastocysts show selective apoptosis of inner cell mass cells, which contain significant Oct4 protein expression. Thus, it is possible that differences in Oct4 protein stability caused by sumoylation play a role in embryonic development.

The site of Oct4 SUMO modification lies immediately amino-terminal to the DNA binding domain. Our data show that sumoylation of Oct4 results in a significant increase in Oct4 DNA binding ability. Increased DNA binding activity by SUMO modification has been reported for other proteins including the heat shock factors HSF1 (30) and HSF2 (31) and basic Krüppel-like factor (32). In our experiments with Oct4, the increase in DNA binding is unlikely the result of interactions with other proteins because our experiments were performed with sumoylated Oct4 isolated from polyacrylamide gels (although it is possible that a protein in the same gel slice cooperates with sumoylated Oct4 in DNA binding). Instead the slightly more diffuse EMSA band generated by sumoylated Oct4 compared with unmodified Oct4 suggests possible conformational changes that could result in increased affinity for DNA.


Figure 7
View larger version (27K):
[in this window]
[in a new window]

  		FIGURE 7.
Sumoylation of Oct4 increases transactivation potential. In A-D 293 cells were cotransfected with increasing amounts of FLAG-SUMO-1 or FLAG-SUMO-2 expression vector (0, 2.5, 5, and 10 µg) and either CMV-Oct4, CMV-Oct4-K118R, or CMV-Oct4-3KR (5 µg). Reporters for each transfection assay were 6W-37tk-luc (A and B), 6xPORE-37tk-luc (C), or 6xMORE-37tk-luc (D). E, P19 cells were cotransfected with FLAG-SUMO-1 or FLAG-SUMO-2 and HA-Ubc9 expression vector and either 6W-37tk-luc (6W), 6xPORE-37tk-luc (PORE), or 6xMORE-37tk-luc (MORE) reporters. -Fold induction is plotted with error bars representing the S.D. WT, wild type; RLU, relative luciferase units.

 
Most transcription factors that are sumoylated show reduced transactivation capacity when conjugated to SUMO-1. However, silencing of transcriptional activity is not universal. In the case of p53 (33, 34) and heat shock transcription factors HSF1 and HSF2 (30, 31), transcriptional capacity is enhanced by SUMO modification. Our results showed that when Oct4 was conjugated with SUMO-1 transcriptional activity was increased. When lysine 118 was mutated to arginine, transcriptional activation in response to SUMO-1 cotransfection was attenuated compared with wild type, suggesting that conjugation of SUMO-1 to Oct4 is needed for this increased activity.

The mobility of the most prominent sumoylated Oct4 band (90 kDa; Fig. 1, B and D) suggests that Oct4 lysine 118 is a site for polysumoylation. The 90-kDa band suggests that two to three SUMO moieties are linked to Oct4 Lys118. The presence of faster and slower mobility sumoylated bands when cells were harvested under denaturing conditions (which would limit SUMO proteases) (Fig. 1D) also argues for polysumoylation. The significance of multiple SUMO motifs added to Oct4 Lys118 awaits to be determined.

Our FLAG-SUMO coimmunoprecipitation studies also revealed the existence of a sumoylated protein that interacts with both sumoylated and nonsumoylated Oct4. PIAS family members can themselves be sumoylated and are known to alter transactivation functions of transcription factors (35, 36). We found that PIAS1, PIAS3, PIASx, and PIASy can all bind to Oct4, and all but PIASy can increase Oct4 transactivation (data not shown). However, the same increase in transactivation occurred with the K118R Oct4 mutant indicating that PIAS1, PIAS3, or PIASx are not responsible for the increased Oct4 transactivation caused by cotransfection with SUMO-1.

The identity of the sumoylated protein that can interact with Oct4 in vivo is unknown. Although one of the PIAS proteins could potentially represent this interaction partner, it is also possible that Oct4 interacts with SUMO-1 in a noncovalent manner. In support of this, we found that SUMO-1 interacted with Oct4 as well as Oct4 K118R by glutathione S-transferase pulldown (data not shown). Although little is known about the structure or function of SUMO recognition motifs, several proteins have been shown to bind noncovalently to SUMO. For instance, proteins containing specific PEST sequences can bind with Ubc9 and SUMO-1 (37, 38). Interestingly according to PEST software there are two PEST sequences surrounding the Oct4 sumoylation target site, Lys118.

In summary, our data show that post-translational modification of Oct4 by SUMO-1 conjugation can enhance Oct4 stability, DNA binding, and transactivation. Sumoylation may therefore provide an important regulatory mechanism to control Oct4 stability and activity during embryonic and germ cell development. More complete understanding of the consequences of Oct4 sumoylation on early embryonic and gonad development will require generation of knock-in mutants expressing the Oct4 K118R mutation.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grant HD042011. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: School of Veterinary Medicine, University of Pennsylvania, 3800 Spruce St., Philadelphia, PA 19104. Tel.: 215-898-6428; Fax: 215-573-5189; E-mail: atchison{at}vet.upenn.edu.

2 The abbreviations used are: ES, embryonic stem; SUMO, small ubiquitin-related modifier; ChIP, chromatin immunoprecipitation; E1, ubiquitin-activating enzyme; E2, ubiquitin conjugation enzyme; E3, ubiquitin-protein isopeptide ligase; CMV, cytomegalovirus; 3KR, K118R/K215R/K244R; DTT, dithiothreitol; EMSA, electrophoretic mobility shift assay; POU, Pit1-Oct-Unc86; PORE, palindromic Oct factor recognition element; MORE, more PORE; PIAS, protein inhibitor of activated STAT. Back


   ACKNOWLEDGMENTS
 
We thank Kyoungsook Park for SUMO and HA-Ubc9 expression vectors and Junwen Wang for identification of Oct4 binding sites in the Pax6 and Neurog1 promoters. We thank Serge Fuchs and Fatima Cavaleri for helpful discussions.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Okamoto, K., Okazawa, H., Okuda, A., Sakai, M., Muramatsu, M., and Hamada, H. (1990) Cell 60, 461-472[CrossRef][Medline] [Order article via Infotrieve]
  2. Rosner, M. H., Vigano, M. A., Ozato, K., Timmons, P. M., Poirier, F., Rigby, P. W., and Staudt, L. M. (1990) Nature 345, 686-692[CrossRef][Medline] [Order article via Infotrieve]
  3. Scholer, H. R., Balling, R., Hatzopoulos, A. K., Suzuki, N., and Gruss, P. (1989) EMBO J. 8, 2551-2557[Medline] [Order article via Infotrieve]
  4. Yeom, Y. I., Fuhrmann, G., Ovitt, C. E., Brehm, A., Ohbo, K., Gross, M., Hubner, K., and Scholer, H. R. (1996) Development (Camb.) 122, 881-894[Abstract]
  5. Nichols, F., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I., Scholer, H., and Smith, A. (1998) Cell 95, 379-391[CrossRef][Medline] [Order article via Infotrieve]
  6. Niwa, H., Miyazaki, J.-i., and Smith, A. G. (2000) Nat. Genet. 24, 372-376[CrossRef][Medline] [Order article via Infotrieve]
  7. Kehler, J., Tolkunova, E., Koschorz, B., Pesce, M., Gentile, L., Boiani, M., Lomeli, H., Nagy, A., McLaughlin, K. J., Scholer, H. R., and Tomilin, A. (2004) EMBO Rep. 5, 1078-1083[CrossRef][Medline] [Order article via Infotrieve]
  8. Scholer, H. R., Ruppert, S., Suzuki, N., Chowdhury, K., and Gruss, P. (1990) Nature 344, 435-439[CrossRef][Medline] [Order article via Infotrieve]
  9. Yeom, Y. I., Ha, H. S., Balling, R., Scholer, H. R., and Artzt, K. (1991) Mech. Dev. 35, 171-179[CrossRef][Medline] [Order article via Infotrieve]
  10. Brandenberger, R., Wei, H., Zhang, S., Lei, S., Murage, J., Fisk, G. J., Li, Y., Xu, C., Fang, R., Guegler, K., Rao, M. S., Mandalam, R., Lebkowski, J., and Stanton, L. W. (2004) Nat. Biotechnol. 22, 707-716[CrossRef][Medline] [Order article via Infotrieve]
  11. Ovitt, C. E., and Scholer, H. R. (1998) Mol. Hum. Reprod. 4, 1021-1031[Abstract/Free Full Text]
  12. Gidekel, S., Pizov, G., Bergman, Y., and Pikarsky, E. (2003) Cancer Cell 4, 361-370[CrossRef][Medline] [Order article via Infotrieve]
  13. Looijenga, L. H., Stoop, H., de Leeuw, H. P., de Gouveia Brazao, C. A., Gillis, A. J., van Roozendaal, K. E., van Zoelen, E. J., Weber, R. F., Wolffen-buttel, K. P., van Dekken, H., Honecker, F., Bokemeyer, C., Perlman, E. J., Schneider, D. T., Kononen, J., Sauter, G., and Oosterhuis, J. W. (2003) Cancer Res. 63, 2244-2250[Abstract/Free Full Text]
  14. Nordhoff, V., Hubner, K., Bauer, A., Orlova, I., Malapetsa, A., and Scholer, H. R. (2001) Mamm. Genome 12, 309-317[CrossRef][Medline] [Order article via Infotrieve]
  15. Botquin, V., Hess, H., Fuhrmann, G., Anastassiadis, C., Gross, M. K., Vriend, G., and Scholer, H. R. (1998) Genes Dev. 12, 2073-2090[Abstract/Free Full Text]
  16. Tomilin, A., Remenyi, A., Lins, K., Bak, H., Leidel, S., Vriend, G., Wilmanns, M., and Scholer, H. R. (2000) Cell 103, 853-864[CrossRef][Medline] [Order article via Infotrieve]
  17. Boyer, L. A., Lee, T. I., Cole, M. F., Johnstone, S. E., Levine, S. S., Zucker, J. P., Guenther, M. G., Kumar, R. M., Maurray, H. L., Jenner, R. G., Gifford, D. K., Melton, D. A., Jaenisch, R., and Young, R. A. (2005) Cell 122, 947-956[CrossRef][Medline] [Order article via Infotrieve]
  18. Chew, J. L., Loh, Y. H., Zhang, W., Chen, X., Tam, W. L., Yeap, L. S., Li, P., Ang, Y. S., Lim, B., Robson, P., and Ng, H. H. (2005) Mol. Cell. Biol. 25, 6031-6046[Abstract/Free Full Text]
  19. Okumura-Nakanishi, S., Saito, M., Niwa, H., and Ishikawa, F. (2005) J. Biol. Chem. 280, 5307-5317[Abstract/Free Full Text]
  20. Brehm, A., Ohbo, K., and Scholer, H. R. (1997) Mol. Cell. Biol. 17, 154-162[Abstract]
  21. Xu, H. M., Liao, B., Zhang, Q. J., Wang, B. B., Li, H., Zhong, X. M., Sheng, H. Z., Zhao, Y. X., Zhao, Y. M., and Jin, Y. (2004) J. Biol. Chem. 279, 23495-23503[Abstract/Free Full Text]
  22. Gill, G. (2004) Genes Dev. 18, 2046-2059[Abstract/Free Full Text]
  23. Rodriguez, M. S., Dargemont, C., and Hay, R. T. (2001) J. Biol. Chem. 276, 12654-12659[Abstract/Free Full Text]
  24. Bohren, K. M., Nadkarni, V., Song, J. H., Gabbay, K. H., and Owerback, D. (2004) J. Biol. Chem. 279, 27233-27238[Abstract/Free Full Text]
  25. Scholer, H. R., Ciesiolka, T., and Gruss, P. (1991) Cell 66, 291-304[CrossRef][Medline] [Order article via Infotrieve]
  26. Pongubala, J. M. R., Nagulapalli, S., Klemsz, M. J., McKercher, S. R., Maki, R. A., and Atchison, M. L. (1992) Mol. Cell. Biol. 12, 368-378[Abstract/Free Full Text]
  27. Hodawadekar, S., Wei, F., Yu, D., Thomas-Tikhonenko, A., and Atchison, M. L. (2006) J. Immunol. 177, 6165-6171[Abstract/Free Full Text]
  28. Sternsdorf, T., Jensen, K., Reich, B., and Will, H. (1999) J. Biol. Chem. 274, 12555-12566[Abstract/Free Full Text]
  29. Nacerddine, K., Lehembre, F., Bhaumik, M., Artus, J., Cohen-Tannoudji, M., Babinet, C., Pandolfi, P. P., and Dejean, A. (2005) Dev. Cell 9, 769-779[CrossRef][Medline] [Order article via Infotrieve]
  30. Hong, Y., Rogers, R., Matunis, M. J., Mayhew, C. N., Goodson, M. L., Park-Sarge, O. K., and Sarge, K. D. (2001) J. Biol. Chem. 276, 40263-40267[Abstract/Free Full Text]
  31. Goodson, M. L., Hong, Y., Rogers, R., Matunis, M. J., Park-Sarge, O. K., and Sarge, K. D. (2001) J. Biol. Chem. 276, 18513-18518[Abstract/Free Full Text]
  32. Perdomo, J., Verger, A., Turner, J., and Crossley, M. (2005) Mol. Cell. Biol. 25, 1549-1559[Abstract/Free Full Text]
  33. Rodriguez, M. S., Desterro, J. M., Lain, S., Midgley, C. A., Lane, D. P., and Hay, R. T. (1999) EMBO J. 18, 6455-6461[CrossRef][Medline] [Order article via Infotrieve]
  34. Gostissa, M., Hengstermann, A., Fogal, V., Sandy, P., Schwarz, S. E., Scheffner, M., and Del Sal, G. (1999) EMBO J. 18, 6462-6471[CrossRef][Medline] [Order article via Infotrieve]
  35. Ihara, M., Yamamoto, H., and Kikuchi, A. (2005) Mol. Cell. Biol. 25, 3506-3518[Abstract/Free Full Text]
  36. Kotaja, N., Karvonen, U., Janne, O. A., and Palvimo, J. J. (2002) Mol. Cell. Biol. 22, 5222-5234[Abstract/Free Full Text]
  37. Melchior, F. (2000) Annu. Rev. Cell Dev. Biol. 16, 591-626[CrossRef][Medline] [Order article via Infotrieve]
  38. Kim, Y. H., Choi, C. Y., and Kim, Y. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 12350-12355[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Immunol.Home page
J. Garaude, R. Farras, G. Bossis, S. Charni, M. Piechaczyk, R. A. Hipskind, and M. Villalba
SUMOylation Regulates the Transcriptional Activity of JunB in T Lymphocytes
J. Immunol., May 1, 2008; 180(9): 5983 - 5990.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/29/21551    most recent
M611041200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow