Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M604052200 on November 22, 2006

J. Biol. Chem., Vol. 282, Issue 3, 1544-1551, January 19, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/3/1544    most recent
M604052200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Q.-P.
Right arrow Articles by Chen, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Q.-P.
Right arrow Articles by Chen, G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Stress-induced c-Jun-dependent Vitamin D Receptor (VDR) Activation Dissects the Non-classical VDR Pathway from the Classical VDR Activity*

Qing-Ping Li12, Xiaomei Qi{ddagger}1, Rocky Pramanik, Nicole M. Pohl{ddagger}, Mathew Loesch{ddagger}, and Guan Chen{ddagger}§3

From the {ddagger}Department of Pharmacology and Toxicology, Medical College of Wisconsin, the §Department of Veterans Affairs, Zablocki Veterans Affairs Medical Center, Milwaukee, Wisconsin 53226, and the Department of Radiation Oncology, Loyola University of Chicago, Maywood, Illinois 60153

Received for publication, April 27, 2006 , and in revised form, September 14, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Vitamin D receptor (VDR) is a ligand-dependent transcription factor that mediates vitamin D3-induced gene expression. Our previous work has established that stress MAPK signaling stimulates VDR expression (Qi, X., Pramank, R., Wang, J., Schultz, R. M., Maitra, R. K., Han, J., DeLuca, H. F., and Chen, G. (2002) J. Biol. Chem. 277, 25884–25892) and VDR inhibits cell death in response to p38 MAPK activation (Qi, X., Tang, J., Pramanik, R., Schultz, R. M., Shirasawa, S., Sasazuki, T., Han, J., and Chen, G. (2004) J. Biol. Chem. 279, 22138–22144). Here we show that c-Jun is essential for VDR expression and VDR in turn inhibits c-Jun-dependent cell death by non-classical mechanisms. In response to stress c-Jun is recruited to the Vdr promoter before VDR protein expression is induced. The necessary and sufficient role of c-Jun in VDR expression was established by the fact that c-Jun knock-out decreases VDR expression, whereas c-Jun restoration recovers its activity. Existence of the non-classical VDR pathway was suggested by a requirement of both c-Jun and VDR in stress-induced VDR activity and further demonstrated by VDR inhibiting c-Jun-dependent cell death independent of its classical transcriptional activity and independent of vitamin D3. c-Jun is also required for vitamin D3-induced classical VDR transcriptional activity by a mechanism likely involving physical interactions between c-Jun and VDR proteins. These results together reveal a non-classical mechanism by which VDR acts as a c-Jun/AP-1 target gene to modify c-Jun activity in stress response through increased protein expression independent of classical transcriptional regulations.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Vitamin D receptor (VDR)4 is a ligand-dependent transcription factor and primarily functions to maintain calcium homeostasis through regulating target gene expression in response to vitamin D3 (1). This endocrine system also regulates differentiation (2, 3), proliferation (4, 5), and cell death (6, 7) by less defined mechanisms. Moreover, vitamin D3 has a well established cancer inhibitory activity: it prevents carcinogenesis in colon, mammary glad, and skin (8), and inhibits malignant growth in vitro and in vivo (9, 10). Whereas vitamin D3 is generally believed to exert biological activities through its receptor VDR (the classical pathway or mechanism), it is not known whether VDR alone exhibits any of these activities in the absence of vitamin D3.

The classical VDR pathway is believed to initiate upon vitamin D3 binding to its receptor. Through conformation changes, VDR dimerizes with itself and/or its partners such as retinoid X receptor (RXR), which then bind to specific vitamin D responsive elements (VDREs) in a target gene promoter, leading to gene transcription alterations (1). Like other nuclear hormone receptors, VDR protein consists of several functional domains including a DNA-binding domain and a C-terminal ligand-binding domain, and functions in cooperation with co-regulators through formation of a chromatin-remodeling complex (11, 12). Through signaling integrations of various target genes, vitamin D3/VDR activity is converted into biological effects.

Recent studies suggest that vitamin D3 and its receptor may each have distinct activities in regulating cell death. Vitamin D3, for example, induces cell death in some cases (7, 13, 14) but inhibits this event in others (15–17). Animal studies (18, 19) also showed that vitamin D3 protects against chemotherapy-induced alopecia (hair loss), a process of intrafollicular apoptosis (20). With regard to its receptor, several pieces of evidence suggest that VDR may be anti-apoptotic by itself. This was first demonstrated by induction of cell death after antisense-mediated VDR inhibition (21). Furthermore, HeLa cells stably transfected with VDR showed resistance to etoposide-induced apoptosis (6). Development of alopecia (22, 23) and increased apoptosis in periprostatic tissues (24) in VDR knock-out mice provide further genetic evidence for VDR anti-apoptotic activity. Signaling mechanisms for VDR anti-apoptotic activity as well as its relationship to the classical VDR pathways, however, remain mostly un-established.

c-Jun, a major component of AP-1 transcription factor, is activated by both mitogenic and stress signals downstream of ERK (extracellular signal-regulated kinase), JNK (N-terminal c-Jun kinase), and p38 MAPKs (mitogen-activated protein kinases) through phosphorylation and trans-activation. AP-1 is composed of homodimers of the Jun family or its heterodimers with one of other transcription factors such as Fos, ATF2, cAMP-response element-binding protein, and NFAT (25, 26). JNK activates c-Jun by phosphorylating Ser63, Ser73, Thr91, and/or Thr93 residues on its N-terminal region, whereas ERK and p38 do so by increasing c-Jun expression via an AP-1-dependent mechanism (25, 27). c-Jun thus serves as a central transcription factor to integrate signaling from three major MAPK pathways resulting in specific cellular response. c-Jun phosphorylation in neurons and fibroblasts is linked to apoptosis activated by JNK and p38 stress MAPKs (28–30). An anti-apoptotic c-Jun function, however, was demonstrated by expressing a dominant negative c-Jun in cancer cells (31) and by knocking out c-Jun expression in primary hepatocytes (32). Thus, c-Jun activity can be either pro-apoptotic or anti-apoptotic by an unknown mechanism. Because a primary function of c-Jun/AP-1 is to regulate gene expression, some of its target genes may play a role in determining specific effects of c-Jun activation.

Our previous work has established that stress MAPK signaling (JNK and p38) stimulates VDR gene expression through an AP-1 site on the VDR promoter (33). Because c-Jun/AP-1 is a central transcription factor, these results may provide explanations for regulatory effects of various stimuli on VDR protein expression (34–37). Moreover, we showed that cellular VDR proteins restrain stress-induced cell death in response to p38 activation (38). Here we sought to test the hypothesis that VDR may act as a c-Jun/AP-1 target gene to determine outcomes of stress-induced c-Jun activation. Our results revealed that c-Jun is both necessary and sufficient for VDR expression and VDR in turn inhibits stress-induced c-Jun-dependent cell death by non-classical mechanisms.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
cDNA Expression Plasmids and Other Reagents—Expression constructs for human VDR, its dominant negative form VDR/GSV (GSV), and VDRE-luciferase reporter (VDRE-Luc, a luciferase gene driven by two copies of a VDRE from osteopontin gene (Spp1)), were kindly provided by Leonard Freedman (2, 39). VDR deletion mutants (VDR1–415 and VDR140–427) were generated by PCR as previously described (40). The wild-type and mutant VDR cDNAs were further cloned into a V5-tagged pcDNA3 vector. For infection, human VDR and mouse c-Jun cDNAs were cloned into retroviral vector LZRS and pLHCX, respectively, as we previously described (38, 41). Mouse Vdr promoter (0.5 kb) was cloned and inserted into a pGL2 basic vector (Promega) in front of the luciferase gene (VDR-Luc (42)).

Minimum essential medium, L-glutamine, and antibiotics were purchased from Invitrogen. Fetal bovine serum was obtained from BioWhittaker. DNA was prepared using an Endo-free kit from Qiagen. Vitamin D3 powder was provided by Hoffmann-La Roche (Nutley, NJ) and dissolved in 100% ethanol as a stock solution. AMSA (amsacrine) powder was from the National Institutes of Health, NCI. DNA transfection kit (calcium phosphate) and a dual luciferase kit were purchased from Promega. FuGENE 6 transfection reagent was purchased from Roche. Proteinase inhibitors and sodium arsenite (ARS) were from Sigma. Protein G-Sepharose 4B and protein A-Sepharose 4B beads were purchased from Zymed Laboratories Inc. Rabbit polyclonal antibodies against c-Jun (sc-44-G to the C-terminal; H-79 to the N-terminal), against VDR (C-20), and RXR{alpha} (D-20) were purchased from Santa Cruz. A rat monoclonal VDR antibody (9A7) was purchased from Affinity Bioreagents, Inc. (Golden, CO). Anti-phospho-c-Jun (Ser63) and V5 monoclonal antibody were purchased from Cell Signaling and Invitrogen, respectively. An ECL Plus kit for Western detection was purchased from Amersham Biosciences.

Cell Culture, Transfection, and Luciferase Assay—Human breast cancer MDA-MB-468 (468) cells were obtained from ATCC. The c-Jun knock-out (c-Jun–/–) and the wild-type fibroblasts (c-Jun+/+) were kindly provided by Ron Wisdom (43). The stable VDR (and its mutants)-overexpressed 468 cell lines were generated by transfecting the cDNA expressing constructs in pcDNA3-V5 vector, followed by selection with 0.6 mg/ml G418 (33). To express c-Jun and VDR in c-Jun null fibroblasts, pLHCX and LZRS retroviral vectors were used, respectively (41). Briefly, pLHCX-c-Jun and LZRS-VDR (and corresponding empty vectors) were transfected into Phoenix-Ampo cells and the resultant supernatants were used to infect c-Jun–/– cells, followed by selection with antibiotics (pLHCX with hygromycin and LZRS with puromycin) for about 1 week. For luciferase assay, cells were collected 48 h after transfection and the luciferase activity (VDR-Luc or VDRE-Luc) was assayed with a dual luciferase kit from Promega using pRL-TK (encoding Renilla luciferase) as an internal control in a TD-20/20 Luminometer (Turner Designs). To determine stress-induced VDRE Luc activity, cells were pulse treated with 20 µM ARS for 2 h, 24 h before the luciferase assay. To assess effects of vitamin D3 on the VDRE activity, cells were cultured in the presence or absence of vitamin D3 for the last 24 h. The results from at least three separate experiments were analyzed with Student's t test for the statistically significant difference.

Chromatin Immunoprecipitation PCR Assay—This experiment was essentially carried out as described before (44). Briefly, growth medium was aspirated (about 70% confluent) after pulse treatment with or without ARS (200 µM for 2 h) and cells were then incubated with 1% formaldehyde solution in phosphate-buffered saline for 10 min at room temperature for the cross-linking of DNA with associated proteins. The cross-linking reaction was terminated by glycine (the final concentration at 125 mM, for 5 min) and cells were collected in RIPA buffer (150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 50 mM Tris (pH 8.0), 5 mM EDTA). The following inhibitors were added to the buffer immediately before use: protease inhibitors (antipain, 10 µg/ml; leupeptin, 10 µg/ml; pepstain A, 10 µg/ml; chymostatin, 10 µg/ml; and 4-(2-aminoethy)benzenesulfonyl fluoride, 200 µg/ml), phosphatase inhibitors (50 mM NaF, and 200 µM sodium orthovanadate), and the deacetylase inhibitor trichostatin A (5 µM). Cell lysates were sonicated and incubated with 2 µg of polyclonal anti-c-Jun antibody or IgG (Santa Cruz, sc-44-G) to precipitate c-Jun-associated DNA. The precipitates were washed and incubated with cross-linking reversal buffer (125 mM Tris (pH 6.8), 10% 2-mercaptoethanol, and 4% SDS). DNA was phenol-chloroform extracted, ethanol precipitated, and used as a template for PCR (primers: forward, ggggtaccccgcgccctgcaggagaaactc; reverse, gaagatcttcgcgcttcccgtgcttagggc) based on the mouse Vdr promoter sequence (42). Genomic DNA was also prepared from a set of control and ARS-treated cells and subjected to PCR as an input control.

Cell Death, Immunoprecipitations, Western, and Northern Blot Analysis—For cell death assay, cells were plated at the same density and treated either with ARS or AMSA (or the solvent control) for 24 h. Cell viability was assessed by a trypan blue exclusion assay (45) and analyzed with Student's t test for statistically significant difference. Moreover, a duplicate set of cells in some cases were treated, fixed in ethanol, and stained for flow cytometric analyses for apoptotic sub-G1 populations as we previously described (45).

Immunoprecipitation was performed as previously described (45) using a rat monoclonal VDR antibody (9A7). For Western blot analyses, cells were directly lysed in 1x loading buffer. Lysates generated were then treated and separated in SDS-PAGE (33), followed by transferring onto a nitrocellulose membrane. The resultant membrane was typically blocked with 5% milk in TBST for 1 h and incubated with primary antibody in 5% milk TBST at 4 °C overnight. Dilutions for the antibody were: rabbit polyclonal anti-VDR (C20, Santa Cruz), 1:1000; rabbit monoclonal anti-phosphor-c-Jun (Ser63), 1:1000; and rabbit polyclonal anti-c-Jun (Santa Cruz), 1:2000. The membrane was then washed four times with 1x TBST and incubated with proper peroxidase-conjugated second antibody for 1 h at room temperature. ECL reaction was carried out according to the manufacturer instructions (Amersham Biosciences) and the resultant bands were visualized in a PhosphorImager (GE Healthcare). Each membrane was typically stripped off and re-probed with additional antibodies two to three times for comparison and normalization. For Northern blot, total RNA was prepared by using TRIzol (Invitrogen), which was separated and incubated with the labeled VDR probe as described previously (33).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
c-Jun Binds to the VDR Promoter in Response to ARS-induced Phosphorylation, Which Precedes Increased VDR Protein Expression—Our previous work has demonstrated that stress signaling stimulates the mouse VDR promoter activity through the p38/JNK/c-Jun pathway (33). To reveal mechanisms for this activation, a chromatin immunoprecipitation assay (44) was performed to examine whether c-Jun binds to the Vdr promoter by a phosphorylation-dependent mechanism. Mouse NIH 3T3 cells in this case were treated with and without the stress stimulus ARS, and cell lysates were subjected to anti-c-Jun immunoprecipitation following cross-linking of bound transcription factors to DNA by formaldehyde. The precipitates were examined by PCR for the presence of endogenous VDR gene promoter (33, 42).


Figure 1
View larger version (25K):
[in this window]
[in a new window]

  		FIGURE 1.
Stress-induced c-Jun binding to the VDR promoter precedes increased VDR protein expression. A, c-Jun protein recruits to the Vdr promoter in response to ARS. NIH 3T3 cells were treated with and without ARS (200 µM, 2 h), followed by an incubation with 1% formaldehyde, and the c-Jun-DNA complexes were isolated by a rabbit anti-c-Jun antibody and used as the template for PCR. Genomic DNAs from the same experiment were prepared and used for PCR as an input control. Similar results were obtained in two additional experiments. B, c-Jun activation precedes increased VDR protein expression. Cells were treated with and without ARS as in A and collected at 0, 24, and 48 h after the treatment for Western blot analyses. Similar results were obtained in one additional experiment.

 
Results in Fig. 1A showed that c-Jun protein did not bind to the VDR DNA in untreated cells, but upon phosphorylation by ARS, it was recruited into the VDR promoter. The specificity of this band was demonstrated by the fact that the same ARS treatment did not yield a band without the cross-linking and the band is the same in size as the positive control using the mouse VDR promoter as a PCR template (data not shown). More importantly, the promoter binding precedes increased VDR protein expression, which was evident 24 h after ARS treatment and became most significant 48 h later (Fig. 1B). Because previous studies (33, 46) showed an involvement of c-Jun phosphorylation in induction of VDR RNA and/or protein expression, these results suggest that the promoter binding by phospho-c-Jun may serve as a key mechanism for this trans-activation.

c-Jun Knock-out Results in Decreased Vdr Gene Activity, Reduced VDR Expression, and Compromised VDR Transcription Activity—To further establish the essential role of c-Jun in Vdr transcription, immortalized c-Jun knock-out fibroblasts (c-Jun–/–) were analyzed for VDR gene activity in comparison with the wild-type counterparts (c-Jun+/+) (43). The mouse Vdr luciferase promoter (VDR-Luc) was transiently expressed in these cells and the promoter activity was determined by luciferase assays. Results in Fig. 2A showed that the promoter activity was decreased more than 85% in c-Jun–/– cells as compared with c-Jun+/+ counterparts, indicating that c-Jun is required for the basal Vdr gene activity. Consistent with this observation, expression levels of VDR protein and RNA were also lower in c-Jun null cells (Fig. 2B). These results support a necessary role of c-Jun in VDR expression.

To further assess the functional consequence of diminished VDR expression caused by knocking out the c-Jun gene, VDR transcriptional activity was assessed. In this case, both c-Jun+/+ and c-Jun–/– cells were transiently transfected with a VDRE-Luc reporter construct and treated with stress and vitamin D3 for their effects on the VDRE activity. Inclusion of stress in this experiment is to determine whether stress also regulates VDR activity as in the case of estrogen receptor (ER) (47) and RXR (48) and thereby to reveal if mechanisms involved are distinct than those observed in ligand-induced VDR activation. Results in Fig. 2C show that both ARS (also interleukin-1beta and anisomycin, data not shown) and vitamin D3 significantly increased the reporter activity in c-Jun+/+ cells, whereas these stimulatory effects were completely abolished in c-Jun–/– cells. These results indicate that stress can stimulate Vdr transcriptional activity as vitamin D3 and c-Jun is required for both of these stimulations. Because VDR expression is decreased in c-Jun–/– cells, it would be important to further dissect the c-Jun-VDR relationship through rescue experiments.


Figure 2
View larger version (24K):
[in this window]
[in a new window]

  		FIGURE 2.
c-Jun is required for VDR transcriptional activity in response to vitamin D3 and stress. A, the basal VDR promoter activity is decreased in c-Jun–/– cells. The VDR Luc was transiently expressed in c-Jun+/+ and c-Jun–/– cells and the promoter luciferase activity was assayed 48 h later (mean of three determinations, S.D.). B, the c-Jun knock-out leads to a decreased VDR protein (WB) and RNA expression (NB). Cell lysates were prepared and examined for VDR protein expression by Western blot, and the same membrane was stripped off and re-probed with anti-c-Jun antibody to confirm the absence of c-Jun expression in c-Jun–/– cells. For Northern blot, total RNA was prepared and analyzed for VDR RNA expression. C, both vitamin D3 and stress increase VDRE activity in c-Jun+/+ but not in c-Jun–/– cells. Cells were transfected with VDRE-Luc and 1 day later pulse-treated with and without ARS, followed by a 24-h incubation, or incubated with 10 nM vitamin D3 (D3) for 24 h, before the reporter luciferase activity was determined. Results are mean of three to four experiments (bars, S.E.; p < 0.05 for all treated c-Jun+/+ cells versus untreated control cells, but p > 0.05 for those in c-Jun–/– cells).

 


Figure 3
View larger version (40K):
[in this window]
[in a new window]

  		FIGURE 3.
Lack of c-Jun confers an increased sensitivity to stress-induced cell death independent of JNK and p38 phosphorylations. A, c-Jun–/– cells are more sensitive to stress-induced cell death. Both wild-type and c-Jun knock-out cells were plated at the same density and incubated with ARS (20 µM), AMSA (30 µM), or the solvent control for 24 h and assessed for cell death by a viability assay (mean of four separate determinations, bars, S.D., p < 0.05 between stress-treated c-Jun+/+ and c-Jun–/– cells). B, stress stimuli activate JNK and p38 similarly in c-Jun–/– and c-Jun+/+ cells. Cells were treated with ARS or AMSA for 2 h and collected for phosphorylations of JNK, p38, and c-Jun using respective specific antibodies. DMSO, dimethyl sulfoxide.

 
c-Jun Restoration Increases VDR Protein Expression whereas VDR Expression Rescues c-Jun-dependent Cell Death—Knockout studies have demonstrated an anti-apoptotic activity of c-Jun (32, 49). Our previous works by both depletion and overexpression have also revealed a cell death inhibitory function of VDR protein in human colon cancer cells (38). An increased cell death in c-Jun–/– cells could therefore be due to a decreased VDR expression. To investigate whether our immortalized c-Jun–/– fibroblasts have an increased sensitivity to stress-induced cell death, both the wild-type and knock-out cells were treated with ARS, AMSA, a DNA topoisomerase II inhibitor (50), or a solvent control. Their effects on JNK/p38/c-Jun activation and cell viability were determined. Both ARS and AMSA increase JNK and p38 phosphorylation, which occurs similarly in two cell lines, but phosphor-c-Jun is only induced in c-Jun+/+ cells (Fig. 3B), indicating the stress MAPK pathways leading to c-Jun activation remained intact in the knock-out cells. Consistent with the earlier findings (49), both agents are much more toxic to c-Jun null cells (Fig. 3A), indicating an anti-apoptotic property of c-Jun.

Experiments with c-Jun restoration in c-Jun–/– cells have previously shown an inhibition of stress-induced cell death (49). We wished next to determine whether c-Jun complementation is sufficient to increase VDR expression and whether introduction of the c-Jun target gene VDR protein expression in these cells could similarly inhibit c-Jun-dependent cell death. As expected, a retroviral-mediated c-Jun delivery increases levels of VDR proteins, whereas VDR restoration has no effects on c-Jun protein expression (Fig. 4A), further confirming that c-Jun dictates VDR expression. Importantly, VDR expression significantly inhibits stress-induced cell death as demonstrated by both increased viability and decreased sub-G1 populations (the number on top of each column, Fig. 4B). These results indicate that increased cell death in c-Jun–/– cells, at least in part, is due to decreased VDR protein expression and that VDR acts downstream of c-Jun in protecting against stress-induced cell death.

Because c-Jun knock-out decreases VDR expression and abolishes activation of VDR transcriptional activity by vitamin D3 and stress, we next sought to determine whether VDR restoration alone is sufficient to rescue these stimulations. In stable VDR-expressed c-Jun–/– cells, ligand- but not ARS-induced VDRE activity is higher than those observed in the vector-transfected cells (Fig. 4C), indicating a distinct property of stress-induced and ligand-stimulated VDR activities. Lack of stress-induced VDR activity under these conditions suggests that stress may mostly depend on c-Jun-mediated continuous VDR synthesis to stimulate VDR activity and additional pathways that have been altered by stress signaling may contribute to these activations. The stimulatory effects of vitamin D3 in these VDR-restored cells, however, are also much less than those observed in c-Jun+/+ cells that were assayed in the same experiments (Fig. 4D). These results together reveal that although ectopically expressed VDR proteins in c-Jun–/– cells can partially rescue ligand-induced VDR activity, VDR expression alone is not sufficient in restoring stimulation of VDR transcriptional activities by stress in the absence of c-Jun.

VDR Protects Stress-induced Cell Death Independent of Vitamin D3 and Independent of Its Classical Transcriptional Activity—Application of a dominant negative c-Jun mutant and a JNK inhibitor has previously demonstrated an essential role of c-Jun phosphorylation in stimulating VDR gene expression (33, 46). Moreover, cellular VDR protein has been shown to be anti-apoptotic in several cell lines (6, 38, 51). To explore whether VDR requires its transcriptional activity to regulate stress-induced cell death, a transcription-defective VDR mutant (VDR/GSV or GSV) (52) was stably expressed in 468 cells by including a 468 subline expressing the wild-type VDR protein for comparison (Fig. 5A). Human breast cancer 468 cells were used for this analysis, as our previous work has shown that stress signaling induces cell death via a c-Jun-dependent mechanism in these cells (45). Results obtained would therefore further extend our observation of VDR signaling downstream of c-Jun in inhibiting cell death by an independent cellular system.


Figure 4
View larger version (60K):
[in this window]
[in a new window]

  		FIGURE 4.
VDR inhibits cell death downstream of c-Jun. A, c-Jun restoration increases VDR protein expression. c-Jun–/– cells were infected with a retroviral vector expressing c-Jun (right) or VDR (left) and the resultant protein expression was assessed by Western blot. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. B, VDR expression decreases stress-induced cell death in c-Jun–/– cells. Stable VDR- or vector-infected cells were treated as described in the legend to Fig. 3A and resultant cell death was determined by the viability assay and flow cytometric analyses (* the number on each column represents sub-G1 cells in % (apoptotic fraction)). C and D, VDR expression only partially rescues vitamin D3, but not stress-induced VDR activity. c-Jun–/– cells stably expressing VDR (VDR) or a vector (Vect) were transiently transfected with VDRE-Luc (C) and the luciferase activity was determined 48 h later after treatment with and without vitamin D3 or ARS as described in the legend to Fig. 2C. c-Jun+/+ cells were similarly analyzed in the same experiments for comparison (D). The luciferase activities from Vect-infected c-Jun–/– cells and c-Jun+/+ cells were expressed as relative stimulations over their respective untreated controls, whereas those from VDR-transfected c-Jun–/– cells were normalized to the untreated Vect-transfected counterparts to show possible effects of VDR expression alone (the Vect infection alone has no substantial effects, data not shown). Results are mean of five to six separate experiments (bars, S.D., with p < 0.05 between vector and VDR transfected c-Jun–/– cells after vitamin D3 but not after ARS; p < 0.05 for both D3 and ARS versus untreated control in c-Jun+/+ cells).

 
Results in Fig. 5, A and B, showed that VDR overexpression significantly reduced ARS-induced cell death as demonstrated by an increased viability and a decreased sub-G1 population. A similar cell death protective effect was also observed after treatment with AMSA (data not shown), thus ruling out a stimulus-specific cell death inhibitory activity of VDR. Of interest, stable expression of the mutant GSV also achieved a similar cell death protection and addition of vitamin D3 did not significantly further alter the cell viability in both 468/VDR and 468/GSV lines (Fig. 5C). Because vitamin D3 treatment increases wild-type but not mutant VDR transcription activity under these experimental conditions (Fig. 5D), VDR is apparently inhibiting stress-induced cell death by ligand-independent and transcription-independent non-classical mechanisms. Consistent with this notion, the ligand addition has no substantial effects on stress-induced VDRE activity (Fig. 5D). These results together suggest the existence of stress-induced non-classical VDR pathways that function to inhibit cell death independent of classical ligand-induced VDR transcriptional activity.


Figure 5
View larger version (66K):
[in this window]
[in a new window]

  		FIGURE 5.
VDR protects cell death independent of vitamin D3 and independent of its classical transcriptional activity. A, VDR and its mutant variants were stably expressed in 468 cells. Human breast cancer 468 cells were transfected with pcDNA3 vector (468/Neo) or pcDNA3-V5-VDR (or its mutants as indicated) and G418-resistant cells were pooled for V5-VDR protein expression by Western blot using a V5 antibody. B, higher levels of VDR proteins protect 468 cells from ARS-induced cell death. Vector and VDR-transfected cells were treated with ARS (20 µM for 24 h) or solvent and assayed for cell death by viability assay and flow cytometric analyses (* indicates sub-G1 populations in %). Results are mean of five experiments (bars, S.D., p < 0.05 between 468/Neo and 468/VDR after ARS treatment). C and D, VDR protects cell death independent of vitamin D3 and independent of its classical transcriptional activity. Stable transfected cells were incubated with and without ARS for 24 h in the presence or absence of 10 nM vitamin D3 and cell viability was determined (C). Results are mean of four separate experiments (bars, S.D., p < 0.05 between 468/Neo and 468/VDR or 468/GSV in cells treated with ARS but not with vitamin D3). To analyze VDR transcriptional activity, 468 breast cancer cells were transiently transfected with VDRE-Luc, together with VDR, VDR/GSV (GSV), or an empty vector (for control and ARS groups) (D). Twentyfour hours later cells were pulse-treated with ARS and the reporter activity was determined after an additional 24-h incubation in the presence and absence of vitamin D3. Results are mean of four to five separate experiments (bars, S.D., p < 0.05 only between cells transfected with VDR incubated with and without vitamin D3). E, VDR inhibits cell death independent of the AF2 domain and independent of the DNA binding domain. Stable VDR and mutant-transfected 468 cells were treated with ARS and analyzed for cell death by a viability assay as described in C (mean of four separate experiments, bars, S.E.) and the cell death inhibitory effects of VDR deletion mutants were also confirmed by flow cytometric analyses (data not shown).

 
To further demonstrate the domain requirement for VDR cell death inhibitory activity, its C- and N-terminal deletion mutants were generated and stably expressed in 468 cells and their cell death regulatory effects were analyzed. VDR1–415 lacks the core AF-2 and VDR140–427 is without the DNA-binding domain (40). Although both of these mutants in 468 cells failed to increase vitamin D3-induced VDRE reporter activity (data not shown), their stable expression significantly suppresses ARS-induced cell death (Fig. 5, A and E). These results indicate that VDR inhibits cell death independent of the AF-2 and independent of the DNA-binding domain, further reinforcing our conclusion that VDR inhibits cell death by a non-classical mechanism.


Figure 6
View larger version (44K):
[in this window]
[in a new window]

  		FIGURE 6.
c-Jun is required for the classical and non-classical VDR activities through transcriptional and post-transcriptional regulations. A, VDR binds to c-Jun protein that is increased by ARS but not vitamin D3. Breast cancer 468 cells were pulse-treated with ARS, followed by a 24-h incubation, or incubated with vitamin D3 for 24 h before being collected for immunoprecipitation (IP) with an anti-VDR antibody for complex formation between VDR and c-Jun proteins. The same lysates were analyzed by direct Western blot to confirm the VDR induction by ARS (input). B, c-Jun regulates VDR-RXR{alpha} binding. Endogenous VDR proteins were isolated by a VDR antibody and its c-Jun, p-c-Jun, and RXR{alpha} binding activity in response to vitamin D3 and ARS was examined by Western analyses (top). The same lysates were analyzed by direct Western blot for protein expression and activations (bottom). C, an experimental model illustrating a two-tier mechanism by which c-Jun is required for classical and non-classical VDR activities. In the non-classical pathway (left), stress induces c-Jun phosphorylation/activation, which trans-activates VDR through promoter binding, and increased VDR will then inhibit stress-induced cell death independent of the classical VDR transcriptional activity. This mechanism contrasts with the classical VDR pathway (right) in which VDR is activated by ligand-induced receptor stabilization and/or cofactors recruiting where c-Jun is likely required for its cofactor binding through physical interactions with VDR proteins. * indicates that VDR alone is necessary but not sufficient for stress-induced VDR transcriptional activity in the absence of c-Jun, although it can inhibit cell death, and additional factors such as c-Jun-VDR physical interactions may also be involved in this process.

 
Physical Interactions between VDR and c-Jun Proteins Further Dissect Non-classical from Classical VDR Activities—Our previous study has demonstrated that ER binds to c-Jun protein by a c-Jun phosphorylation-dependent mechanism and thereby inhibits pro-apoptotic c-Jun activity in human breast cancer cells (45). VDR protein was similarly shown to bind to c-Jun in a glutathione S-transferase pulldown assay (39). We would like therefore to explore whether VDR binds to c-Jun protein in these ER negative human breast cancer cells, thereby contributing to its non-classical activity.

To this end, 468 cells were incubated with and without stress or vitamin D3, and endogenous VDR protein was isolated with a specific antibody and precipitates were examined for bound c-Jun proteins by Western analyses. Results in Fig. 6A showed that indeed VDR forms a complex with endogenous c-Jun protein. ARS treatment increases VDR protein expression, whereas vitamin D3 failed to show substantial effects in these cells (Fig. 6A, input). Of interest, VDR-bound c-Jun protein was significantly increased following ARS treatment (phospho-c-Jun undetectable under this condition). This increase is not due to elevated c-Jun protein levels but correlates with up-regulated VDR protein expression under these conditions as judged from the input control. Because VDR proteins in the complex are not significantly elevated compared with the control, these results suggest that in addition to increased protein expression, stress may activate other pathways leading to an increase in the VDR-c-Jun binding affinity. The increased VDR-c-Jun binding activity by ARS may additionally contribute to the non-classical VDR activity.

c-Jun+/+ and c-Jun–/– cells were further analyzed for contributions of VDR-c-Jun interactions to the classical and non-classical VDR activities. Consistent with 468 cells, ARS but not vitamin D3 increased c-Jun proteins in VDR precipitates of c-Jun+/+ cells. The elevated VDR-bound c-Jun proteins under these conditions are phosphorylated, as illustrated by a doublet that is also recognized by a phospho-c-Jun antibody (Fig. 6B). Different than in the breast cancer cells, both stress and vitamin D3 increased VDR protein expression in these fibroblasts (Fig. 6B, bottom). The ARS-induced increase may be due to c-Jun-mediated VDR trans-activation (33) (Fig. 1), whereas the ligand-induced stimulation may result from receptor stabilization (53). To our surprise, vitamin D3 still induces VDR protein expression in c-Jun–/– cells as potently as in c-Jun+/+ cells despite a complete loss of liganded VDR activity (Fig. 6B, input control, and Fig. 2C), suggesting that c-Jun knock-out uncouples VDR protein expression from VDR transcriptional activity. These results together reveal that in contrast to the complete loss of ARS-induced VDR activation, the ligand-induced VDR post-transcriptional regulatory pathways are still intact in these c-Jun knock-out cells, thus further mechanistically dissecting ligand-induced and stress-activated VDR transcriptional activities.

A dissociation of ligand-induced VDR protein expression from liganded VDR activity in c-Jun–/– cells (Fig. 2C versus Fig. 6B, input) indicates additional factors involved in c-Jun regulating VDR transcriptional activity. We next attempted to determine whether its key heterodimer partner RXR (1) is involved in this process. Western blot analyses showed that there were no substantial differences in basal RXR{alpha} protein expression between the knock-out and the wild-type cells (Fig. 6B, input control). Consistent with previous reports (54, 55), stress pathway activation (by ARS in our case) increases RXR{alpha} protein expression in both c-Jun+/+ and c-Jun–/– cells, likely through phosphorylation-associated processes. Vitamin D3, on the other hand, increases a complex formation between VDR and RXR{alpha} as compared with untreated controls and this stimulation, however, is decreased in c-Jun–/– cells despite similar levels of VDR and RXR{alpha} protein expressions (Fig. 6B). Because RXR is a critical cofactor for liganded VDR activity (1), these results suggest that lack of c-Jun proteins may decrease the VDR-RXR{alpha} complex formation, thereby contributing to the diminished classical VDR transcriptional activity. These results together indicate that c-Jun is required for stress-induced VDR activity through trans-activation and for liganded VDR activity via protein-protein interactions leading to an increase in VDR binding activity to other cofactors such as RXR{alpha}.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
These studies demonstrated the existence of the non-classical VDR pathway that functions primarily to inhibit stress-induced cell death by c-Jun-dependent mechanisms. Here are major characteristics of the non-classical VDR pathway as compared with the classical VDR activity (Fig. 6C). First, it is activated through stress-induced VDR trans-activation leading to increased VDR protein synthesis as opposed to ligand-induced receptor stabilization in the classical pathway (53). Second, stress-induced VDR activity is constitutively active, which inhibits cell death independent of vitamin D3 and independent of its classical transcriptional activity. Third, c-Jun is required for the stress-induced VDR activity through its direct binding to the VDR promoter as compared with its physical interactions with VDR proteins in the classical pathways. These results together indicate that the non-classical VDR pathway may primarily function under stress conditions to inhibit cell death via continuous synthesis of VDR protein through c-Jun-mediated trans-activation, whereas the classical VDR activity may mainly act in physiological conditions to regulate target gene expression through c-Jun-regulated cofactors binding. Existence of the non-classical VDR pathway explains VDR cell death inhibitory activities observed in multiple systems (6, 22, 24, 38, 51) in the absence of vitamin D3.

Demonstration of the existence of the non-classical VDR pathway reveals a novel stress regulatory activity of VDR. Although nuclear receptor ER also protects cell death (45, 56) and ER transcriptional activity is also induced by stress (47), ER protein expression is not increased by stress (57) (data not shown). VDR expression, on the other hand, is increased by stress signals (33, 35) (Figs. 1B and 6, A and B) and higher levels of VDR protein in turn suppress stress-induced cell death (21, 38) (Figs. 4B and 5, B and C). Existence of the non-classical VDR activity suggests that this nuclear receptor possesses dual activity (Fig. 6C). Under normal physiological conditions where there is a sufficient amount of vitamin D3, endogenous VDR in target tissues/cells may primarily function as a nuclear receptor to regulate expression of genes important for calcium signaling and bone metabolism (1). In response to stress, however, additional VDR protein will be synthesized by a c-Jun-dependent mechanism to execute its cell death inhibitory functions without requirement of vitamin D3. Thus, VDR may have distinct duties in response to different stimuli.

Our results also indicate that c-Jun is essential for VDR transcriptional activity that acts by distinct mechanisms in the classical and non-classical VDR pathways. The essential role of c-Jun in the VDR activities is indicated by the lack of VDRE activation by both stress and vitamin D3 in c-Jun null cells. In the non-classical pathway, the diminished activity may mostly be due to the absence of c-Jun-mediated VDR trans-activation, as demonstrated by a decreased VDR promoter activity, reduced VDR RNA/protein expression, and diminished stress-induced VDR protein expression in c-Jun–/– cells. In the classical pathway, on the other hand, the reduced VDRE by vitamin D3 may predominantly result from the lack of c-Jun-VDR complex formation leading to a decreased VDR binding activity to RXR{alpha} (likely other cofactors as well), as ligand can still induce VDR protein expression and/or stabilization in these cells. Although VDR expression alone in c-Jun–/– cells inhibits stress-induced cell death, the resultant recovery of VDR activity is limited as compared with c-Jun+/+ cells. This inefficiency may be a combination effect of the lack of c-Jun protein expression and of different regulations of transfected VDR protein by stress and/or vitamin D3 than those observed with endogenous VDR protein (Fig. 6, A and B). Nevertheless, these studies reveal a transcriptional and post-transcriptional two-tier mechanism by which c-Jun is required for stress- and ligand-induced VDR activities.

VDR is known to interact with other proteins, thereby regulating its transcription activity independent of vitamin D3 (40, 58, 59). Ets-1, for example, binds to VDR in the absence of ligand, leading to conformational changes in VDR protein/recruitments of coactivators and a consequent stimulation of VDR transcriptional activity (40). Because c-Jun and Ets family proteins can collaborate in regulating VDR-dependent (60) and -independent gene expression (61), a formation of multiple protein complexes containing VDR, c-Jun, RXR{alpha}, and possibly Ets-1 and other cofactors may contribute to the constitutive VDR activity in the non-classical pathway. Identification of RXR{alpha} in the VDR-c-Jun complex supports this speculation. Future experiments are needed to demonstrate whether a direct VDR-c-Jun binding is required for VDR cell death inhibitory activity and for VDR regulating gene expression.

Our observation that activated c-Jun induces VDR transcription and VDR inhibits c-Jun dependent cell death may explain pleiotropic effects of c-Jun activity in regulating cell death. c-Jun is known to be pro-apoptotic in some systems (45, 62–64) but anti-apoptotic in others (32, 49, 65), and its interacting with other proteins has been shown to regulate its biological outcomes (45, 66). Our results presented here are the first to show that c-Jun activity can be modified through regulating protein expression of its downstream target VDR. This is demonstrated by the decrease in VDR expression in c-Jun–/– cells associated with increased cell death and by the restoration of cell resistance to stress-induced cell death by VDR complementation in the absence of c-Jun protein. This mechanism contrasts to positive feedback regulations through c-Jun phosphorylation leading to an increase in its own transcription via the AP-1 binding (67) and an increase in its own stability (68). The non-classical VDR pathway may therefore determine whether c-Jun activity in stress response leads to cell survival or cell death.


   FOOTNOTES
 
* This work was supported by National Institutes of Health NCI Grant 2R01 CA91576, a Department of Veterans Affairs Merit Review Award, and the Charlotte Geyer Foundation (to G. C.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Both authors contributed equally to this work. Back

2 Present address: Dept. of Pharmacology, Nanjing Medical University, Nanjing, China. Back

3 To whom correspondence should be addressed: Dept. of Pharmacology and Toxicology, Medical College of Wisconsin, 8701 Watertown Plank Rd., Milwaukee, WI 53226. Tel.: 414-456-8636; Fax: 414-456-6545; E-mail: gchen{at}mcw.edu.

4 The abbreviations used are: VDR, vitamin D receptor; RXR, retinoid X receptor; VDRE, vitamin D responsive element; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; JNK, N-terminal c-Jun kinase; AMSA, amsacrine; ARS, sodium arsenite; ER, estrogen receptor; TBST, Tris-buffered saline/Tween 20. Back


   ACKNOWLEDGMENTS
 
We thank Drs. Leonard P. Freedman, Jiahuai Han, Hector F. DeLuca, and Ron Wisdom for providing reagents and Richard M. Schultz for critical reading of the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Jones, G., Strugnell, S. A., and Deluca, H. F. (1998) Physiol. Rev. 78, 1193–1231[Abstract/Free Full Text]
  2. Liu, M., Lee, M. H., Bommakanti, M., and Freedman, L. P. (1996) Gene Dev. 10, 142–153[Abstract/Free Full Text]
  3. Palmer, H. G., Gonzalez-Sancho, J. M., Espada, J., Berciano, M., Puig, I., Baulida, J., Quintanilla, M., Cano, A., de Herreros, A. G., Lafarga, M., and Munoz, A. (2001) J. Cell Biol. 154, 369–387[Abstract/Free Full Text]
  4. Hershberger, P. A., Modzelewski, R. A., Shurin, Z. R., Rueger, R. M., Trump, D. L., and Johnson, C. S. (1999) Cancer Res. 59, 2644–2649[Abstract/Free Full Text]
  5. Yang, L., Yang, J., Venkateswarlu, S., Ko, T., and Brattain, M. G. (2001) J. Cell Physiol. 188, 383–393[CrossRef][Medline] [Order article via Infotrieve]
  6. Kousteni, S., Bellido, T., Plotkin, L. I., O'Brien, C. A., Bodenner, D. L., Han, L., Han, K., DiGregorio, G. B., Katzenellenbogen, J. A., Katzenellenbogen, B. S., Roberson, P. K., Weinstein, R. S., Jilka, R. L., and Manolagas, S. C. (2001) Cell 104, 719–730[Medline] [Order article via Infotrieve]
  7. Mathiasen, I. S., Sergeev, I. N., Bastholm, L., Elling, F., Norman, A. W., and Jaattela, M. (2002) J. Biol. Chem. 277, 30738–30745[Abstract/Free Full Text]
  8. Studzinski, G. P., and Moore, D. C. (1995) Cancer Res. 55, 4014–4022[Abstract/Free Full Text]
  9. Vink-van Wijngaarden, T., Pols, H. A. P., Buurman, C. J., van den Bemd, G. J. C. M., Dorssers, L. C. J., Birkenhager, J. C., and van Leeuwen, J. P. T. M. (1994) Cancer Res. 54, 5711–5717[Abstract/Free Full Text]
  10. Kane, K. F., Langman, M. J. S., and Williams, G. R. (1996) Cancer Res. 56, 623–632[Abstract/Free Full Text]
  11. Belandia, B., and Parker, M. G. (2003) Cell 114, 277–280[CrossRef][Medline] [Order article via Infotrieve]
  12. Kitagawa, H., Fujiki, R., Yoshimura, K., Mezaki, Y., Uematsu, Y., Matsui, D., Ogawa, S., Unno, K., Okubo, M., Tokita, A., Nakagawa, T., Ito, T., Ishimi, Y., Nagasawa, H., Matsumoto, T., Yanagisawa, J., and Kato, S. (2003) Cell 113, 905–917[CrossRef][Medline] [Order article via Infotrieve]
  13. McGuire, T. F., Trump, D. L., and Johnson, C. (2001) J. Biol. Chem. 276, 26365–26373[Abstract/Free Full Text]
  14. Diaz, G. D., Paraskeva, C., Thomas, M. G., Binderup, L., and Hague, A. (2000) Cancer Res. 60, 2304–2312[Abstract/Free Full Text]
  15. Xu, H. M., Tepper, C. G., Jones, J. B., Fernandez, C. E., and Studzinski, G. P. (1993) Exp. Cell Res. 209, 367–373[CrossRef][Medline] [Order article via Infotrieve]
  16. Asada, M., Yamada, T., Ichijo, H., Delia, D., Miyazono, K., Fukumuro, K., and Mizutani, S. (1999) EMBO J. 18, 1223–1234[CrossRef][Medline] [Order article via Infotrieve]
  17. Ravid, A., Rubinstein, E., Gamady, A., Rotem, C., Liberman, U. A., and Koren, R. (2002) J. Endocrinol. 173, 525–532[Abstract]
  18. Jimenez, J., and Yunis, A. A. (1992) Cancer Res. 52, 5123–5125[Abstract/Free Full Text]
  19. Chen, G., Baechle, A., Nevins, T. D., Oh, S., Harmon, C., and Stacey, W. D. (1998) Int. J. Cancer 75, 303–309[CrossRef][Medline] [Order article via Infotrieve]
  20. Schilli, M. B., Paus, R., and Menrad, A. (1998) J. Investig. Dermatol. 111, 598–604[CrossRef][Medline] [Order article via Infotrieve]
  21. Hewison, M., Dabrowski, M., Vadher, S., Faulkner, L., Cockerill, F. J., Brickell, P., O'Riordan, J. L. H., and Katz, D. R. (1996) J. Immunol. 156, 4391–4400[Abstract]
  22. Li, Y. C., Pirro, A., Amling, M., Delling, G., Baron, R., Bronson, R., and Demay, M. B. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 9831–9835[Abstract/Free Full Text]
  23. Yoshizawa, T., Handa, Y., Uematsu, Y., Takeda, S., Sekine, K., Yoshihara, Y., Kawakami, T., Arioka, K., Sato, H., Uchiyama, Y., Masusgige, S., Fukamizu, A., Matsumoto, T., and Kato, S. (1997) Nat. Genet. 16, 391–393[CrossRef][Medline] [Order article via Infotrieve]
  24. Guzey, M., Jukic, D., Arlotti, J., Acquafondata, M., Dhir, R., and Getzenberg, R. (2004) J. Cell. Biochem. 93, 133–141[CrossRef][Medline] [Order article via Infotrieve]
  25. Karin, M. (1995) J. Biol. Chem. 270, 16483–16486[Free Full Text]
  26. Shaulian, E., and Karin, M. (2002) Nat. Cell. Biol. 5, E131–E136
  27. Ono, K., and Han, J. (2000) Cell. Signal. 12, 1–13[CrossRef][Medline] [Order article via Infotrieve]
  28. Xia, Z., Dickens, M., Raingeaud, J., Davis, R. J., and Greenberg, M. E. (1995) Science 270, 1326–1331[Abstract/Free Full Text]
  29. Behrens, A., Sibilia, M., and Wagner, E. F. (1999) Nat. Genet. 21, 326–329[CrossRef][Medline] [Order article via Infotrieve]
  30. Kolbus, A., Herr, I., Schreiber, M., Debatin, K., Wagner, E. F., and Angel, P. (2000) Mol. Cell. Biol. 20, 575–582[Abstract/Free Full Text]
  31. Potapova, O., Gorospe, M., Dougherty, R. H., Dean, N. M., Gaarde, W. A., and Holbrook, N. J. (2000) Mol. Cell. Biol. 20, 1713–1722[Abstract/Free Full Text]
  32. Eferi, R., Ricci, R., Kenner, L., Zenz, R., David, J., Rath, M., and Wagner, E. F. (2003) Cell 112, 181–192[CrossRef][Medline] [Order article via Infotrieve]
  33. Qi, X., Pramank, R., Wang, J., Schultz, R. M., Maitra, R. K., Han, J., DeLuca, H. F., and Chen, G. (2002) J. Biol. Chem. 277, 25884–25892[Abstract/Free Full Text]
  34. Chen, T. L., and Feldman, D. (1981) J. Biol. Chem. 256, 5561–5566[Free Full Text]
  35. Daniel, C., Schroder, O., Zahn, N., Gaschott, T., and Stein, J. (2004) Biochem. Biophy. Res. Commun. 324, 1220–1226[CrossRef][Medline] [Order article via Infotrieve]
  36. Bao, B. Y., Hu, Y. C., and Lee, Y. F. (2004) Oncogene 23, 3350–3360[CrossRef][Medline] [Order article via Infotrieve]
  37. Chen, L., Cencioni, M. T., Angelini, D. F., Borsellino, G., Battistini, L., and Brosnan, C. F. (2005) J. Immunol. 174, 6144–6152[Abstract/Free Full Text]
  38. Qi, X., Tang, J., Pramanik, R., Schultz, R. M., Shirasawa, S., Sasazuki, T., Han, J., and Chen, G. (2004) J. Biol. Chem. 279, 22138–22144[Abstract/Free Full Text]
  39. Towers, T. L., Staeva, T. P., and Freedman, L. (1999) Mol. Cell. Biol. 19, 4191–4199[Abstract/Free Full Text]
  40. Tolon, R. M., Castillo, A. I., Jimenez-Lara, A. M., and Aranda, A. (2000) Mol. Cell. Biol. 20, 8793–8802[Abstract/Free Full Text]
  41. Tang, J., Qi, X., Mercola, D., Han, J., and Chen, G. (2005) J. Biol. Chem. 280, 23910–23917[Abstract/Free Full Text]
  42. Jehan, F., and Deluca, H. F. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 10138–10143[Abstract/Free Full Text]
  43. Johnson, R., Spiegelman, B., Hanahan, D., and Wisdom, R. (1996) Mol. Cell. Biol. 16, 4504–4511[Abstract]
  44. Szak, S. T., Mays, D., and Pietenpol, J. (2001) Mol. Cell. Biol. 21, 3375–3386[Abstract/Free Full Text]
  45. Qi, X., Borowicz, S., Pramanik, R., Schultz, R. M., Han, J., and Chen, G. (2004) J. Biol. Chem. 279, 6769–6777[Abstract/Free Full Text]
  46. Gilad, L. A., Bresler, T., Gnainsky, J., Smirnoff, P., and Schwartz, B. (2005) J. Endocrinol. 185, 577–592[Abstract/Free Full Text]
  47. Lee, H., Jiang, F., Wang, Q., Nicosia, S. V., Yang, J., and Bai, W. (2000) Mol. Endocrinol. 14, 1882–1896[Abstract/Free Full Text]
  48. Lee, H.-Y., Suh, Y.-A., Robinson, M. J., Clifford, J. L., Hong, W. K., Woodgett, J. R., Cobb, M. H., Mangelsdorf, D. J., and Kurie, J. M. (2000) J. Biol. Chem. 275, 32193–32199[Abstract/Free Full Text]
  49. Wisdom, R., Johnson, R. S., and Moore, C. (1999) EMBO J. 18, 188–197[CrossRef][Medline] [Order article via Infotrieve]
  50. Chen, A. Y., and Liu, L. F. (1994) Annu. Rev. Pharmacol. Toxicol. 34, 191–218
  51. Maruyama, R., Aoki, F., Toyota, M., Sasaki, Y., Akashi, H., Mita, H., Suzuki, H., Akino, K., Ohe-Toyota, M., Maruyama, Y., Tatsumi, H., Imai, K., Shinomura, Y., and Tokino, T. (2006) Cancer Res. 66, 4574–4583[Abstract/Free Full Text]
  52. Alroy, I., Towers, T. L., and Freedman, L. P. (1995) Mol. Cell. Biol. 15, 5789–5799[Abstract]
  53. Wiese, R. J., Rhland-Smith, A., Ross, T. K., Prahl, J. M., and DeLuca, H. F. (1992) J. Biol. Chem. 267, 20082–20086[Abstract/Free Full Text]
  54. Adam-Stitah, S., Penna, L., Chambon, P., and Rochette-Egly, C. (1999) J. Biol. Chem. 274, 18932–18941[Abstract/Free Full Text]
  55. Konta, T., Xu, Q., Furusu, A., Nakayama, K., and Kitamura, M. (2001) J. Biol. Chem. 276, 12697–12701[Abstract/Free Full Text]
  56. Park, K.-J., Krishnan, V., O'Malley, B. W., Yamamoto, Y., and Gaynor, R. B. (2005) Mol. Cell 18, 71–82[CrossRef][Medline] [Order article via Infotrieve]
  57. Pinzone, J. J., Stevenson, H., Stroble, J., and Berg, P. E. (2004) Mol. Cell. Biol. 24, 4605–4612[Free Full Text]
  58. Hsieh, J., Sisk, J. M., Jurutka, P. W., Haussler, C. A., Slater, S. A., Haussler, M. R., and Thompson, C. C. (2003) J. Biol. Chem. 278, 38665–38674[Abstract/Free Full Text]
  59. Pedigo, N. G., Zhang, H., Bruno, M. E. C., Kaetzel, C. S., Dugan, A. R., Shanehsaz, P., Hennigan, R. F., Xing, Z., Koszewski, N., and Kaetzel, D. M. (2005) Oncogene 24, 2654–2666[CrossRef][Medline] [Order article via Infotrieve]
  60. El-Tanani, M., Platt-Higgins, A., Rudland, P. S., and Campbell, F. C. (2004) J. Biol. Chem. 279, 20794–20806[Abstract/Free Full Text]
  61. Wasylyk, B., Wasylyk, C., Flores, P., Begue, A., Leprince, D., and Stehelin, D. (1990) Nature 346, 191–193[CrossRef][Medline] [Order article via Infotrieve]
  62. Shaulian, E., Schreiber, M., Piu, F., Beeche, M., Wagner, E. F., and Karin, M. (2000) Cell 103, 897–907[CrossRef][Medline] [Order article via Infotrieve]
  63. Estus, S., Zaks, W. J., Freeman, R. S., Gruda, M., Bravo, R., and Johnson, E. M., Jr. (1994) J. Cell Biol. 127, 1717–1727[Abstract/Free Full Text]
  64. Bossy-Wetzel, E., Bakiri, L., and Yaniv, M. (1997) EMBO J. 16, 1695–1709[CrossRef][Medline] [Order article via Infotrieve]
  65. Huang, Y., Hutter, D., Liu, Y., Wang, X., Sheikh, M. S., Chan, A. M., and Holbrook, N. J. (2000) J. Biol. Chem. 275, 18234–18242[Abstract/Free Full Text]
  66. Nateri, A. S., Riera-Sans, L., Costa, C. D., and Behrens, A. (2004) Science 303, 1374–1378[Abstract/Free Full Text]
  67. Angel, P., Hattori, K., Smeal, T., and Karin, M. (1988) Cell 55, 875–885[CrossRef][Medline] [Order article via Infotrieve]
  68. Musti, A. M., Treier, M., and Bohmann, D. (1997) Science 275, 400–402[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
X. Qi, N. M. Pohl, M. Loesch, S. Hou, R. Li, J.-Z. Qin, A. Cuenda, and G. Chen
p38{alpha} Antagonizes p38{gamma} Activity through c-Jun-dependent Ubiquitin-proteasome Pathways in Regulating Ras Transformation and Stress Response
J. Biol. Chem., October 26, 2007; 282(43): 31398 - 31408.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/3/1544    most recent
M604052200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Q.-P.
Right arrow Articles by Chen, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Q.-P.
Right arrow Articles by Chen, G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement