JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M605931200 on November 27, 2006

J. Biol. Chem., Vol. 282, Issue 3, 1561-1569, January 19, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/3/1561    most recent
M605931200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagahara, N.
Right arrow Articles by Matsumura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagahara, N.
Right arrow Articles by Matsumura, T.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Thioredoxin-dependent Enzymatic Activation of Mercaptopyruvate Sulfurtransferase

AN INTERSUBUNIT DISULFIDE BOND SERVES AS A REDOX SWITCH FOR ACTIVATION*

Noriyuki Nagahara{ddagger}1, Taro Yoshii{ddagger}, Yasuko Abe§, and Tomohiro Matsumura§

From the {ddagger}Department of Environmental Medicine and the §Department of Biochemistry and Molecular Biology, Nippon Medical School, Tokyo 113-8602, Japan

Received for publication, June 21, 2006 , and in revised form, November 13, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Rat 3-mercaptopyruvate sulfurtransferase (MST) contains three exposed cysteines as follows: a catalytic site cysteine, Cys247, in the active site and Cys154 and Cys263 on the surface of MST. The corresponding cysteine to Cys263 is conserved in mammalian MSTs, and Cys154 is a unique cysteine. MST has monomer-dimer equilibrium with the assistance of oxidants and reductants. The monomer to dimer ratio is maintained at ~92:8 in 0.2 M potassium phosphate buffer containing no reductants under air-saturated conditions; the dimer might be symmetrical via an intersubunit disulfide bond between Cys154 and Cys154 and between Cys263 and Cys263, or asymmetrical via an intersubunit disulfide bond between Cys154 and Cys263. Escherichia coli reduced thioredoxin (Trx) cleaved the intersubunit disulfide bond to activate MST to 2.3- and 4.9-fold the levels of activation of dithiothreitol (DTT)-treated and DTT-untreated MST, respectively. Rat Trx also activated MST. On the other hand, reduced glutathione did not affect MST activity. E. coli C35S Trx, in which Cys35 was replaced with Ser, formed some adducts with MST and activated MST after treatment with DTT. Thus, Cys32 of E. coli Trx reacted with the redox-active cysteines, Cys154 and Cys263, by forming an intersubunit disulfide bond and a sulfenyl Cys247. A consecutively formed disulfide bond between Trx and MST must be cleaved for the activation. E. coli C32S Trx, however, did not activate MST. Reduced Trx turns on a redox switch for the enzymatic activation of MST, which contributes to the maintenance of cellular redox homeostasis.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Redox-active disulfide bonds have an important role in regulating protein function and enzymatic activity. Reduced thioredoxin (Trx)2 cleaves the disulfide bond, "turns on or off a redox switch," and facilitates protein function or activates an enzyme that results from possible conformational changes (1–8). These disulfide bonds are generally "intrasubunit or intramolecular disulfide bonds." When these cysteines are adjacent, the redox change most effectively turns the redox switch on and off (9). As an exceptional case, hetero-oligomer ATP synthase is inhibited via the formation of an intersubunit disulfide bond between the bc' and {gamma} subunits because of a mechanical standstill of the molecular motor (10). This redox switch directly regulates enzymatic activity and can therefore be categorized as a direct and mechanical function. In the cases in which protein function is facilitated via a conformational change caused by cleavage of a disulfide bond, the redox switch is categorized as an indirect function.

Rat 3-mercaptopyruvate sulfurtransferase (MST) (EC 2.8.1.2 [EC] ) is a 32.8-kDa simple protein enzyme (11). MST catalyzes the degradation of cysteine, detoxifies cyanide (12), and serves as anti-oxidant protein (13). When oxidative stress builds up in the cells, a sulfur atom of the catalytic site Cys247 donates an electron to the oxidants, and the cysteine is transiently converted to a sulfenate, resulting in the inhibition of MST. Furthermore, as the sulfenate is at a low redox potential, Trx and DTT reduce it to restore its activity, but reduced glutathione does not affect the activity (13). Under oxidizing conditions, the cysteine pool is increased because of post-translational inhibition of methionine synthase (14, 15) and post-translational activation of cystathione beta-synthase (14, 16). Inhibition of MST conserves cysteine and contributes to increase the cysteine pool. An increase in the cysteine content in the cell results in an increase in the content of cellular reductants such as Trx and glutathione. Thus, MST contributes to maintain redox homeostasis.

In a preliminary study, Escherichia coli reduced Trx activated rat recombinant MST after treatment with DTT, but DTT did not activate MST after treatment with reduced Trx. These findings suggested that reduced Trx reacted with cysteines other than Cys247. It is also possible that Trx reacted with Cys154 and Cys263 on the surface of MST. MST exhibits monomer-dimer equilibrium (17). The estimated tertiary structure of rat MST (18) using QUANTA/CHARMm (Molecular Simulations Inc., Tokyo, Japan), based on the x-ray structure of bovine rhodanese (19), suggests that Cys154 and Cys263 in the hydrophobic patch are too far from each other (32 Å) to form an intrasubunit disulfide bond. The dimer is therefore formed via intersubunit disulfide bonds, and reduced Trx would react with the disulfide bond or turn on "a redox switch."

Rat Trx has two redox-active cysteine residues (Cys31 and Cys34) and four structural cysteine residues (Cys45, Cys61, Cys68, and Cys72) (20), which are identical to those of human Trx except Cys45 (21). Cys72 is easily oxidized to form an intermolecular disulfide bond (22) and to undergo glutathionylation (23). Furthermore, they modify the Trx reaction with a target protein, which makes a quantitative analysis of change in the target protein function complicated. On the other hand, exposed cysteines are only two redox-active cysteines (Cys32 and Cys35) in E. coli Trx (24). Thus, E. coli Trx has been used to probe a Trx-dependent modification of mammalian protein function (25–27). In this study, we confirm that E. coli thioredoxin acts on rat MST. The results provide evidence that reduced Trx also regulates MST at the enzyme level via a redox regulation of intersubunit disulfide bonds.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Preparation of Wild Type and Mutant MSTs
Rat wild type, C64S (in which Cys64 is replaced with serine), C154S, C254S, and C263S MST cDNAs were prepared according to a procedure described previously (13). A cDNA coding a mutant MST, C154S/C263S (in which Cys154 and Cys263 are replaced with serine), was synthesized. A C154S MST cDNA inserted into a pET28a vector (Novagen, San Diego) between the NcoI/XhoI sites was used as a template for the mutagenesis. The primers, rC263S-s, GGGGCCTTCCTCTCTGGCAAACCCGATG, and rC263S-A, CATCGGGTTTGCCAGAGAGGAAGGCCCC, were used to replace of Cys263 with serine.

The mutagenesis was performed using a QuikChange site-directed mutagenesis kit (Stratagene La Jolla, CA). The parameters for the PCR were as follows: for the first segment, one cycle of denaturation at 95 °C for 30 s; for the second segment, 13 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 1 min, and extension at 68 °C for 8.6 min. The PCR product was digested with DpnI and introduced into Epicurian Coli XL1-Blue using standard protocols except for preculture in Luria Bertani medium without antibiotics at 37 °C for 1 h before plating. Sequencing was performed to select each mutagenized cDNA using the synthesized antisense primer, AGGATGGTTCGGTGTCAC, to examine the replacement of Cys263 with serine. The mutant cDNA sequence was confirmed by DNA sequencing.

Overexpression and Purification of MSTs
Each pET28a vector containing cDNA of the wild type or mutant MST was introduced into E. coli, BL21 (DE3) cells transformed with a pSTV vector containing GroEL and GroES cDNAs. Each enzyme was overexpressed and purified according to the methods described previously (11).

Preparation of Thioredoxin Reductase and Wild Type and Mutant Trxs
E. coli thioredoxin reductase (TRD), wild type (Trx 1), C32S, and C35S Trx cDNAs, rat wild type, and C34S Trx cDNAs were prepared according to the procedure of Abe et al.3 These proteins were then overexpressed and purified accordingly.3 Rat TRD was purchased from Sigma.

Reduction of E. coli Wild Type, C32S, and C35S Trxs and Rat Wild Type and C34S Trxs
The Trxs (2 mg) were incubated with 10 mM DTT on ice for 12 h in 100 µl of 20 mM potassium phosphate buffer, pH 7.4. After gel filtration with a Sephadex G-25 column (1 x 20 cm; GE Healthcare), Trx-containing fractions were collected and concentrated with a Microcon YM-3 filter (Millipore, Billerica, MA). Rat redox Trx would be easily oxidized to form a dimer via an intermolecular disulfide bond, after DTT is removed. Thus, the rat Trx, in which redox-active cysteines are reduced, is referred as a rat reduced Trx.

Establishment of Reduced Trx System and Trx-TRD-NADPH System for MST Activation
In the Trx-TRD-NADPH system, after incubation of 12 µM wild type MST with NADPH (0, 12, 60, 120, and 300 µM), E. coli or rat Trx (0, 12, 24, 48, 60, and 120 µM), and E. coli or rat TRD (0, 12, 1.2, 0.6, 0.24, and 0.12 µM) in 10 µl of 20 mM potassium phosphate buffer, pH 7.4, on ice for 20 min, a 5-µl aliquot of the mixture was used for the rhodanese activity assay. In the E. coli or rat reduced Trx system, after incubation of 12 µM wild type MST with E. coli or rat reduced Trx (0, 12, 24, 48, 60, and 120 µM) in 10 µl of 20 mM potassium phosphate buffer, pH 7.4, on ice for 20 min, a 5-µl aliquot of the mixture was used for the rhodanese activity assay. Additionally the rat reduced Trx system with 1.2 mM DTT was also examined.

Time-dependent activation of MST (12 µM) in the E. coli or rat reduced Trx system ([MST]:[reduced Trx] = 5:1) or the Trx-TRD-NADPH system ([MST]:[E. coli Trx]:[E. coli TRD]:[NADPH] = 1:5:0.02:12.5 or [MST]:[rat Trx]:[rat TRD]:[NADPH] = 1:1:0.05: 12.5) was examined in 5 µl of 20 mM potassium phosphate buffer, pH 7.4, on ice for 1, 5, 10, 15, and 20 min, and the mixture was used for the rhodanese activity assay. Furthermore, the rat reduced Trx system with 1.2 mM DTT and the Trx-TRD-NADPH system with 1.2 mM DTT were also examined.

Activation Study of MST Using DTT, Reduced Trx, and Trx-TRD-NADPH Systems
To remove an outer sulfur of some persulfurated MST, MST was incubated with a 100-fold molar dose of potassium cyanide (Wako Pure Chemicals, Osaka, Japan) in 20 mM potassium phosphate buffer, pH 7.4, on ice for 40 min, and cyanide was removed using a PD10 column (GE Healthcare). Enzyme-containing fractions were collected and concentrated with a VIVASPIN (10,000 molecular weight cutoff; Sartorius, Goettingen, Germany).

In an activation system using DTT, or E. coli or rat reduced Trx, after incubation of wild type MST with a 100-fold molar dose of DTT or a 5-fold molar dose of reduced Trx in 20 mM potassium phosphate buffer, pH 7.4, on ice for 20 min, DTT was removed using a PD10 column, and enzyme-containing fractions were collected and concentrated with a VIVASPIN. When MST was activated in the Trx-TRD-NADPH system, wild type MST was incubated in a mixture ([MST]:[E. coli Trx]:[E. coli TRD]:[NADPH] = 1:5:0.02:12.5 or [MST]:[rat Trx]:[rat TRD]: [NADPH] = 1:1:0.05:12.5) in 20 mM potassium phosphate buffer, pH 7.4, on ice for 20 min. After each single or serially combined MST treatment, rhodanese activity was measured, and the ratio of the specific activity of one experimental result to another was calculated.

Kinetic Studies
To investigate the mechanism of MST activation by reduced Trx, kinetic studies of untreated and activated wild type, C64S, C254S, and C154/236S MSTs by reduced Trx were performed.

As the double-reciprocal plots of velocity versus potassium cyanide concentration were not linear when rhodanese activities were measured with MSTs (18), apparent Km and kcat values for thiosulfate were determined with a constant concentration of potassium cyanide at 60 mM. After incubation of 6 µM of mutant MSTs with 0 or 30 µM (5-fold molar dose), reduced Trx in 10 µl of 20 mM potassium phosphate buffer, pH 7.4, on ice for 20 min, rhodanese activity was measured using an assay mixture containing 60 mM potassium cyanide and 20, 30, 40, 50, or 60 mM thiosulfate. For the study of wild type MST, after 6 µM of MST was incubated with 0, 3, 6, 12, or 30 µM reduced Trx or 0.6 mM DTT, rhodanese activity was measured using an assay mixture containing 60 mM potassium cyanide, and 12.5, 20, 30, 40, 50, or 60 mM thiosulfate.

Percentage of Free SH Groups Under Air-saturated Conditions
For titration of the enzymes under reducing conditions, oxygen in the solvent was removed using a glass apparatus by sequential evacuation and re-equilibration with oxygen-free argon. Oxygen-free argon was prepared by passing commercially obtained pure argon through a column of a Chromatopack Gas-Clean Oxygen Filter CP17970 (Varian, Inc., Palo Alto, CA). After incubation of 300 µM wild type, C154S, C263S, and C153S/C236S MSTs with 5 mM DTT in 30 µl of 20 mM potassium phosphate buffer, pH 7.4, on ice overnight under anaerobic conditions, DTT was removed from each sample with a NAP 5 column before analysis.

Each enzyme (20 µM) was incubated with 0.5 mM 5,5'-dithiobis(2-nitrobenzoic acid) in 20 mM potassium phosphate buffer, pH 8.0, at 25 °C for 60 min, and the change in absorbance at 412 nm ({epsilon}412 = 13,600 M–1) was measured. The ratio of free SH groups of each enzyme under air-saturated conditions to that under reducing conditions was calculated.

Activation Mechanism
HPLC Analysis during Trx Activation of MSTs—Wild type, C154S, C263S, and C154S/C263S MSTs (0.3 nmol) were incubated with E. coli reduced wild type, E. coli C32S, or E. coli C35S Trx (1.5 nmol) in 20 µl of 20 mM potassium phosphate buffer, pH 7.0, on ice for 20 min. Untreated and C35S Trx-treated wild type MST were incubated with 1.5 mM DTT in 20 µl of 20 mM potassium phosphate buffer, pH 7.0, on ice for 20 min and 12 h. All samples were analyzed using an HPLC system (PU-2080Plus and UV2075Plus, JUSCO, Tokyo, Japan) equipped with two TSK gel filtration columns (G3000SWXL, 7.8 mm x 30 cm and G2000SWXL, 7.8 mm x 30 cm, TOSOH Corp., Tokyo, Japan), which were connected in series. The mobile phase was composed of 0.2 M potassium phosphate buffer, pH 7.0; the flow rate was 0.5 ml/min, and detection was made at 280 nm.

For the calibration curve, a gel filtration standard (Bio-Rad) containing thyroglobulin (670 kDa), bovine gamma globulin (158 kDa), chicken ovalbumin (44 kDa), and equine myoglobin (17 kDa) was used.


Figure 1
View larger version (58K):
[in this window]
[in a new window]

  		FIGURE 1.
Time and dose dependence of Trx on activation of MST. A, time-dependent activation of MST with reducing systems. The E. coli system contains 12 µM MST and 60 µM E. coli reduced Trx (Figure 1). The rat system contains 60 µM rat reduced Trx with (Figure 1) or without (Figure 1) 1.2 mM DTT. The E. coli Trx-TRD-NADPH system contains 12 µM MST, 0.24 µM E. coli TRD, 150 µM NADPH, and 60 µM E. coli Trx ({square}). The rat Trx-TRD-NADPH system contains 12 µM MST, 0.24 µM rat TRD, 150 µM NADPH, and 12 µM rat Trx with ({blacksquare}) or without (Figure 1) 1.2 mM DTT. After incubation for the predetermined time, the rhodanese activity of each MST was assayed. The ratio of rhodanese activity for each MST to the control activity was calculated. B, NADPH dose-dependent activation of MST using an E. coli ({square}) or rat Trx ({blacksquare}). MST (12 µM), various concentrations of NADPH (0, 12, 50, 120, and 300 µM), E. coli or rat Trx (60 or 12 µM, respectively), and E. coli or rat TRD (0.24 or 0.6 µM, respectively) were incubated on ice for 20 min, and the rhodanese activity of each MST was assayed. C, Trx dose-dependent activation of MST using an E. coli ({square}) or rat Trx ({blacksquare}). MST (12 µM), various concentrations of E. coli or rat Trx (0, 12, 24, 48, 60, and 120 µM), NADPH (150 µM), and E. coli or rat TRD (0.24 or 0.6 µM, respectively) were incubated on ice for 20 min. D, TRD dose-dependent activation of MST using an E. coli ({square}) or rat Trx ({blacksquare}). MST (12 µM), various concentrations of E. coli or rat TRD (0, 0.12, 0.24, 0.6, 1.2, and 12µM), NADPH (150µM), and E. coli or rat Trx (60 or 12 µM, respectively) were incubated. E, reduced Trx dose-dependent activation of MST using an E. coli (Figure 1) or rat (Figure 1) reduced Trx. MST (12 µM), various concentrations of E. coli, or rat reduced Trx (0, 12, 24, 48, 60, and 120 µM) was incubated. Furthermore, 1.2 mM DTT was incubated with rat reduced Trx (Figure 1). Data are shown as the mean ± S.E. (error bar), (n = 3).

 
Trx Attack Mode—After wild type MST (12 µM) was incubated with E. coli reduced C32S Trx (0, 36, 60, or 120 µM) or reduced C35S Trx (0, 36, 60, 120, or 360 µM) in 10 µl of 20 mM potassium phosphate buffer, pH 7.4, on ice for 30 min, a 10-µl aliquot of the mixture was assayed for the rhodanese activity. Another 5-µl aliquot was further incubated with DTT (1.2 mM) on ice for 30 min and then assayed for rhodanese activity.

MST Rhodanese Activity Assay
A procedure to measure rhodanese activity by catalyzing the trans-sulfuration from mercaptopyruvate to beta-mercaptoethanol would not be appropriate for this experiment, because beta-mercaptoethanol reduces disulfide bonds formed between subunits during incubation in the assay mixture. MST possesses rhodanese activity, which catalyzes trans-sulfuration from thiosulfate to cyanide (11, 18); therefore, it was this rhodanese activity of MST that was measured.

Protein Determination
The protein concentrations were determined with a Coomassie protein assay kit (Pierce) with crystalline bovine serum albumin (ICN Biochemicals, Irvine, CA) as the standard.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Time and Dose Dependence of Enzymatic Activity of MST by Reduced Trx and Trx-TRD-NADPH Systems—MST was activated in a time-dependent manner by the E. coli or rat reduced Trx system, and also by the E. coli or rat reduced Trx-TRD-NADPH system (Fig. 1A). MST activation quickly proceeded with increasing concentrations of reagents in each reducing system (Fig. 1, B–E). These findings suggest that, similar to rat Trx, E. coli Trx reacts with rat MST. In the E. coli Trx-TRD-NADPH system, MST activity increased to 4.5-fold that of the control with 48 µM E. coli Trx and 0.24 µM E. coli TRD (Fig. 1, C and D). In the rat Trx-TRD-NADPH system, MST activity increased to 3-fold that of the control with 12 µM rat Trx and 0.6 µM rat TRD (Fig. 1, C and D). In the E. coli reduced Trx system, MST activity increased to 4.5-fold that of the control with 48 µM E. coli Trx (Fig. 1E). In the rat reduced Trx system, MST activity increased to 3.0-fold that of the control with 60 µM rat Trx (Fig. 1E). It is noteworthy that additional treatment with DTT (1.2 mM) increased MST activity to 5-fold that of the control, implying that DTT acted on rat Trx to modify its function and/or directly activated MST (Fig. 1E).

For the Trx-TRD-NADPH system in this study, we determined that the ratio of [MST] to [E. coli reduced Trx], [E. coli TRD], and [NADPH] was 1 to 5, 0.02, and 12.5, respectively, and the ratio of [MST] to [rat reduced Trx], [rat TRD], and [NADPH] was 1 to 1, 0.05, and 12.5, respectively. For the reduced Trx system, we determined that the ratio of [MST] to [reduced Trx] was 1 to 5.

MST Activation by DTT, Reduced Trx, and Trx-TRD-NADPH System—E. coli reduced Trx, the E. coli Trx-TRD-NADPH system, and DTT activated wild type, C64S, C154S, C254S, and C263S MSTs under air-saturated conditions (Table 1). The effect of E. coli reduced Trx on the activation of each MST was similar to that of the E. coli Trx-TRD-NADPH system. Wild type, C64S, and C254S MSTs responded well to the reducing systems, and for C154S/C263S MST little responded. C154S and C263S MSTs were low responsive to the reducing systems, and their activities were increased to 1.9- and 3.1-fold that of each control group, respectively.


View this table:
[in this window]
[in a new window]

  		TABLE 1
MST activation by the Trx-TRD-NADPH system, reduced Trx (RedTrx), and DTT

 
DTT also activated MSTs to between 1.1- and 2.4-fold the activity of each control. Furthermore, we previously revealed that reduced Trx quickly restored hydrogen peroxide-inhibited MST, in which oxidants formed a sulfenate at a catalytic Cys247, and DTT equivalently or more efficiently restored the activity (13). This finding and the results of this study indicate that Cys154 and Cys263, other than the catalytic Cys247, are sites of action for Trx and DTT, and DTT acts mainly on a sulfenyl Cys247.

To minimize the action of Trx on a sulfenyl Cys247, after the MSTs were treated with DTT and the DTT was removed, MSTs were treated with E. coli reduced Trx. Wild type, C64S, and C254S MSTs were activated to 2.3-, 2.2-, 2.8-fold that of each DTT-treated MSTs, respectively. On the other hand, after MSTs were treated with E. coli reduced Trx, MSTs were then treated with DTT. Their activities ranged between 1.0- and 1.2-fold that of each Trx-treated MST. The results confirm that E. coli reduced Trx acts on Cys154 and Cys263 other than Cys247 in the activation of MST.

The results of a comparative study using rat Trx and rat TRD are shown in Table 1 and Fig. 1. The rat Trx-TRD-NADPH system and rat reduced Trx activated wild type MST to 3.1- and 3.0-fold that of the control, respectively. It is noteworthy that, although DTT co-existed in the reducing systems using rat Trx, these activities further increased to 4.8- and 5.0-fold that of the control, respectively (Fig. 1E and Table 1). These findings are similar to those of experiments using E. coli Trx and E. coli TRD.

It is strongly suggested that DTT modifies rat Trx function to further activate MST probably because of reduction of an intersubunit disulfide bond at Cys72 in a rat Trx dimer, which dissolved oxygen would easily form. The reducing system using rat Trx is not suitable for a quantitative study of Trx function on a protein.

Kinetic Studies of the Enzymatic Activation—As the action of E. coli wild type Trx on Cys154, Cys263, and Cys247 of MSTs cannot be clearly discriminated, the results of the overall activation kinetics were compared. Lineweaver-Burk plots and kinetic parameters for wild type, C64S, C154S, C254S, C263S, and C154S/C263S MSTs are shown in Fig. 2 and Table 2. In wild type MST, Lineweaver-Burk plots for 1/[thiosulfate] versus 1/[velocity] showed that the activation followed pseudo-first order Michaelis-Menten kinetics. Furthermore, all of the lines did not intersect at a single point, suggesting that the activation process with various concentrations of reduced Trx involved an increase in kcat(app) and a decrease in Km(app). The activation proceeded via "cleavage of the covalent intermediate of a single enzyme molecule with Trx" (see also under "Attack Mode of Trx to MST") and resulted from possible conformational changes.


View this table:
[in this window]
[in a new window]

  		TABLE 2
Change in kinetic parameters for rhodanese activity of MST in enzymatic activation

 
Lineweaver-Burk plots for wild type, C64S, and C254S MSTs had a similar pattern (Fig. 2), and the values of kcat(app)/Km(app) for untreated MSTs were 11, 7.0, and 9.1 (min–1 mM–1), respectively (Table 2). On the other hand, Lineweaver-Burk plots for C154S, C263S, and C154S/C263S MSTs resembled each other. These three MSTs were low responsive to reduced Trx, and the kcat(app)/Km(app) values for untreated MSTs were 15, 18, and 37 (min–1 mM–1), respectively (Table 2). Furthermore, the ratios of kcat(app)/Km(app) for Trx-treated MST compared with that for the untreated MST were 1.5, 1.3, and 1.2, respectively. These findings suggest that C154S, C263S, and C154S/C263S MSTs mimic the active form of MST. The Km(app), kcat(app), and kcat(app)/Km(app) values for DTT-treated wild type MST were (4.1 ± 0.5) x 10 mM, (6.5 ± 0.7) x 102 min–1, and 1.6 x 10 min–1 mM–1, respectively.

Gel Filtration HPLC Analysis Using E. coli Wild Type Trx—Chromatograms of untreated wild type, C154S, and C263S MSTs revealed that they had each monomer (retention time of 35.8 min)-dimer (32 min) equilibrium, and the dimer contents were 7.8 (Fig. 3), 1.6, and 12.2%, respectively. It is noteworthy that C154S/C263S MST consisted of a monomer alone (Fig. 3). E. coli reduced wild type Trx decreased the dimer content to 1.0, 1.1 (data not shown), and 3.0% (data not shown), respectively, at 20 min when each enzyme was fully activated (Fig. 3). DTT very slowly decreased the dimer content of wild type MST to 7.2% at 20 min and to 4.2% at 12 h (Fig. 3). These facts suggest that an intersubunit disulfide bond can be formed between Cys154 of one subunit and Cys154' of the other subunit, Cys263 and Cys263', or Cys154 and Cys263'; a disulfide bond between Cys263 and Cys263' in C154S MST is less frequently formed, whereas that between Cys154 and Cys154' in C263S MST is more easily formed but is less likely to be reduced than in wild type MST. Thus, an intersubunit disulfide bond would be formed mainly between Cys154 and Cys263 under physiologic conditions.

Attack Mode of Trx to MST—E. coli reduced C32S Trx with or without DTT treatment did not activate MST (Fig. 4). On the other hand, E. coli reduced C35S Trx with or without DTT treatment dose-dependently activated MST to 4.5- and 1.8-fold that of the control, respectively (Fig. 4). HPLC analysis (Fig. 3) indicated that E. coli reduced C32S Trx did not change the dimer content under air-saturated conditions. On the other hand, E. coli reduced C35S Trx decreased both dimer and monomer contents, and the chromatogram was consistent with the estimation that an MST-C35S Trx complex (44.6 kDa, 33.6 min), an MST-2xC35S Trx complex (56.4 kDa, 32.9 min), an MST-3xC35S Trx complex (68.2 kDa, 31.9 min), a 2xMST-C35S Trx complex (77.4 kDa, 31.9 min), a 2xMST-2xC35S Trx complex (89.2 kDa, overlapped), and a 2xMST-3xC35S Trx complex (101 kDa, 30.4 min) were formed (Fig. 5). But each complex cannot be clearly distinguished in this HPLC system. Furthermore, DTT treatment diminished the number of these MST-Trx complexes (covalent intermediates). These findings suggest that Cys32 of Trx attacks an intersubunit disulfide bond and a sulfenyl Cys247 to form Trx-MST complexes (Fig. 5).


Figure 2
View larger version (24K):
[in this window]
[in a new window]

  		FIGURE 2.
Comparative kinetic studies for untreated and activated MSTs by Trx. After 6 µM wild type, C64S, C154S, C254S, C263S, and C153S/C236S, MSTs were incubated with 0 µM ({circ}) or 30 µM (•) (0 µM ({circ}), 3 µM ({blacksquare}), 6 µM ({blacktriangleup}), 12 µM ({blacktriangledown}), or 30 µM (•) for the study on wild type MST) reduced Trx in 10 µl of 20 mM potassium phosphate buffer, pH 7.4, on ice for 20 min, and the rhodanese activity was measured using assay mixture containing 60 mM potassium cyanide and 20, 30, 40, 50, or 60 mM (12.5, 20, 30, 40, 50, or 60 mM for the study on wild type MST) thiosulfate. Data are shown as Lineweaver-Burk plots for wild type and mutant MSTs.

 


Figure 3
View larger version (35K):
[in this window]
[in a new window]

  		FIGURE 3.
HPLC data for untreated and treated wild type MST with Trx. Elution profiles for the wild type MSTs are shown at the top. From the wild type profile ([dimer]:[monomer] = 7.8:92.2) there is an arrow labeled RedTrx 20 min (upper left), which means that after E. coli reduced thioredoxin (1.5 nmol) was added to the wild type MST (0.3 nmol), and the mixture was incubated on ice for 20 min, the elution profile ([dimer]:[monomer] = 1.0:99.0) was obtained. There is another arrow coming from the wild type profile labeled RedC35STrx 20 min (lower right), implying that E. coli reduced C35S Trx instead was added. The arrow points to a seriously altered profile, suggesting formation of MST-thioredoxin adducts. From this graph, there is an arrow pointing downward and labeled DTT 20 min, implying that DTT (1.5 mM) instead was added, and the mixture was incubated in ice for 20 min. That arrow points to a profile indicating the disappearance of the adducts. Another arrow labeled RedC32STrx 20 min (upper right) implies that E. coli reduced C32S Trx instead was added. The profile was not changed. In another experiment, an arrow labeled DTT 12 h (lower left) implies that DTT (1.5 mM) was added, and the mixture was incubated on ice for 12 h. In the middle graph, a calibration curve shows that retention times of standard proteins (thyroglobulin (670 kDa), bovine gamma globulin (158 kDa), chicken ovalbumin (44 kDa), and equine myoglobin (17 kDa)) for the calibration are 22.2, 28.2, 33.3, and 38.3 min, respectively. D indicates a dimer MST (66.6 kDa, 30.9 min); M indicates a monomer MST (32.8 kDa, 32.0 min); T indicates E. coli thioredoxin (11.8 kDa, 40.5 min); Mix indicates mixture of Trx-MST complexes (D, D + T, D + 2T, D + 3T, D + 4T, and M + 2T) (see also Fig. 5). Elution profile for the C154/253S MST containing no dimer is shown at the bottom.

 
A comparative study using rat reduced C34S Trx, in which Cys34 corresponded to Cys35 of E. coli Trx, was performed. Reduced C34S Trx with or without DTT treatment dose-dependently activated MST to 4.9- and 1.7-fold that of the control, respectively.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Rat recombinant wild type MST had a monomer-dimer equilibrium with assistance of cellular redox substances, and the monomer to dimer ratio was ~9 to 1 in 0.2 M potassium phosphate buffer, pH 7.0. On the other hand, rat authentic MST from the liver also had a monomer-dimer equilibrium, with a ratio of ~2 to 1 (17). Some oxidants other than dissolved oxygen in the liver tissue might increase the dimer content. Considering the small ratio of intersubunit disulfide bonds, Trx effectively reduced the bonds to activate MST. The reversibly monomer-dimer equilibrium could increase the dimer content.

Oxidants formed a sulfenate at Cys247 to inhibit MST, and DTT and Trx reduced MST to restore the activity, but glutathione did not affect the MST activity (13). Under air-saturated conditions, after some MSTs containing sulfenyl Cys247 were treated with reduced Trx, DTT did little to activate MST. On the other hand, after treating MST with DTT (Table 3), Trx was further activated by MST via reduction of the intersubunit disulfide bonds. It has been approved that "an intrasubunit disulfide bond" serves as a redox switch for the regulation of protein function (1–9). The present findings that "an intersubunit disulfide bond" serves as a redox switch for enzyme activation is new.


View this table:
[in this window]
[in a new window]

  		TABLE 3
Percentage of free SH groups under air-saturated conditions of wild type and mutant MSTs

 
Although the MST activity was increased by reduced Trx, kcat(app) was increased and Km(app) was decreased with an increase of reduced Trx concentration. This activation did not involve allosteric effects because the activation followed Michaelis-Menten kinetics. DTT also activated MST chiefly via reduction of a sulfenyl Cys247 with an increase in kcat(app) and a decrease in Km(app). This activation also followed Michaelis-Menten kinetics. The reduction of the intersubunit disulfide bond cannot be separately observed because the reduction of a sulfenyl Cys247 by reduced Trx or DTT quickly but simultaneously proceeded. As DTT quickly reduced the sulfenate at Cys247 and extremely slowly reduced the intersubunit disulfide bond, the activation of DTT-treated MST by reduced Trx can be regarded as an apparent single reaction via reduction of the intersubunit disulfide bond.


Figure 4
View larger version (26K):
[in this window]
[in a new window]

  		FIGURE 4.
Contribution of Cys32 of E. coli Trx to the MST activation. Wild type MST (12 µM) was incubated with various concentrations of E. coli reduced C32S Trx (0, 36, 60, and 120 µM)(A) or various concentrations of E. coli reduced S35S Trx (0, 36, 60, 120, and 360 µM)(B) in 10 µl of 20 mM potassium phosphate buffer, pH 7.4, on ice for 30 min, and a 5-µl aliquot with (Figure 4) or without ({square}) 1.2 mM DTT was used for the rhodanese activity. Data are shown as the mean ± S.E. (error bar), (n = 3).

 
Reduced Trx and DTT did not increase C154S, C263S, and C154S/C263S MST activity, and kinetic properties of these MSTs were similar to those of MST, which was activated by reduced Trx. These findings suggest that cleavage of the inter-subunit disulfide bonds could induce the conformational change that is required for MST to become the activated form (Fig. 6). After C154S, C263S, and C154S/C263S MSTs were incubated on ice for 3 days, each activity was decreased via oxidation of each catalytic site Cys247, and DTT and reduced Trx well restored the activity.4 The results indicate that C154S, C263S, and C154S/C263S MSTs structurally resemble an active form of MST.


Figure 5
View larger version (26K):
[in this window]
[in a new window]

  		FIGURE 5.
Formation of various species of MST-E. coli C35S Trx complex. A symmetrical or asymmetrical dimer of MST reacts with E. coli C35S Trx (an arrow labeled C35STrx) to form various species of MST-C35S Trx complex, which are observed in the HPLC profile after treatment of wild type MST with reduced C35S Trx (Fig. 3). When Cys247 of MST is sulfenated, C35S Trx attacks it, and MST-C35S Trx complex is formed via a disulfide bond formation between Cys247 of MST and Cys32 of C35S Trx. This process is not illustrated in this figure, but the number of the Trx adduct is shown. When C36S Trx reacts with an intersubunit disulfide of MST, a new disulfide bond between Cys32 of C35S Trx and Cys154 or Cys236 of MST is formed, resulting in formation of each two heterogeneous monomer MSTs. Each monomer is then oxidized by dissolved oxygen (a dotted arrow) to form new dimers. Only one process is depicted. Furthermore, C35S Trx attacks them. These reactions proceed until C35S Trx is depleted, and the proportion in concentration of various species of the MST-C35S Trx complex differs depending on the proportion in concentration of C35S Trx to that of MST (data not shown). D, a dimer MST; M, a monomer MST. Details are provided in the text.

 


Figure 6
View larger version (25K):
[in this window]
[in a new window]

  		FIGURE 6.
Proposed activation mechanism of MST (an asymmetrical dimer model). Details are provided in the text.

 


Figure 7
View larger version (51K):
[in this window]
[in a new window]

  		FIGURE 7.
Sequence homology of rat MST to rat TRD and E. coli TRD. The sequence around Cys154 or Cys236 of MST (GenBankTM accession number D50564) is highly related or identical to the sequence of rat TRD (R-TRD) (GenBankTM accession number AF108213) and E. coli TRD (E-TRD) (GenBankTM accession number J03762). Helix 10, a proposed Trx binding domain (37). •, related amino acid residue; *, identical amino acid residue; {uparrow}, redox-active cysteine.

 
Cys32 of E. coli Trx reacts with a redox-active cysteine of a protein (28). In this study, Cys32 of E. coli Trx and Cys31 of rat Trx reacted with MST at oxidized Cys154, oxidized Cys263, and sulfenyl Cys247 and various forms of E. coli C35S Trx-MST adducts and rat C34S Trx-MST adducts via a disulfide bond that might be produced in the redox cycle with decrease in contents of monomers and dimers (Figs. 5 and 6). Furthermore, consecutive cleavage of the disulfide bond between E. coli C35S Trx-MST or rat C34S Trx-MST was essential for the enzymatic activation. Thus, MST was activated via cleavage of the covalent intermediate with Trx. E. coli C35S Trx with DTT also activated C154S and C263S MSTs (data not shown). These findings also suggest that monomer-dimer equilibrium in MST is regulated by redox state.

Cys154 of rat MST is a unique cysteine on the surface of the protein, and the corresponding cysteine is lacking in bacteria, E. coli (29), plant, Arabidopsis thaliana (30), and animals: protozoa (Leishmania) (31), bovine (Bos taurus) (BC112580 [GenBank] ), mouse (Mus musculus) (32), and human (Homo sapiens) (33) MSTs. On the other hand, Cys263 is conserved among rat, mouse, bovine, and human. A symmetrical dimer via a disulfide bond between Cys154 and Cys154 is more easily formed in C263S MST, whereas the disulfide bond between Cys263 and Cys263 is much less likely to form in C154S MST than a dimer of wild type MST, probably because the redox potential of Cys263 is higher than that of Cys154 and/or they differ in steric properties. Therefore, MSTs were mixed with symmetrical dimers via an intersubunit disulfide bond between Cys154 and Cys154 and between Cys263 and Cys263, and an asymmetrical dimer via an intersubunit disulfide bond between Cys154 and Cys263. A balance of reduced Trx and dissolved oxygen regulates the monomerdimer equilibrium in this in vitro study. These findings are consistent with the finding that rat recombinant MST had a prominently broad band in a native PAGE.4

Trx also regulates the activity of {alpha}-glucan, water dikinase in a higher plant, and Trxf most effectively affects the enzyme activity via reduction of the intrasubunit disulfide bond among Trxf, Trxmf, and DTT (34). The specificity of Trxf for this enzyme is determined by a consensus sequence "CFATC" contained in the active site. MST does not contain an intrasubunit disulfide bond nor is this consensus sequence essential for Trx binding (35, 36), although sequences around Cys154 and Cys263 of rat MST are related or identical to parts of rat and E. coli TRD sequences (Fig. 7).

In mammalian cells, Trx concentration is 0.01–1.2 µM (37–39). On the assumption that cellular protein content is ~160 mg/ml (40, 41), we estimate intracellular MST concentration based on purification data to be 0.2–3 µM (18, 42); Trx concentration ranges between 1/300- and 5-fold that of MST, and therefore Trx can activate MST. Furthermore, after incubation of 1 µM MST with 1 µM E. coli or rat Trx, 12.5 µM NADPH (within physiological concentration), and 1 µM E. coli or rat TRD (within estimated physiological concentration ranging between 0.9 and 24 µM) (28, 43, 44), the activity was measured. Each activity increased to 2.8- and 1.9-fold that of each control, respectively. The present MST activation model can represent intracellular metabolism, although the other redox-regulating factors should participate in this reaction.

MST serves as an antioxidant protein via the formation of a sulfenate at Cys247, and cellular redox regulates the enzymatic activity (13). Moreover, although the cells are recovering from oxidizing conditions, reduced Trx turns on the redox switch (i.e. Trx cleaves an intersubunit disulfide bond) to activate MST that results from possible conformational changes. The results of this study strongly suggest that MST participates in the maintenance of cellular redox homeostasis.


   FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Dept. of Environmental Medicine, Nippon Medical School, 1-1-5 Sendagi Bunkyo-ku, Tokyo 113-8602, Japan. Tel.: 81-3-3822-2131; Fax: 81-3-5685-3065; E-mail: noriyuki{at}nms.ac.jp.

2 The abbreviations used are: Trx, thioredoxin; DTT, dithiothreitol; MST, mercaptopyruvate sulfurtransferase; TRD, thioredoxin reductase; HPLC, high pressure liquid chromatography. Back

3 Y. Abe, T. Matsumura, K. Okamoto, S. Iwahara, H. Hori, Y. Takahashi, and T. Nishino, submitted for publication. Back

4 N. Nagahara, unpublished data. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Takeshi Nishino (Department of Biochemistry and Molecular Biology, Nippon Medical School) and Dr. Hajime Nakamura (Thioredoxin Project, Department of Experimental Therapeutics, Translational Research Center, Kyoto University) for their helpful suggestions.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Clancey, C. J., and Gilbert, H. F. (1987) J. Biol. Chem. 262, 13545–13549[Abstract/Free Full Text]
  2. Hawkins, H. C., Blackburn, E. C., and Freedman, R. B. (1991) Biochem. J. 275, 349–353
  3. Sasaki, Y., Kozaki, A., and Hatano, M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 11096–11101[Abstract/Free Full Text]
  4. Mora-Garcia, S., Rodriguez-Suarez, R., and Wolosiuk, R. A. (1998) J. Biol. Chem. 273, 16273–16280[Abstract/Free Full Text]
  5. Zheng, M., Aslund, F., and Storz, G. (1998) Science 279, 1718–1721[Abstract/Free Full Text]
  6. Reynolds, C. M., and Poole, L. B. (2001) Biochemistry 40, 3912–3919[CrossRef][Medline] [Order article via Infotrieve]
  7. Buhrman, G., Parker, B., Sohn, J., Rudolph, J., and Mattos, C. (2005) Biochemistry 44, 5307–5316[CrossRef][Medline] [Order article via Infotrieve]
  8. Sevier, C. S., and Kaiser, C. A. (2006) Mol. Biol. Cell. 17, 2256–2266[Abstract/Free Full Text]
  9. Park, C., and Raines, R. T. (2001) Protein Eng. 14, 939–942[Abstract/Free Full Text]
  10. Suzuki, T., Suzuki, J., Mitome, N., Ueno, H., and Yoshida, M. (2000) J. Biol. Chem. 275, 37902–37906[Abstract/Free Full Text]
  11. Nagahara, N., and Nishino, T. (1996) J. Biol. Chem. 271, 27395–27401[Abstract/Free Full Text]
  12. Nagahara, N., Ito, T., and Minami, M. (1999) Histol. Histopathol. 14, 1277–1286[Medline] [Order article via Infotrieve]
  13. Nagahara, N., and Katayama, A. (2005) J. Biol. Chem. 280, 34569–34576[Abstract/Free Full Text]
  14. Taoka, S., Ohja, S., Shan, X., Kruger, W. D., and Banerjee, R. (1998) J. Biol. Chem. 273, 25179–25184[Abstract/Free Full Text]
  15. Mosharov, E., Cranford, M. R., and Banerjee, R. (2000) Biochemistry 39, 13005–13011[CrossRef][Medline] [Order article via Infotrieve]
  16. Chen, Z., Chakraborty, S., Shan, X., Kruger, W. D., and Banerjee, R. (1995) J. Biol. Chem. 270, 19246–19249[Abstract/Free Full Text]
  17. Nagahara, N., and Sawada, N. (2006) Curr. Med. Chem. 13, 1219–1230[CrossRef][Medline] [Order article via Infotrieve]
  18. Nagahara, N., Okazaki, T., and Nishino, T. (1995) J. Biol. Chem. 270, 16230–16235[Abstract/Free Full Text]
  19. Ploegman, J. H., Drent, G., Kalk, K. H., Hol, W. J. G., Heinrikson, R. L., Keim, P., Weng, L., and Russell, J. (1978) Nature 273, 124–129[CrossRef][Medline] [Order article via Infotrieve]
  20. Wang, Y., De Keulenaer, G. W., and Lee, R. T. (2002) J. Biol. Chem. 277, 26496–26500[Abstract/Free Full Text]
  21. Wollman, E. E., d'Auriol, L., Rimsky, L., Shaw, A., Jacquot, J. P., Wingfield, P., Graber, P., Dessarps, F., Robin, P., and Galibert, F. (1988) J. Biol. Chem. 263, 15506–15512[Abstract/Free Full Text]
  22. Powis, G., and Montfort, W. R. (2001) Annu. Rev. Pharmacol. Toxicol. 41, 261–295
  23. Casagrande, S., Bonetto, V., Fratellim, M., Gianazza, E., Eberini, I., Massignan, T., Salmona, M., Chang, G., Holmgren, A., and Ghezzi, P. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 9745–9749[Abstract/Free Full Text]
  24. Musso, R., Di Lauro, R., Rosenberg, M., and de Crombrugghe, B. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 106–110[Abstract/Free Full Text]
  25. Holmgren, A. (1979) J. Biol. Chem., 254, 9627–9632[Abstract/Free Full Text]
  26. Park, E. M., and Thomas, J. A. (1989) Arch. Biochem. Biophys. 272, 25–31[CrossRef][Medline] [Order article via Infotrieve]
  27. Lundstrom, J., and Holmgren, A. (1990) J. Biol. Chem. 265, 9114–9120[Abstract/Free Full Text]
  28. Kallis, G. B., and Holmgren, A. (1980) J. Biol. Chem. 225, 10261–10265
  29. Hama, H., Kayahara, T., Ogawa, W., Tsuda, M., and Tsuchiya, T. (1994) J. Biol. Chem. 115, 1135–1140
  30. Papenbrock, J., and Schmidt, A. (2000) Eur. J. Biochem. 267, 145–154[Medline] [Order article via Infotrieve]
  31. Williams, R. A., Kelly, S. M., Mottram, J. C., and Coombs, G. H. (2003) J. Biol. Chem. 278, 1480–1486[Abstract/Free Full Text]
  32. Strausberg, R. L., Feingold, E. A., Grouse, L. H., Derge, J. G., Klausner, R. D., Collins, F. S., Wagner, L., Shenmen, C. M., Schuler, G. D., Altschul, S. F., Zeeberg, B., Buetow, K. H., Schaefer, C. F., Bhat, N. K., Hopkins, R. F., Jordan, H., Moore, T., Max, S. I., Wang, J., Hsieh, F., Diatchenko, L., Marusina, K., Farmer, A. A., Rubin, G. M., Hong, L., Stapleton, M., Soares, M. B., Bonaldo, M. F., Casavant, T. L., Scheetz, T. E., Brownstein, M. J., Usdin, T. B., Toshiyuki, S., Carninci, P., Prange, C., Raha, S. S., Loquellano, N. A., Peters, G. J., Abramson, R. D., Mullahy, S. J., Bosak, S. A., McEwan, P. J., McKernan, K. J., Malek, J. A., Gunaratne, P. H., Richards, S., Worley, K. C., Hale, S., Garcia, A. M., Gay, L. J., Hulyk, S. W., Villalon, D. K., Muzny, D. M., Sodergren, E. J., Lu, X., Gibbs, R. A., Fahey, J., Helton, E., Ketteman, M., Madan, A., Rodrigues, S., Sanchez, A., Whiting, M., Madan, A., Young, A. C., Shevchenko, Y., Bouffard, G. G., Blakesley, R. W., Touchman, J. W., Green, E. D., Dickson, M. C., Rodriguez, A. C., Grimwood, J., Schmutz, J., Myers, R. M., Butterfield, Y. S., Krzywinski, M. I., Skalska, U., Smailus, D. E., Schnerch, A., Schein, J. E., Jones, S. J., Marra, M. A., and Mammalian Gene Collection Program Team (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 16899–16903[Abstract/Free Full Text]
  33. Pallini, R., Guazzi, G. C., Cannella, C., and Cacace, M. G. (1991) Biochem. Biophys. Res. Commum. 80, 887–893
  34. Mikkelsen, R., Mutenda, K. E., Mant, A., Schurmann, P., and Blennow, A. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 1785–1790[Abstract/Free Full Text]
  35. Waksman, G., Krishna, T. S., Williams, C. H., Jr., and Kuriyan, J. (1994) J. Mol. Biol. 236, 800–816[CrossRef][Medline] [Order article via Infotrieve]
  36. Sandalova, T., Zhong, L., Lindqvist, Y., Holmgren, A., and Schneider, G. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 9533–9538[Abstract/Free Full Text]
  37. Kobayashi, F., Sagawa, N., Nanbu, Y., Kitaoka, Y., Mori, T., Fujii, S., Nakamura, H., Masutani, H., and Yodoi, J. (1995) Hum. Reprod. 10, 1603–1608[Abstract/Free Full Text]
  38. Nakamura, H., De Rosa, S., Roederer, M., Anderson, M. T., Dubs, J. G., Yodoi, J., Holmgren, A., Herzenberg, L. A., and Herzenberg, L. A. (1996) Int. Immunol. 8, 603–611[Abstract/Free Full Text]
  39. Kondo, N., Ishii, Y., Kwon, Y. W., Tanito, M., Horita, H., Nishinaka, Y., Nakamura, H., and Yodoi, J. (2004) J. Immunol. 172, 442–448[Abstract/Free Full Text]
  40. Loewy, A. G., Siekevitz, P., Menninger, J. R., and Gallant, J. (1991) Cell Structure and Function, 3rd Ed., Harcourt College Publishers, Orlando, FL
  41. Guyton, A. C., and Hall, J. E. (2006) Textbook of Medical Physiology, 11th Ed., Elsevier/W. B. Saunders Co., Philadelphia
  42. Nagahara, N., Ito, T., Kitamura, H., and Nishino, T. (1998). Histochem. Cell Biol. 110, 243–250[CrossRef][Medline] [Order article via Infotrieve]
  43. Larsson, A. (1973) Eur. J. Biochem. 35, 346–349[Medline] [Order article via Infotrieve]
  44. Martinez-Galisteo, E., Padilla, C. A., Garcia-Alfonso, C., Lopez-Barea, J., and Barcena, J. A. (1993) Biochimie (Paris) 75, 803–809
  45. Gromer, S., Arscott, L. D., Williams, C. H., Jr., Schirmer, R. H., and Becker, K. (1998) J. Biol. Chem. 273, 20096–20101[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
T. Matsumura, K. Okamoto, S.-i. Iwahara, H. Hori, Y. Takahashi, T. Nishino, and Y. Abe
Dimer-Oligomer Interconversion of Wild-type and Mutant Rat 2-Cys Peroxiredoxin: DISULFIDE FORMATION AT DIMER-DIMER INTERFACES IS NOT ESSENTIAL FOR DECAMERIZATION
J. Biol. Chem., January 4, 2008; 283(1): 284 - 293.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/3/1561    most recent
M605931200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow