Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M703512200 on June 1, 2007

J. Biol. Chem., Vol. 282, Issue 30, 21767-21775, July 27, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/30/21767    most recent
M703512200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krautz-Peterson, G.
Right arrow Articles by Skelly, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krautz-Peterson, G.
Right arrow Articles by Skelly, P. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Amino Acid Transport in Schistosomes

CHARACTERIZATION OF THE PERMEASEHEAVY CHAIN SPRM1hc*

Greice Krautz-Peterson{ddagger}, Simone Camargo§, Katja Huggel§, François Verrey§, Charles B. Shoemaker{ddagger}, and Patrick J. Skelly{ddagger}1

From the {ddagger}Molecular Helminthology Laboratory, Division of Infectious Diseases, Department of Biomedical Sciences, Tufts University, Cummings School of Veterinary Medicine, Grafton, Massachusetts 01536 and the §Institute of Physiology, University of Zürich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland

Received for publication, April 26, 2007 , and in revised form, May 30, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Schistosomes are human parasitic flatworms that constitute an important public health problem globally. Adult parasites live in the bloodstream where they import nutrients such as amino acids across their body surface (the tegument). One amino acid transporter, Schistosome Permease 1 light chain, SPRM1lc, a member of the glycoprotein-associated family of transporters (gpaAT), has been characterized in schistosomes. Only a single member of the SLC3 family of glycoproteins that associate with gpaATs is found following extensive searching of the genomes of Schistosoma mansoni and S. japonicum. In this report, we characterize this schistosome permease heavy chain (SPRM1hc) gene and protein. The 72-kDa gene product is predicted to possess a single transmembrane domain, a (beta{alpha})8 (TIM barrel) conformation and a catalytic triad. Xenopus oocytes functionally expressing SPRM1hc with SPRM1lc import phenylalanine, arginine, lysine, alanine, glutamine, histidine, tryptophan, and leucine. Biochemical characterization demonstrates that in Xenopus extracts and in schistosome extracts SPRM1hc is associated into a high molecular weight complex with SPRM1lc that is disrupted by reducing agents. Quantitative real-time PCR and Western analysis demonstrate that SPRM1hc is expressed in each schistosome life stage examined (eggs, cercariae, schistosomula, adult males and females). SPRM1hc is widely distributed throughout adult male and female worms as determined by immunolocalization. Consistent with the hypothesis that SPRM1hc functions to facilitate nutrient uptake from host blood, immunogold electron microscopy confirms that the protein is distributed on the host-interactive tegumental membranes. We propose that surface-exposed, host-interactive, nutrient-transporting proteins like the SPRM1 heterodimer are promising vaccine candidates.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Schistosomes are parasitic platyhelminths that currently infect several hundred million people globally (1). The World Health Organization estimates that about a billion people are at risk of exposure (2). Schistosomes also infect livestock and cause serious economic hardship in many developing nations. The disease is characterized by the presence of adult worms, or blood flukes, within the portal and mesenteric veins. These worms, living as male/female pairs, can survive for many years during which time the female produces hundreds of eggs per day. The primary pathological consequences of schistosome infection are the host immunological response to these eggs within host tissues (3).

Adult schistosomes, within the vertebrate blood stream, can feed in two ways. First, they can ingest blood through the mouth and into the gut where a battery of enzymes breaks down the material. Second, they can import nutrients directly across their body surface (or tegument) (4–7). The schistosome tegument is an unusual structure, being enclosed by two closely apposed lipid bilayers in the form of a normal plasma membrane overlain by a membrane-like secretion called the membranocalyx (8). Because the tegument lacks lateral membranes, its cytoplasm extends as a continuous unit, or syncytium, around the entire body of the worm (9, 10). The tegumental cytoplasm is connected by numerous, thin cytoplasmic processes to interconnected, cell bodies (or cytons) that lie beneath the peripheral muscle layers; these contain nuclei, endoplasmic reticula, golgi complexes, and mitochondria (9, 11). The import of nutrients across the tegument surface implies the presence of nutrient-transporting proteins (sometimes called permeases) in the tegumental plasma membrane. Such nutrient importing proteins must be exposed to the nutrients in the host blood and, as such, should be available for chemotherapeutic or immunological assault.

Several glucose transporter proteins have been identified in schistosomes (12) and one of these, Schistosome Glucose Transporter 4 (SGTP4), is detected in the host-interactive plasma membrane of intravascular Schistosoma mansoni (13, 14). Schistosomes synthesize a new tegument during invasion of their vertebrate host and SGTP4 is rapidly deposited into the surface of this new structure (14–16). A second glucose transporter (SGTP1) is found in the basal membrane of the tegument where it likely facilitates the distribution of glucose from within the tegument to the internal tissues (17, 18).

A single amino acid transporter (Schistosome Permease 1 light chain, SPRM1lc) has been characterized in schistosomes, which belongs to the glycoprotein-associated family of transporters (gpaAT)2 (19, 20). This ~55-kDa protein is found in both larval and adult schistosomes and in a variety of tissues (20). When expressed within Xenopus oocytes, SPRM1lc promoted amino acid uptake but only when co-expressed with the human glycoprotein, h4F2hc (19). In this context, SPRM1lc facilitated the transport of the basic amino acids arginine, lysine, histidine, as well as leucine, phenylalanine, methionine, and glutamine (19, 20). The h4F2hc protein, acting as a chaperone, was necessary for SPRM1lc to reach the oocyte plasma membrane and function as an amino acid permease. A disulfide bond links h4F2hc and SPRM1lc (21). All characterized heterodimeric amino acid transporters function as obligatory amino acid exchangers (22, 23). Thus the role of SPRM1lc can be viewed as that of equilibrating concentrations of amino acids across the membrane rather than as that of an influx transporter.

Biochemical characterization demonstrates that, in schistosome extracts of all life cycle stages, SPRM1lc is associated into a high molecular weight complex that can be disrupted by reducing agents (20). This is consistent with the hypothesis that a significant fraction of the endogenous SPRM1lc is linked by a disulfide bond to the schistosome h4F2hc homolog. We call this protein the schistosome amino acid permease heavy chain or SPRM1hc. In this report, we clone cDNA encoding SPRM1hc and characterize the protein from this important human parasite.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Parasites—The Puerto Rican strain of S. mansoni was used. Cercariae were obtained from infected Biomphalaria glabrata snails and isolated parasite bodies were prepared as described (24). Parasites were cultured in RPMI medium supplemented with 10 mM HEPES, 2 mM glutamine, 5% fetal calf serum, and antibiotics (100 units/ml penicillin and 100 µg/ml streptomycin) at 37 °C, in an atmosphere of 5% CO2. Adult parasites were recovered by perfusion and parasite eggs were isolated from infected mouse liver tissue as described (25).

Identifying SPRM1hc and SjSPRM1hc—SPRM1lc functionally associates with the human protein h4F2hc when both molecules are expressed in Xenopus oocytes. In this work we set out to identify and characterize the schistosome h4F2hc homolog. Analysis of the S. mansoni transcriptome revealed one EST (designated SmAE 607755.1) with sequence similarity to h4F2hc (26). The EST encoded a partial sequence that lacked an initiator methionine. To most easily uncover the entire schistosome coding sequence, we used the EST data to search the S. mansoni genome assembly (version 3) for genomic clones containing the sequence. One match was found on contig 0011683. A comparison of the extreme 5'-end of the EST with the equivalent region of the genomic contig identified an inframe initiation codon just 15 bases upstream of the EST start. This identification of the 5'-end of the SPRM1hc coding sequence was confirmed by directly sequencing a PCR product obtained from adult parasite cDNA using oligonucleotides (Hc-6: 5'-TGTTCTATTGTCATCTACATTTTGTG-3' and Hc-7: 5'-GTGAGGACAATAAAACCCGCGCC-3'), which span this region. The entire coding DNA was also amplified from adult cDNA using the following oligonucleotides: Hc-2 CGGAACTTTATCTGTTGTAGTACTGA and Hc-5: 5'-CTTGCAAGCGGTTAGTTTGTGTAAAG-3'. All amplified DNA fragments were sequenced at the Tufts University Core Sequencing Facility. The SPRM1hc gene was identified by comparing the complete coding sequence of SPRM1hc with the genomic contig containing this sequence.

To identify homologs of SPRM1hc, the entire coding DNA was analyzed using the Basic Local Alignment Search Tool (BLAST) at the National Center for Biotechnology Information (27). In this way a single close homolog was identified from S. japonicum that was designated SjPRM1hc (GenBankTM accession number AAW26021 [GenBank] .1) but the clone appeared to lack the N-terminal coding region. To identify further potential coding DNA, the S. japonicum genome data base, housed at the Shanghai Center for Life Science and Biotechnology Information, was probed for sequence that extended upstream of the available coding DNA. Several hits were obtained and one (TISJA01484276) was used to identify the likely 5'-coding sequence for SjPRM1hc. The following oligonucleotides were used with S. japonicum cDNA to amplify by PCR two overlapping fragments comprising the entire potential SjPRM1hc coding sequence: SjPRMhcfor1, 5'-CTATCATTTACATTTTGCAAGCGG-3' with SjPRMhcrev1, 5'-GCATCCACCGCTAATAATTTTGG-3', and SjPRMhcfor2, 5'-GGTCGTCCGAAAAATAAGAAAGG-3' with SjPRMhcrev2, 5'-CACACAGAAGCGTAAATTTCAGC-3'. Both PCR fragments were purified and sequenced. Comparisons between SPRM1hc and related permease heavy chain sequences were undertaken using the UPGMA best tree building method, with gaps distributed proportionally, using DS Gene software (Accelrys Inc.).

Functional Expression of SPRM1hc in Xenopus laevis Oocytes—To express SPRM1hc in Xenopus oocytes, the entire SPRM1hc coding DNA was first amplified by PCR using adult parasite cDNA and oligonucleotides, Hc-XO1 (5'-CGCCTCGAGATGAGTTCGAGCGGTACCAATGG-3') and Hc-XO2 (5'-CGCGGATCCTCATTCACATTTGAAAACATATATCATAG-3'), using conditions as described (12). Underlined sequences denote restriction sites; XhoI for Hc-XO1 and BamHI for Hc-XO2. Next, the PCR product was gel-purified, digested with XhoI and BamHI and ligated into the similarly digested Xenopus expression plasmid, pSDeasy. TOP10 cells were transformed with the ligation mixture and recombinant transformants were selected on agar plates containing 100 µg/ml ampicillin. Plasmid was purified from several clones and the cloned inserts were sequenced. One plasmid, pNAA009, was linearized by digestion with PstI and cRNA was synthesized in vitro, as earlier described (19). Tritiated amino acids were used in uptake experiments involving X. laevis oocytes, as previously detailed (22). Background uptake was determined using oocytes expressing only the corresponding heavy chain (SPRM1hc or h4F2hc), and this value was subtracted to generate the data shown. The results are expressed as mean ± S.E. (pmol/oocyte/h) of 13–42 oocytes from 2 to 6 independent experiments. Statistical comparison of means was carried out using one way analysis of variance and Tuckey as post-test when p < 0.05.

L-Arginine was selected to monitor the concentration dependence of substrate transport in oocytes expressing SPRM1lc together with either SPRM1hc or h4F2hc. For this study, oocytes were injected with 1 ng of each cRNA and evaluated, as above, for L-Arg transport (at 0.1, 1, 10, 100, and 1000 µM) after 24 h, in uptake buffer containing Na+.

Biosynthetic Labeling of Oocyte Proteins and Immunoprecipitation—Non-injected or cRNA-injected oocytes were incubated in ND96 supplemented with 1 mCi·ml–1 [35S]methionine for 48 h at 16 °C. Oocytes were then washed twice with ND96 and lysed in a buffer containing 50 mM Tris/HCl, pH 8.0, 120 mM NaCl, 0.5% Nonidet P-40; and protease inhibitors. Extracts were vortexed and centrifuged for 10 min at 12,000 rpm at 4 °C. The supernatant was separated from the pelleted yolk granules and stored at –70 °C. Aliquots of 2 x 106 cpm were rotated for 16 h at 4 °C with 1 µg of anti-SPRM1lc antibody (21) prebound to protein G/protein A-agarose. The beads were washed five times with 20 mM Tris/HCl, pH 8.0; 100 mM NaCl, 1 mM EDTA, 500 mM LiCl, 0.5% Nonidet P-40; and five times with 20 mM Tris/HCl, pH 8.0; 100 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40. The resulting immunoprecipitates were heated in SDS-sample buffer (with or without reducing agent (beta-mercaptoethanol)) for 3 min at 95 °C.

Anti-SPRM1hc Antibody Production—The following peptide comprising SPRM1hc amino acid residues 615–633 was synthesized: NH2-IDQPVGSQRVYLKSDGQPM-COOH by Genemed Synthesis, Inc. San Francisco. This sequence is indicated in bold script in Fig. 1B. A cysteine residue was added at the amino terminus to facilitate conjugation of the peptide to bovine serum albumin (BSA). Approximately 500 µgofthe peptide-BSA conjugate in Freund's Complete Adjuvant was used to immunize two New Zealand White rabbits subcutaneously. The rabbits were boosted with 100 µg of peptide alone in Incomplete Freund's Adjuvant 20, 40, and 60 days later. Ten days following this, serum was recovered from both rabbits, pooled and anti-SPRM1hc antibodies were affinity-purified using a peptide-ovalbumin conjugate and dialyzed against phosphate-buffered saline, as previously described (15).

Membrane Preparation and Gel Electrophoresis—Membrane preparations from different parasite life stages were prepared, aliquots from each preparation were resolved by 4–15% gradient SDS-PAGE. One gel was stained with Coomassie Blue and an equivalent gel and blotted to polyvinylidene difluoride membrane, as previously outlined (15). Blots were probed with purified anti-SPRM1hc antibodies (1 mg/ml) at 1:300 dilution and bound antibody was detected using a horseradish peroxidase-labeled anti-rabbit IgG (1:5000, Amersham Biosciences) and the TMB Membrane Peroxidase system from Kirkegaard and Perry Laboratories Inc, following the manufacturer's instructions. Blot images were captured using a Kodak Image Station 2000RT.

Immunolocalization—Immunofluorescent detection of SPRM1hc in 7-µm thick, cold acetone fixed, adult worm sections was carried out using affinity-purified, rabbit anti-SPRM1hc antiserum and fluorescein-conjugated goat anti-rabbit IgG (Sigma), essentially as described earlier (28).

Immunogold Labeling and Electron Microscopy—Freshly perfused adult parasites were fixed overnight with 2% glutaraldehyde in 0.1 M cacodylate buffer at 4 °C. The samples were then dehydrated in a graded series of ethanol, then infiltrated and embedded in L. R. White acrylic resin. Ultramicrotomy was performed using a Leica Ultracut R ultramicrotome and the sections collected on gold grids. Grids were immunolabeled in a two step method according to the following procedure; the grids were conditioned in PBS for 5 min x3 at room temperature, followed by the blocking of nonspecific labeling for 30 min at room temperature using 5% nonfat dry milk in PBS. After rinsing, the grids were exposed to the primary antibodies diluted 1:30 for 1 h at room temperature, followed by washing in PBS and then incubated with the secondary antibodies diluted 1:30 (10 nm gold-labeled goat anti-rabbit IgG (H&L, Amersham Biosciences) for 1 h at room temperature, and finally rinsed thoroughly in water. The grids were exposed to osmium vapor and/or lightly stained with lead citrate to improve contrast and were examined and photographed using a Philips CM 10 electron microscope at 80 KV.

Developmental Expression of SPRM1hc by qRT-PCR—Relative SPRM1hc gene expression across different life cycle stages of S. mansoni was measured by TaqMan Gene Expression Assay (Applied Biosystems). The following life cycle stages were examined: eggs, cercariae, schistosomula, and adult males and females. The schistosomula were obtained after culture for 15 days in RPMI medium supplemented with 10 mM Hepes, 2 mM glutamine, 5% fetal calf serum and antibiotics (100 units/ml penicillin and 100 µg/ml streptomycin) at 37 °C, in an atmosphere of 5% CO2. First, total RNA was extracted from all parasites using the TRIzol method (Invitrogen), following the manufacturer's instructions. Next, 1 µg of total RNA, pre-treated with TurboDNase (Ambion, TX), was reverse-transcribed to cDNA using random hexamers and Superscript reverse transcriptase (Invitrogen). qRT-PCR was performed using cDNA derived from 50 ng of total RNA and primer sets/reporter probes labeled with 6-carboxyfluorescein (FAM), custom synthesized by Applied Biosystems (Foster City, CA). For SPRM1hc the following primers and probe were used: SPRM1HC3PM-HCP3F, 5'-GCTTTGGCTTCCACGTTTCTG-3' and SPRM1HC3PM-HCP3R, 5'-CGTTTCCTCATTTAACTCCGAACCA-3' with the FAM-labeled probe, SPRM1HC3PM-HCP3M1, 5'-FAM-CTTCCAGGCACTTCTC-3'; for the endogenous control S. mansoni triosephosphate isomerase (SmTPI) gene the following primers and probe were used: SMTPI-TPI3F, 5'-CATACTTGGACATTCTGAGCGTAGA-3' and SMTPI-TPI3R, 5'-ACCTTCAGCAAGTGCATGTTGA-3' with the FAM-labeled probe, SMTPI-TPI3M2, 5'-FAM-CAATAAGTTCATCAGATTCAC-3'. Probe positions were designed to span exon/exon boundaries to minimize detection of any contaminating genomic DNA. All samples were run in triplicate and underwent 45 amplification cycles on a 7500 ABI PRISM® Sequence Detection System Instrument. For relative quantification, the {Delta}{Delta}Ct method was employed (29).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
The SPRM1hc Gene and cDNA—Prior studies showed that the schistosome permease SPRM1lc is a member of the glycoprotein associated family of amino acid transporters (gpaATs) and requires association with a heavy chain glycoprotein belonging to the SLC3 family to function in Xenopus oocytes. The ESTs and the nearly complete genomes of S. mansoni and S. japonicum were extensively searched for homologs of h4F2hc or rBAT, representing the two classes of the SLC3 family of glycoproteins known to associate with gpaATs. Only a single putative SLC3 family member was identified that we named SPRM1hc (schistosome permease 1 heavy chain). A complete cDNA encoding SPRM1hc was obtained from adult schistosome mRNA by RT-PCR, which permitted characterization of the gene structure. A map of the SPRM1hc gene is shown in Fig. 1A. The gene is 6.56 kb, only one-third of which is coding sequence and possesses 9 introns and 10 exons. The first 6 introns are small (32–42 bp); the remaining 3 vary from 1.02 to 1.95 kb. All introns possess conventional GT:AG intron donor: acceptor sites and are composed of ~65% A+T residues (range 60–75%). Exon size varies from 120–370 bp with ~58% AT (range 54–63%). Searching schistosome genome and EST databases for additional homologs of SPRM1hc was unsuccessful. The GenBankTM accession number of the S. mansoni SPRM1hc cDNA reported here is EF204542.


Figure 1
View larger version (97K):
[in this window]
[in a new window]

  		FIGURE 1.
The SPRM1hc gene and predicted protein. A, diagrammatic representation of the SPRM1hc gene. Open rectangles, numbered 1–10, represent exons. The position of a poly(A) addition site is indicated (right). K represents kilobase pairs. B, alignment of SPRM1hc predicted amino acid sequence with homologs. GenBankTM accession numbers of these proteins are: SPRM1hc, EF204542; SjPRMhc, EF204543; rBAT (human), AAH93626; h4F2hc (human), NP 001013269; Ce BAT (or ATG1, C. elegans) CAB02316. Identical residues are indicated by shading. TM indicates the predicted transmembrane domain. beta1–8 and {alpha}1–8 indicate domains comprising the TIM barrel. The arrowhead indicates a conserved cysteine that is postulated to be involved in SPRM1hc cross-linking to its light chain partner (SPRM1lc). Arrows at position Asp278, Glu332, and Asp408 highlight residues that may comprise a catalytic triad. The C-terminal peptide indicated in bold (615IDQPVGSQRVYLKSDGQPM633) was synthesized and used to generate anti-SPRM1hc antibodies.

 


Figure 2
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 2.
Membrane topology model of the SPRM1hc/SPRM1lc heterodimer. The gray barrel represents the single predicted transmembrane domain of SPRM1hc. Potential N-glycosylation sites are indicated by forks. The putative transmembrane domains of SPRM1lc are numbered 1–12. The putative cysteine residues involved in disulfide linkage are circled. OUT indicates the exterior of the cell; IN interior.

 
The predicted SPRM1hc protein is 640 amino acids long, with a molecular weight of 71,645 daltons and a pI of 5.05. A comparison of the SPRM1hc protein with homologs from other species is shown in Fig. 1B. The complete coding DNA of the homolog from S. japonicum was determined (and designated SjPRM1hc, GenBankTM accession number EF204543) and, relative to an earlier S. japonicum data base entry (GenBankTM accession number AAW26021 [GenBank] .1), revealed several polymorphisms or sequencing errors (not shown). SmPRM1hc nucleotide and protein sequences are 80 and 79% identical to SjPRM1hc respectively. Not surprisingly, considerably lower sequence similarity is evident between the SPRM1hc protein and homologs from other organisms e.g. humans or Caenorhabditis elegans (all ~20%). GenBankTM accession numbers of the related permease heavy chain sequences compared in this work are as follows: rBAT, AAH93626 [GenBank] ; h4F2hc, NP 001013269; Ce BAT (ATG1) CAB02316 [GenBank] .

All of these heavy chain proteins are predicted to possess a single transmembrane (TM) domain. In addition, the schistosome proteins are also predicted to display what is called a TIM barrel (because the domain was first identified in triosephosphate isomerase enzymes). TIM barrels assume a (beta{alpha})8 conformation. The positions of the {alpha}-helices and beta-sheet motifs within the TIM domain of SPRM1hc shown in Fig. 1B were predicted by Network Protein Sequence Analysis (30). Both schistosome proteins also possess a potential catalytic triad (at position Asp278, Glu332, and Asp408, arrows Fig. 2). A conserved cysteine residue (Cys89, arrowhead, Fig. 1B) is predicted to cross-link this protein with its light chain partner (SPRM1lc) in the plasma membrane, as was demonstrated for the human transporter (21). A membrane topology model of the complexed heterodimeric amino acid transporter SPRM1hc with SPRM1lc (collectively called SPRM1), is shown in Fig. 2. This model of the SPRM1hc/SPRM1lc heterodimer is based on the 12-transmembrane domain topology proposed by TMpred analysis for SPRM1lc (19) and on the fact that the extracellular cysteine residue involved in the disulfide bridge with the 4F2hc heterologous heavy chain is located in the loop between predicted transmembrane helices 3 and 4 (21).

Expression and Functional Characterization of SPRM1hc in Xenopus Oocytes—Amino acid uptake characteristics were studied in Xenopus oocytes expressing SPRM1lc in combination with either SPRM1hc or the human homolog h4F2hc (Fig. 3A). It is clear that oocytes injected with RNA encoding SPRM1hc, together with RNA encoding its schistosome light chain partner (SPRM1lc), import several amino acids, most notably phenylalanine, arginine, and lysine. The amino acids alanine, glutamine, histidine, tryptophan, and leucine are also transported (Fig. 3A). No major differences were observed between transport rates measured in the presence (+, Fig. 3A) or absence (–, Fig. 3A) of Na+. It is not clear whether the small differences in the pattern of amino acid uptake observed when SPRM1hc is replaced in the assay with h4F2hc are biologically relevant (Fig. 3A). Injected alone, RNA encoding neither SPRM1hc nor SPRM1lc nor h4F2hc promotes increased amino acid uptake when compared with control, uninjected oocytes.

Fig. 3B shows that the concentration dependence of L-Arg transport is similar for oocytes expressing SPRM1hc + SPRM1lc as for those expressing h4F2hc + SPRM1lc. The bars represent the means ± S.E. from three independent experiments (n = 24 oocytes). The K0.5 for SPRM1hc/SPRM1lc is 82 ± 32 µM and for h4F2/SPRM1lc is 51.4 ± 19 µM.

Immunoprecipitation experiments using anti-SPRM1lc antibodies were undertaken to determine whether the SPRM1hc protein was complexed with SPRM1lc in Xenopus oocytes, as hypothesized. Oocytes were injected with cRNAs, incubated with [35S]methionine, and immunoprecipitates were resolved by SDS-PAGE. A representative autoradiograph result is shown in Fig. 3C. In oocytes injected with heavy and light chain cRNAs, both SPRM1lc (arrowhead, lc) and SPRM1hc (arrowhead, hc) can be detected under reducing conditions (+, lane 4, Fig. 3C), following immunoprecipitation with anti-SPRM1lc antibodies. When this immunoprecipitate is resolved in the absence of reducing agent (–), the high molecular weight SPRM1hc/SPRM1lc complex is detected (arrow, lc/hc, lane 8). This demonstrates that the proteins form reduction-sensitive heterodimers.

Developmental Expression of SPRM1hc—Membrane extracts of several schistosome life cycle stages were resolved by SDS-PAGE and the gel was stained using Coomassie Blue (Fig. 4A, left panel). An equivalent gel was subjected to Western blotting analysis using affinity purified anti-SPRM1hc antibodies and results are shown in Fig. 4A, right panel. One prominent band (arrow, Fig. 4A), running at near the predicted size of SPRM1hc, is detected in all of the life stages examined, namely; eggs, cercariae, schistosomula, and adult male and female worms, when extracts are resolved in the presence of reducing agent. The mixed sex adult membrane preparation (Fig. 4A, left-most lanes) was resolved either in the presence (+) or absence (–) of reducing agent, dithiothreitol. In the absence of this reagent, the protein has reduced mobility (>100 kDa, arrowhead) presumably representing both SPRM1 components, SPRM1hc complexed with SPRM1lc. Anti-SPRM1lc antibodies recognize a moiety of the same size in membrane extracts resolved without dithiothreitol (20). In some preparations an additional, unidentified faint band, running at ~90 kDa, can be detected.


Figure 3
View larger version (40K):
[in this window]
[in a new window]

  		FIGURE 3.
Functional characterization of SPRM1hc expressed in X. laevis oocytes. A, comparison of amino acid transport selectivity of SPRM1hc/SPRM1lc versus SPRM1hc/h4F2hc. L-Amino acid transport (mean ± S.E.) was determined in the presence (+) or absence (–) of Na+. *, p < 0.05; and ***, p < 0.001. B, concentration dependence of L-Arg transport in oocytes expressing SPRM1hc/SPRM1lc versus SPRM1hc/h4F2hc. Bars represent the mean ± S.E. from three independent experiments (n = 24 oocytes). C, immunoprecipitation of SPRM1hc/SPRM1lc. Oocytes were injected with cRNA (as indicated) and labeled with [35S]methionine. Immunoprecipitates, obtained using anti-SPRM1lc antibodies, were resolved by SDS-PAGE in the presence (+) or absence (–) of reducing agent and subjected to autoradiography. Arrowheads indicate the positions of SPRM1hc (hc) or SPRM1lc (lc). The arrow indicates the SPRM1hc/SPRM1lc (hc/lc) heterodimer.

 
Developmental expression of SPRM1hc was also measured at the mRNA level by qRT-PCR and these data are shown in Fig. 4B. Of the various life stages tested, the relative expression of SPRM1hc is low only in cercariae, perhaps reflecting the fact that this life stage does not import nutrients from the environment. Relative expression is high in schistosomula and remains high in adult males and females. Eggs also have a comparatively high expression of SPRM1hc, which may indicate that miracidia within the eggs continue to import amino acids, even as they traverse host tissues while exiting the host.

Localization of SPRM1hc in Adult Tissues—SPRM1hc is widely distributed throughout adult male and female worms as determined by immunolocalization (Fig. 5A). Parasite muscle and parenchymal tissue stain clearly with anti-SPRM1hc antibodies. Fig. 5B shows a higher magnification image of the periphery of an adult male section where the exterior of the tegument (t) shows clear staining (arrow). Localization of SPRM1hc by immunogold electron microscopy (Fig. 5C) confirms that the protein is distributed on the host-interactive tegumental membranes. Arrowheads in Fig. 5C point to some of the tegumental immunogold particles. Parasites treated with secondary antiserum alone demonstrate no tissue staining (data not shown). A recent proteomic survey has been completed that identified schistosome proteins which are available for biotinylation on living adult worms (38). SPRM1hc was one of the few proteins identified in the study, confirming our localization of this protein at the host-interactive surface of schistosomes.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
S. mansoni adults are parasitic worms that live in the mesenteric venules of their vertebrate hosts. Whereas the parasites possess a mouth and a gut, many nutrients such as glucose and amino acids can be imported directly across their body surface (or tegument) from the host blood stream (4–6). Nutrient uptake into the tegument must be facilitated by specific membrane transporter proteins located in the tegumental membranes. For instance, the apical tegument glucose transporter protein SGTP4 probably facilitates glucose uptake from the vasculature into the parasites (14, 15). Similarly, the uptake of at least some amino acids into these parasites is likely mediated by the amino acid permease SPRM1lc in the tegumental membranes (19, 20). Previous work showed that in Xenopus oocytes, SPRM1lc does not mediate amino acid uptake unless the protein is chaperoned to the plasma membrane by a heavy chain partner protein (19). The human protein h4F2hc can act as this partner to functionally associate with SPRM1hc; this demonstrates a high level of evolutionary conservation for this interaction. In this work, we cloned and characterized the endogenous schistosome heavy chain partner which we designate SPRM1hc (Schistosome Permease 1 heavy chain).


Figure 4
View larger version (67K):
[in this window]
[in a new window]

  		FIGURE 4.
Developmental expression of SPRM1hc. A, SPRM1hc protein expression determined by Western analysis. Membrane preparations from different parasite life stages (E, egg; C, cercariae; S, 24 h cultured schistosomula; female, adult female (7-week-old); male, adult male (7-week-old) were resolved by SDS-PAGE under reducing conditions; Adult, mixed populations of both males and females, prepared in the presence (+) or absence (–) of reducing agent were resolved by SDS-PAGE. The left panel shows a Coomassie Blue-stained gel, and the right panel shows a Western blot of an equivalent gel probed with anti-SPRM1hc antibodies. The arrow indicates the position of SPRM1hc, the arrowhead indicates the position of a higher molecular weight complex (likely SPRM1hc/SPRM1lc) seen when reducing agent is omitted. M, molecular mass markers, numbers represent kDa. B, SPRM1hc gene expression determined by qRT-PCR. The following developmental stages were examined: egg, cercariae, schistosomula (15-day cultured), adult males (7-week-old), and adult females (7-week-old). The relative expression level in adult males was arbitrarily set at 100.

 
Transcriptome analysis of S. mansoni revealed just one EST with strong sequence similarity to members of the amino acid transporter heavy chain family (26), and this was designated SPRM1hc. By comparing this expressed sequence with the available S. mansoni genome assembly a complete coding sequence for SPRM1hc was identified. The putative protein encoded by the sequence is 640 amino acids long and displays a domain structure that is conserved among members of the heterodimeric amino acid transporter (HAT) family (31). In particular, much of the protein (encompassing residues 103–445) is predicted to assume a (beta{alpha})8 conformation (otherwise known as a TIM barrel) and this has been described most prominently in members of the {alpha}-amylase enzyme family (32–34). However, unlike vertebrate transporter heavy chain proteins, like h4F2hc and rBAT, SPRM1hc appears to possess a catalytic triad that is conserved in amylase proteins. This suggests that SPRM1hc may possess some enzymatic activity in addition to its role in facilitating amino acid transport. The functional significance of the hydrolase-like extracellular domain structure of SPRM1hc remains elusive as do the equivalent domains of the corresponding mammalian heteromeric amino acid transporter heavy chains 4F2hc and rBAT, even though the three-dimensional structure of the 4F2hc extracellular domain has been solved (35).


Figure 5
View larger version (146K):
[in this window]
[in a new window]

  		FIGURE 5.
Immunolocalization of SPRM1hc in adult parasites. A, cross section through a male/female couple showing widespread staining with anti-SPRM1hc antibodies. B, higher magnification image of the peripheral tissue of an adult male (t, tegument; m, muscle). The arrow indicates the outer tegumental membrane. C, electron micrograph of the adult tegument showing immunogold labeling of SPRM1hc. Arrowheads indicate gold particles at the host/parasite interface. Numbers above scale bars represent microns.

 
In this study we show that SPRM1hc cross-links with SPRM1lc when both are expressed in Xenopus oocytes and that this association can be disrupted by reducing agents. Similarly, in schistosome extracts, SPRM1hc is associated into a high molecular weight complex that can be disrupted by reducing agents. Further, it has previously been shown that SPRMlc likewise exists as a molecular weight complex of the same size that is also disrupted under reducing conditions (20). These data compellingly suggest that a significant fraction of the endogenous SPRM1hc is linked by a disulfide bond to SPRM1lc. A conserved cysteine residue (Cys89, arrowhead, Fig. 1B) is predicted to cross-link this protein with SPRM1lc in the plasma membrane.

The SPRM1hc/SPRM1lc heterodimer is termed simply SPRM1. We show here that in oocytes expressing SPRM1 the basic amino acids histidine, arginine, and lysine are all imported in significantly greater amounts than controls. In addition, transport of leucine, phenylalanine, methionine, glutamine, and tryptophan is enhanced. This pattern of amino acid uptake by SPRM1 into oocytes is similar to that reported for oocytes expressing SPRM1lc with h4F2hc (19). Minor differences in the rate of uptake of some amino acids were observed, which suggests that the heavy chain protein may exert some small influence on the specificity of amino acid import.

The concentration dependence of L-Arg transport is similar for oocytes expressing SPRM1hc + SPRM1lc as for those expressing h4F2hc + SPRM1lc. This demonstrates that kinetically the transport of L-Arg is essentially identical whether SPRM1lc acts in concert with h4F2hc or with SPRM1hc and suggests that heavy chain influence is minor and that it is the light chain partner that is most responsible for the uptake characteristics of the heterodimer.

In view of the fact that all heterodimeric amino acid transporters appear to function as obligatory amino acid exchangers, it is likely that the schistosome heterodimeric transporter SPRM1 also functions in this manner. In this scenario, another, as yet unidentified, transporter would likely directionally import some of the SPRM1 amino acid substrates into the tegumental cytoplasm. SPRM1 would then exchange these molecules, to permit the import of its other amino acid substrates.

To investigate the importance of SPRM1hc in parasite development, attempts were made to silence the expression of the gene using RNAi. Using conditions that resulted in the potent suppression of other schistosome genes, the consistent and significant suppression of SPRM1hc was not observed in this study (36). Our inability to suppress SPRM1hc may reflect differences in the stability or accessibility of its mRNA to the cellular machinery of suppression, as seen in other systems (37).

SPRM1hc is detected in all life stages examined and this is consistent with its role in amino acid uptake into cells, an important function that would likely be required by all parasites. In order for SPRM1 to import amino acids across the body surface of intravascular schistosomes, the complex must exist in the tegumental membranes. Previously, we showed that SPRM1lc can be detected in many adult tissues including the tegument (20). SPRM1hc is likewise widely expressed in the adult parasites and electron microscopy demonstrates that the protein localizes in the tegumental membranes, including at the host/parasite interface. This surface localization of SPRM1hc has been confirmed by other researchers using proteomics to identify the entire protein composition of the tegumental membranes (38, 39). In tegumental extracts, SPRM1hc is detected by proteomics only in the membrane fraction (39).

The heavy chain subunits of vertebrate heterodimeric amino acid transporter proteins, SLC3 glycoproteins, comprise two related families one exemplified by h4F2hc and the other by rBAT (32). Schistosomes are members of the phylum Platyhelminthes, the earliest branch of the Bilateria. Genome and transcriptome analysis indicates that a single heavy chain heterodimeric amino acid transporter family (represented by SPRM1hc) exists in these parasites. Thus SPRM1hc represents the most primordial member of the SLC3 family of glycoproteins that has been identified to date. While SPRM1hc has only about 20% of its amino acids conserved with h4F2hc or rBAT, remarkably, it can be functionally interchanged effectively with h4F2hc when dimerized with SPRM1lc. Clearly the functional role of this protein family is highly conserved across vast evolutionary distances.

Earlier work implicated the presence of at least 5 different amino acid uptake systems in adult male schistosomes (5). SPRM1 is a functional amino acid transporting heterodimer that exhibits transport characteristics akin to one of the described systems and is localized in the host-exposed tegumental membrane. This makes it most likely that SPRM1 represents the molecular basis for one of these amino acid transport systems. This surface localization of SPRM1, a complex that is likely providing an essential function (amino acid uptake) for the parasites, suggests that it will make a viable target for immunological intervention. Further, the low level of overall sequence similarity between SPRM1hc and human homologs suggests that targeting this molecule as a vaccine would not likely elicit a deleterious, autoimmune response.


   FOOTNOTES
 
* This work was funded by NIAID, National Institutes of Health Grant AI-056273. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: 200 Westboro Rd., Grafton, MA 01536. Tel.: 508-887-4348; Fax: 508-839-7911; E-mail: Patrick.Skelly{at}Tufts.edu.

2 The abbreviations used are: gpaAT, glycoprotein-associated family of transporters; EST, expressed sequence tag; PBS, phosphate-buffered saline; TM, transmembrane; FAM, 6-carboxylfluorescein; SPRM1, schistosome permease 1; hc, heavy chain; lc, light chain. Back


   ACKNOWLEDGMENTS
 
We thank Dr. L. I. Rong (Shanghai Centre for Bioinformatics Technology) for access to the S. japonicum genome sequence and Dr. Fred Lewis (Biomedical Research Institute) and Dr. Alex Loukas (Queensland Institute of Medical Research) for providing S. japonicum worms and cDNA. We thank David Ndegwa for technical assistance and John Nunneri for performing immunoelectron microscopy. Schistosome-infected snails were provided by the Biomedical Research Institute through NIAID, National Institutes of Health Contract N01-AI-30026.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Chitsulo, L., Engels, D., Montresor, A., and Savioli, L. (2000) Acta. Trop. 77, 41–51[CrossRef][Medline] [Order article via Infotrieve]
  2. Bergquist, R., Al-Sherbiny, M., Barakat, R., and Olds, R. (2002) Acta. Trop. 82, 183–192[CrossRef][Medline] [Order article via Infotrieve]
  3. Warren, K. S. (1982) Immunol. Rev. 61, 189–213[CrossRef][Medline] [Order article via Infotrieve]
  4. Fripp, P. J. (1967) Comp. Biochem. Physiol. 23, 893–898[Medline] [Order article via Infotrieve]
  5. Asch, H. L., and Read, C. P. (1975) Exp. Parasitol. 38, 123–135[CrossRef][Medline] [Order article via Infotrieve]
  6. Asch, H. L., and Read, C. P. (1975) J. Parasitol. 61, 378–379[CrossRef][Medline] [Order article via Infotrieve]
  7. Pappas, P. W. (1975) Exp. Parasitol. 37, 469–530[CrossRef][Medline] [Order article via Infotrieve]
  8. Wilson, R. A., and Barnes, P. E. (1974) Parasitology 68, 239–258[Medline] [Order article via Infotrieve]
  9. Morris, G. P., and Threadgold, L. T. (1968) J. Parasitol 54, 15–27[CrossRef][Medline] [Order article via Infotrieve]
  10. Smith, J. H., Reynolds, E. S., and Von Lichtenberg, F. (1969) Am. J. Trop. Med. Hyg. 18, 28–49[Abstract/Free Full Text]
  11. Silk, M. H., Spence, I. M., and Gear, J. H. (1969) S. Afr. J. Med. Sci. 34, 1–10[Medline] [Order article via Infotrieve]
  12. Skelly, P., Cunningham, J., Kim, J., and Shoemaker, C. (1994) J. Biol. Chem. 269, 4247–4253[Abstract/Free Full Text]
  13. Jiang, J., Skelly, P. J., Shoemaker, C. B., and Caulfield, J. P. (1996) Exp. Parasitol. 82, 201–210[CrossRef][Medline] [Order article via Infotrieve]
  14. Skelly, P. J., and Shoemaker, C. B. (2001) Parasitology 122, 67–73
  15. Skelly, P. J., and Shoemaker, C. B. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 3642–3646[Abstract/Free Full Text]
  16. Skelly, P. J., and Shoemaker, C. B. (2000) Int. J. Parasitol. 30, 625–631[CrossRef][Medline] [Order article via Infotrieve]
  17. Zhong, C., Skelly, P. J., Leaffer, D., Cohn, R. G., Caulfield, J. P., and Shoemaker, C. B. (1995) Parasitology 110, 383–394
  18. Skelly, P. J., Tielens, A. G. M., and Shoemaker, C. B. (1998) Parasitol. Today 14, 402–406[CrossRef][Medline] [Order article via Infotrieve]
  19. Mastroberardino, L., Spindler, B., Pfeiffer, R., Skelly, P. J., Loffing, J., Shoemaker, C. B., and Verrey, F. (1998) Nature 395, 288–291[CrossRef][Medline] [Order article via Infotrieve]
  20. Skelly, P. J., Pfeiffer, R., Verrey, F., and Shoemaker, C. B. (1999) Parasitology 119, 569–576
  21. Pfeiffer, R., Spindler, B., Loffing, J., Skelly, P. J., Shoemaker, C. B., and Verrey, F. (1998) FEBS Lett. 439, 157–162[CrossRef][Medline] [Order article via Infotrieve]
  22. Meier, C., Ristic, Z., Klauser, S., and Verrey, F. (2002) EMBO J. 21, 580–589[CrossRef][Medline] [Order article via Infotrieve]
  23. Verrey, F. (2003) Pflugers Arch 445, 529–533[CrossRef][Medline] [Order article via Infotrieve]
  24. Skelly, P. J., Da'dara, A., and Harn, D. A. (2003) Int. J. Parasitol. 33, 363–369[CrossRef][Medline] [Order article via Infotrieve]
  25. Hackett, F. (1993) in Protocols in Molecular Parasitology (Hyde, J. E., ed) Vol. 21, pp. 89–99, Humana Press[CrossRef]
  26. Verjovski-Almeida, S., DeMarco, R., Martins, E. A., Guimaraes, P. E., Ojopi, E. P., Paquola, A. C., Piazza, J. P., Nishiyama, M. Y., Jr., Kitajima, J. P., Adamson, R. E., Ashton, P. D., Bonaldo, M. F., Coulson, P. S., Dillon, G. P., Farias, L. P., Gregorio, S. P., Ho, P. L., Leite, R. A., Malaquias, L. C., Marques, R. C., Miyasato, P. A., Nascimento, A. L., Ohlweiler, F. P., Reis, E. M., Ribeiro, M. A., Sa, R. G., Stukart, G. C., Soares, M. B., Gargioni, C., Kawano, T., Rodrigues, V., Madeira, A. M., Wilson, R. A., Menck, C. F., Setubal, J. C., Leite, L. C., and Dias-Neto, E. (2003) Nat. Genet. 35, 148–157[CrossRef][Medline] [Order article via Infotrieve]
  27. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403–410[CrossRef][Medline] [Order article via Infotrieve]
  28. Skelly, P. J., Dougan, P. M., Maule, A., Day, T. A., and Shoemaker, C. B. (2001) Parasitology 123, 277–284[Medline] [Order article via Infotrieve]
  29. Livak, K. J., and Schmittgen, T. D. (2001) Methods 25, 402–408[CrossRef][Medline] [Order article via Infotrieve]
  30. Combet, C., Blanchet, C., Geourjon, C., and Deleage, G. (2000) Trends Biochem. Sci. 25, 147–150[CrossRef][Medline] [Order article via Infotrieve]
  31. Broer, S., and Wagner, C. A. (2002) Cell Biochem. Biophys. 36, 155–168[Medline] [Order article via Infotrieve]
  32. Nagano, N., Orengo, C. A., and Thornton, J. M. (2002) J. Mol. Biol. 321, 741–765[CrossRef][Medline] [Order article via Infotrieve]
  33. Janecek, S., Svensson, B., and Henrissat, B. (1997) J. Mol. Evol. 45, 322–331[CrossRef][Medline] [Order article via Infotrieve]
  34. Da Lage, J. L., Feller, G., and Janecek, S. (2004) Cell Mol Life Sci. 61, 97–109[CrossRef][Medline] [Order article via Infotrieve]
  35. Palacin, M., Nunes, V., Font-Llitjos, M., Jimenez-Vidal, M., Fort, J., Gasol, E., Pineda, M., Feliubadalo, L., Chillaron, J., and Zorzano, A. (2005) Physiology 20, 112–124[Abstract/Free Full Text]
  36. Krautz-Peterson, G., Radwanska, M., Ndegwa, D., Shoemaker, C. B., and Skelly, P. J. (2007) Mol. Biochem. Parasitol 153, 194–202[CrossRef][Medline] [Order article via Infotrieve]
  37. Overhoff, M., Alken, M., Far, R. K., Lemaitre, M., Lebleu, B., Sczakiel, G., and Robbins, I. (2005) J. Mol. Biol. 348, 871–881[CrossRef][Medline] [Order article via Infotrieve]
  38. van Balkom, B. W., van Gestel, R. A., Brouwers, J. F., Krijgsveld, J., Tielens, A. G., Heck, A. J., and van Hellemond, J. J. (2005) J. Proteome Res. 4, 958–966[CrossRef][Medline] [Order article via Infotrieve]
  39. Braschi, S., Curwen, R. S., Ashton, P. D., Verjovski-Almeida, S., and Wilson, A. (2006) Proteomics 6, 1471–1482[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/30/21767    most recent
M703512200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krautz-Peterson, G.
Right arrow Articles by Skelly, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krautz-Peterson, G.
Right arrow Articles by Skelly, P. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement