JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M611877200 on May 29, 2007

J. Biol. Chem., Vol. 282, Issue 31, 22278-22288, August 3, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/31/22278    most recent
M611877200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pedram, A.
Right arrow Articles by Levin, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pedram, A.
Right arrow Articles by Levin, E. R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Conserved Mechanism for Steroid Receptor Translocation to the Plasma Membrane*

Ali Pedram{ddagger}, Mahnaz Razandi{ddagger}, Richard C. A. Sainson§, Jin K. Kim{ddagger}, Christopher C. Hughes§, and Ellis R. Levin{ddagger}1

From the Division of Endocrinology, Veterans Affairs Medical Center, Long Beach, California 90822 and the Departments of {ddagger}Medicine, Pharmacology, and §Molecular Biology and Biochemistry, University of California, Irvine, Irvine, California 92697

Received for publication, December 28, 2006 , and in revised form, May 2, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Multiple steroid receptors (SR) have been proposed to localize to the plasma membrane. Some structural elements for membrane translocation of the estrogen receptor {alpha} (ER{alpha}) have been described, but the mechanisms relevant to other steroid receptors are entirely unknown. Here, we identify a highly conserved 9 amino acid motif in the ligand binding domains (E domains) of human/mouse ER{alpha} and ERbeta, progesterone receptors A and B, and the androgen receptor. Mutation of the phenylalanine or tyrosine at position–2, cysteine at position 0, and hydrophobic isoleucine/leucine or leucine/leucine combinations at positions +5/6, relative to cysteine, significantly reduced membrane localization, MAP and PI 3-kinase activation, thymidine incorporation into DNA, and cell viability, stimulated by specific SR ligands. The localization sequence mediated palmitoylation of each SR, which facilitated caveolin-1 association, subsequent membrane localization, and steroid signaling. Palmitoylation within the E domain is therefore a crucial modification for membrane translocation and function of classical sex steroid receptors.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Steroid receptors (SR)2 exist predominantly in the nucleus and mediate gene transcription, both in ligand-independent and -dependent fashion (1). However, evidence also supports distinct pools of functional membrane-localized SR, binding estrogen (2), progesterone (P), or androgen (reviewed in Ref. 3). Overall, very little is understood regarding the mechanisms of translocation of SR to the plasma membrane (PM).

From a structure/function relationship for membrane localization, estrogen receptors (ER) have been best studied. Serine 522 and cysteine 447 in the E domain are necessary for strong physical association of ER{alpha} with caveolin-1, and subsequent membrane translocation (4, 5). Cysteine 447 has been reported to be a site of palmitoylation (5), a modification that generally increases protein hydrophobicity and membrane association of proteins (6). Other regions, such as the N terminus (A/B) region of ER{alpha} have also been reported to participate in membrane localization (7), but this has been disputed (4).

ER have been localized to caveolae rafts in the membrane (8–10). Here, ER closely associate with signaling proteins, leading to rapid activation of G proteins and subsequent multiple transducer signals (reviewed in Ref. 11). Evidence strongly supports the idea that the membrane and nuclear ER{alpha} and ERbeta proteins are distinct pools of the classical receptor proteins in several cells (12, 13).

Regarding other steroid receptors, virtually nothing is known about the mechanisms of membrane localization. Related to this, a report identified a new family of membrane heptahelical G protein -coupled receptors that bind progesterone (P) and are products of genes distinct from the gene encoding the classical progesterone receptor(s) (PR) (14). It is not clear whether these proteins or the classical PR mediate rapid actions of P at the membrane (15).

In the studies here, we identified a highly conserved sequence and mechanism required for membrane localization of multiple SRs. Mutational analysis established that a 9 amino acid motif in the E domains of ER{alpha} and ERbeta, PR, and the androgen receptor (AR) mediates membrane translocation via palmitoylation, events necessary for rapid signaling by these receptors.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Plasmids and Constructs—Mouse ER{alpha} (pcDNA3-ER{alpha} kindly provided by K. Korach), ERbeta (pSG5-ERbeta from J. Gustaffson), human PRB (pLEM-PR) and human AR (pCMV5-AR kindly provided by D. Tindall) were used as wild-type (wt) controls and templates for creating mutations by polymerase chain reaction (PCR)-based, site-directed mutagenesis (kit from Stratagene). Primers used and the alanine mutants created are shown in Table 1, and all PCR products were sequenced for mutation verification. CHO cells or steroid receptor-negative breast cancer cells were transfected with wt or mutant SR using lipofectamine (4), recovered overnight, then exposed for 2 h to 10 nM E2, 100 nM P, or 10 nM T, and immunofluorescent microscopy was carried out for receptor localization, as described (4). First antibodies were against the receptor C terminus (Santa Cruz Biotechnology), and second antibody was conjugated to FITC (Molecular Probes). For each condition, 300 cells were counted to compare the PM localization of wt versus mutant SR-expressing CHO cells, in two separate experiments. Protein expression was controlled by limiting the amount of plasmid used, to simulate the expression of endogenous SRs expressed at the membrane of MCF-7 and LnCap cells, determined by Western blot (data not shown). To create a fusion protein containing the 9 amino acid motif from ER{alpha} (FVCLKSIIL) C terminus to the GFP protein, we used the oligonucleotides (5'-aattctttgtgtgcctcaaatctattattttgg and gatcccaaaataatagatttgaggcacacaaag) to form double-stranded DNA containing the ER{alpha} sequence flanked by sticky ends recognizing EcoRI and BamHI enzymes. The DNA was ligated to pEGFP-C2 (Clontech), linearized by EcoRI and BamHI.


View this table:
[in this window]
[in a new window]

  		TABLE 1
Primers used for site-directed mutagenesis

 
To test whether key residues of the ER{alpha} palmitoylation motif dictated translocation to a palmitoyl acyltransferase, or promoted palmitoylation, we constructed a plasmid with additional membrane targeting sequences. A myristoylation sequence (the first 15 amino acids of p60src, mgsskskpkdpsgrr), was fused to the N terminus of wild-type ER{alpha}. A single-stranded oligonucleotide containing the myristoylation sense sequence (5'-gatccatggggagtagcaagagcaag cct aag gac ccc agc cag cgc cgg-3') was annealed to a complementary antisense sequence, (5'-aattccggcgctggctggggtccttaggcttgctcttgctactcccatg-3') in 10 mM Tris/50 mM NaCl/1 mM EDTA, at 95 °C for 5 min. The annealed oligonucleotides contained sticky ends for ligation to a BamHI-and EcoRI-digested site at 5'- and 3'-ends, respectively. ER{alpha} in pcDNA3 was digested with BamHI and EcoRI, gel-purified, and ligated to the double-stranded oligo containing the myristoylation sequence. The resulting vector, Myr-ER{alpha}, expressed the myristoylation sequence in frame to wild-type ER. The same method was used to fuse the myristoylation sequence to mutant ER vectors containing amino acid changes, F-A or IL-AA. The constructs were verified by sequencing.

In some studies, siRNAs to caveolin-1 or control (GFP) were obtained from Qiagen, cat. no. Si00299635. siRNA, 3 µg in 1 ml of buffer, per 500,000 cells in a single well, was transfected at 0 h with OLIGOfectamine as described (13), after time course studies showed maximal protein knockdown at 48 h. wtER{alpha} was transfected at 24 h, and microscopy of ER{alpha} localization in CHO cells was performed at 48 h. For other studies, CHO were transfected and recovered, incubated with 10 µM 2-bromopalmitate for 6 h, followed by 2 h of incubation with steroid. Transcription studies utilized a triple, tandem estrogen response element/luciferase reporter (kindly provided by John Couse/Ken Korach), transiently transfected into CHO cells, with or without the various ER{alpha} constructs. Luciferase activity was determined after incubation of the cells with 10 nM E2 for 24 h, as described (16).

Estradiol-specific Binding—CHO cells were transfected to express wt or mutant ER{alpha}, and whole cell binding of 17beta-[3H]E2 (1 nM) to equilibrium was carried out in the presence or absence of 100 nM unlabeled E2 (nonspecific binding) (13).

Palmitoylation of SRs Expressed in CHO-K1 Cells—CHO-K1 cells were grown on 100-mm-diameter dishes in Dulbecco's modified Eagle's medium/nutrient mixture F12 Ham without phenol red. Twenty-four hours after transfection with wildtype or mutant SRs, the cells were synchronized without serum overnight, then labeled with [3H]palmitic acid (0.5 mCi/ml) for 1 h. 10 nM 17beta-E2 or other sex steroids were added for another 4 h, the cells washed, then lysed in buffer A (50 mM Tris-HCl, pH 7.5, 5 mM EDTA, 100 mM NaCl, 50 mM NaF, 100 µM phenylmethylsulfonyl fluoride, protease inhibitor mixture, and 0.2% Triton X-100).

Nuclear pellets were collected by low speed centrifugation (6000 rpm) and solubilized by sonication. Equal amounts of solubilized cell extracts (supernatant and nuclear fractions) were immunoprecipitated for 2 h at 4 °C with antibodies to ER{alpha} (MC-20, Santa Cruz Biotechnology), ERbeta (51-7700, directed against the C terminus, Zymed Laboratories Inc.), PR (SC-539, C-20, Santa Cruz Biotechnology), or AR (SC-815, C-19, Santa Cruz Biotechnology) each conjugated to protein A-Sepharose. The immunoprecipitates were washed with lysis buffer, then eluted with 4x Laemmli sample buffer containing 2-mercaptoethanol after boiling for 5 min. Samples were subjected to 10% SDS-PAGE, followed by fluorography and autoradiography. Some aliquots underwent counting by beta-scintillation. Data were analyzed by analysis of variance plus Schefe's test, and incorporated counts were normalized per milligram of protein from each condition. To determine whether palmitoylation occurred at internal site(s) via thioester linkage, CHO cells expressing wtER{alpha} were incubated with 1 µM unlabeled palmitic acid for 2 h. The cells were washed, then lysed, and ER was immunoprecipitated. The supernatant containing isolated ER was exposed to buffer containing or not containing 1 M hydroxylamine at pH 7.2 for 2 h. Hydroxylamine cleaves thioester linkage of the fatty acyl group to cystine (17). The buffers were centrifuged, and the supernatants sent for analysis by electrospray ionization mass spectrometry (HT Laboratories Inc., San Diego).

Kinase Signaling—ERK activity in CHO cells expressing wt or mutant SR was determined at 8 min after exposure to steroid ligand. Activity of immunoprecipitated and protein normalized ERK was directed against the myelin basic protein substrate in an in vitro assay, as described (4). PI 3-kinase activity was determined as phosphorylation of AKT at serine 473 (13), after 15 min of exposure of the cells to steroid. p38beta activity was determined similarly to ERK, immunoprecipitating this kinase from ERbeta-expressing cells incubated with/without 10 nM E2 for 30 min. Protein-normalized immunoprecipitates were used in an in vitro assay with the substrate ATF2 protein. p38beta antibody (Santa Cruz Biotechnology) was also used to immunoblot total p38beta protein (for normalization). All studies were repeated.


Figure 1
View larger version (35K):
[in this window]
[in a new window]

  		FIGURE 1.
Membrane ER localization. A, highly conserved amino acid sequence in the ligand binding domains of ER, AR, and PR. B, immunofluorescent localization of wt or mutant ER{alpha} expressed in CHO cells. Arrows point to membrane ER expression. C, 2-bromopalmitate (2-Br) prevents membrane localization of endogenous ER{alpha} in MCF-7 cells. D, Western blots of whole cell, nuclear, cytoplasmic, or PM fractions from ER-transfected CHO cells (n = 3). E, kinase activation in cells expressing wild-type or mutant ER{alpha}. ERK activity directed against the myelin basic protein (MBP) substrate or PI3 kinase activity (serine 473 phosphorylation of AKT kinase) was accomplished in transfected CHO cells. F, whole cell specific binding of estradiol to cells expressing wild-type or mutant ER{alpha}. CHO cells were transfected to express wt or mutant ER{alpha}, and total specific binding of [3H]E2 was determined at 1 h (in the presence or absence of 100 nM unlabeled E2). The study was repeated. G, wild-type and mutant ER{alpha} comparably stimulate transcription. ER-transfected CHO cells were co-transfected with an ERE-luciferase reporter plasmid, and luciferase activity was measured as described under "Experimental Procedures." The bar graph values are mean ± S.E. from three experiments combined. *, p < 0.05 by analysis of variance plus Schefes' test for any ER expressed versus same plus E2.

 
Cell Biology Studies—CHO or HCC-1569 cells (ER/PR/AR-negative breast cancer cells) expressing the various SR constructs were recovered, synchronized overnight in serum and steroid-free medium. Progression from G1 to S phase was reflected by thymidine incorporation (DNA synthesis) in response to steroid ± kinase inhibitors, 10 mM PD98059 (MEK) or 100 nM wortmannin (PI3K), determined at 24 h as described (13). In some experiments, 2-Br was added prior to assay. Cell viability was separately quantified by the colorimetric MTT assay (Sigma). The conversion of MTT to MTT-formazan crystal by mitochondrial enzymes occurs in viable cells. In brief, CHO cells were transiently transfected with different SR constructs, and recovered for 24 h. Cells were exposed or sham exposed to brief UV radiation (50 J/M2), and incubated in the presence or absence of specific steroid ligands for 24 h. The cells were then washed in medium without phenol red and incubated with medium containing MTT 1 mg/ml for 4 h at 37°C. MTT/formazan was extracted by overnight incubation at 37 °C with 100 ml of extraction buffer. Optical densities at 570 nm were measured using buffer as a blank. The optical density of the control vector alone (sham UV) was converted to 100% viability, and all other densities were normalized to this value as a percent of control.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Functional Analysis of Mutated ER{alpha}—Many heptahelical G protein-coupled receptors (GPCR) contain a conserved F(X6)LL sequence, where X is any amino acid and L is leucine or isoleucine (18). F, LL, and the precise 6 amino acid spacing between F and LL are required for protein export from the endoplasmic reticulum. Upon sequence mutation, membrane localization of several GPCRs was not found (18).

In the E domain of human/mouse ER{alpha} proteins, a sequence highly homologous to F(X6)LL is present. In contrast to typical GPCRs, the third amino acid of this motif in ER{alpha} is cysteine (amino acid 447 in the human) (Fig. 1A). We expressed wtER{alpha} or F445A, C447A, and IL453/454AA mutant ER{alpha} in ER-null CHO cells. Wild-type receptor was detected in a discontinuous pattern at the PM in 95% of successfully transfected cells, but no mutant receptors were observed at this location (Fig. 1B and Table 2). Similar results were obtained after expression in ER-null breast cancer cells (data not shown). Whole cell and cytoplasmic ER protein was comparable by immunoblot in wildtype and mutant receptor-expressing cells (Fig. 1D). All receptors comparably localized to the nucleus (Fig. 1D) but each mutant ER{alpha} protein was significantly less abundant at the PM. We previously established the purity of our subcellular fractionation approach (4, 13, 19).


View this table:
[in this window]
[in a new window]

  		TABLE 2
Localization of steroid receptors expressed in CHO cells

Data are derived from counting 300 CHO cells per receptor condition in two separate experiments. Transfected cells were counted if they expressed the nuclear receptor, determined by immunofluorescent microscopy. Lack of nuclear expression was always accompanied by lack of membrane expression. In some transfected cells, it was technically difficult to determine if membrane localization occurred.

 
E2 rapidly activates ERK and PI 3-kinase via membrane-localized ER in various target cells (4, 20, 21). Wt compared with mutant ER{alpha} supported rapid and robust ERK activation by E2 (Fig. 1E), and stronger PI3K activation. Specific binding of labeled E2 was similar for wt and mutant ER{alpha} (Fig. 1F), and the transcriptional activities of the various ER{alpha} constructs were comparable in ERE-luciferase-transfected CHO cells (Fig. 1G).

Palmitoylation and Function of Membrane ER—How does this motif promote the PM localization of functional ER{alpha}? The cysteine residue has been reported to be a site for palmitoylation, potentially mediating ER{alpha} translocation to the PM (5). Here we determined whether cysteine and other amino acids in our identified motif affect ER{alpha} lipidation and PM localization/function.

Membrane Localization and Signaling—We found that cytoplasmic/membrane wtER{alpha} underwent palmitoylation, not influenced by steroid ligand (Fig. 2A). Importantly, wtER{alpha} in the nucleus did not show this acylation. This supports the idea that palmitoylation drives the SR specifically to the PM. Furthermore, virtually no palmitoylation of the cysteine mutant receptor was detected in this cell fraction. Thus, Cys447 is apparently the only palmitoylation site in ER{alpha}. Scant lipidation occurred in cells expressing the F or IL mutants (Fig. 2A).

We also incubated CHO-wtER{alpha} cells with an inhibitor of palmitoylation, 2-bromopalmitate (2-Br) (22). This compound prevents wtER palmitoylation (Fig. 2A, lane 5), the membrane localization of expressed wtER{alpha} (Fig. 1B), and the localization of endogenous ER{alpha} to the PM in MCF-7 cells (Fig. 1C). 2-Br also dampened E2-induced ERK and PI 3-kinase activities via endogenous membrane ER in MCF-7 cells (Fig. 2B), or ERK in CHO-wtER{alpha} cells (Fig. 2C).

Palmitoylation is the co- or post-translational attachment of palmitic acid to a cysteine, promoted by a palmitoyl acyltransferase enzyme (PAT) (6). This most often occurs in the N-terminal region of membrane-bound signaling molecules by amide linkage. However, internal cysteine residues can be reversibly S-palmitoylated via thioester linkage. To support the idea that palmitoylation occurred by thioester bonding of palmitic acid to the designated cystine, a plasmid encoding a GFP-wtER{alpha} fusion protein was expressed in CHO cells, incubated with 3H-labeled or unlabeled palmitic acid, then immunoprecipitated from the cells. Isolated GFP-ER was then incubated in buffer with or without hydroxylamine. Hydroxylamine cleaves thioester bonding of fatty acyl groups (17). Here, hydroxylamine blocked palmitoylation of ER{alpha} (Fig. 2D, left) and liberated palmitic acid (right). The latter was identified by electrospray ionization mass spectrometry as a 256 Da peak, compatible with palmitic acid. This was found released in the buffer from hydroxylamine-treated ER but not in the control buffer (latter not shown).

Next, we determined cell transition through G1 to S phase of the cell cycle. Compared with wtER{alpha}, each mutant receptor resulted in ~50% less E2-stimulated thymidine incorporation (TI) (Fig. 2E). 2-Br also significantly but incompletely blocked the ability of wtER{alpha} to support this action. 2-Br further decreased E2-induced TI when the palmitoylation inhibitor was combined with F449A mutant expression, perhaps further impairing palmitoylation. Finally, wtER{alpha}-induced TI was significantly but partially prevented by inhibitors of MEK (PD98059) or PI3 kinase (wortmannin) (Fig. 2F). Thus, membrane localization of palmitoylated ER{alpha} leads to signal transduction that contributes to cell cycle progression.

Palmitoylation Facilitates ER Association with Caveolin-1—We previously showed that membrane translocation of ER{alpha} requires the physical association of the steroid receptor with caveolin-1 protein, mediated in part through serine 522 of ER{alpha} (4). Further, the scaffolding domain of caveo-lin-1 (amino acids 80–100) was necessary for the membrane localization of both caveolin and ER.

We asked whether palmitoylation promotes caveolin-1/ER association, leading to membrane transport. CHO cells contain endogenous caveolin-1 but lack ER. Transfection of wtER{alpha} led to membrane ER{alpha} association with caveolin-1, this aspect promoted by E2 (Fig. 3A). This was substantially diminished from expression of each mutant receptor (top), and wtER{alpha} association with caveolin-1 was inhibited by 2-Br (Fig. 3A, bottom). This protein-protein interaction was important to membrane localization because knockdown of caveolin-1 with siRNA prevented wtER{alpha} localization at the membrane (Fig. 3B).

Is the identified 9 amino acid motif in ER{alpha} sufficient to dictate membrane localization? To address this issue, we attached the E domain motif to a protein that normally does not translocate to the membrane. We cloned the ER{alpha} motif C terminus to green fluorescent protein in the pEGFP-C2 plasmid. Transfection of the parent vector, pEGFP-C2, resulted in diffuse cellular fluorescence in CHO cells (Fig. 3C). In contrast, expression of the fusion protein resulted in membrane localization, although a weaker fluorescent intensity was seen. The fusion protein was palmitoylated, and this was reversed by treatment of the precipitated protein with hydroxylamine (Fig. 3D). Thus, the 9 amino acid sequence bestows protein localization at the membrane and palmitoylation.


Figure 2
Figure 2
View larger version (63K):
[in this window]
[in a new window]

  		FIGURE 2.
Palmitoylation of ER{alpha}. A, CHO cells transfected with wt or mutant ER constructs were labeled with [3H]palmitate. A representative experiment is shown, and the bar graph is the mean ± S.E. (n = 3). *, p < 0.05 for wtER{alpha} in cyto/mem versus other conditions. +, p < 0.05 for mutant ER{alpha} versus wtER{alpha} in cyto/mem fraction. B and C, 2-Br prevents rapid kinase activation in MCF-7 cells (B) and ER{alpha}-transfected CHO cells (C). D, wtER{alpha} were immunoprecipitated from transfected CHO cells incubated with buffer containing [3H]palmitic acid (autoradiogram) or 1 M unlabeled palmitic acid (for mass spectrometry analysis), and processed as described under "Experimental Procedures." Left, autoradiograph of palmitoylated ER{alpha} not exposed or exposed to hydroxylamine. Right, chromatogram of buffer from hydroxylamine-treated wtER{alpha}. The single large peak seen in the top figure was further analyzed by ionization, revealing a corrected mass of 256 Da (bottom figure) and was not seen in the control buffer (no hydroxylamine). E, thymidine incorporation into DNA of wtER{alpha}-expressing cells is diminished in mutant-ER cells. Bar graph is three experiments. *, p < 0.05 for wtER{alpha} versus same +E2. +, p < 0.05 for wtER{alpha} +E2 versus mutant ER{alpha} +E2. F, thymidine incorporation into DNA is prevented by MEK(PD98059) and PI3 kinase (Wortmannin) inhibitors (n = 3). *, p < 0.05 for pcDNA3 or same plus E2 or wtER{alpha} alone, versus wtER{alpha} +E2. +, p < 0.05 for ER +E2 versus same +PD or Wort.

 


Figure 3
View larger version (46K):
[in this window]
[in a new window]

  		FIGURE 3.
Caveolin-1 and ER. A, caveolin-1 associates with wild type but weakly with mutant ER{alpha} at the PM, inhibited by 2-Br. The studies were repeated a second time. B, caveolin-1 is necessary for ER{alpha} localization at the PM. CHO-wtER{alpha} cells were imaged after transfection with control siRNA or caveolin-1 siRNA in this representative study (n = 3). Arrows indicate membrane ER{alpha}. Protein knockdown by siRNA is shown. C, addition of the putative ER{alpha} membrane localization sequence cloned C terminus to GFP resulted in fluorescence only at the membrane of transfected CHO cells. D, GFP-membrane localization sequence fusion protein is palmitoylated upon expression in CHO cells, reversed by hydroxylamine treatment of the immunoprecipitated protein. E, membrane-targeted wt but not mutant ER{alpha} undergoes palmitoylation. Left, myristoylated ER vectors were expressed in CHO cells for confocal immunofluorescent microscopy and right, palmitoylation studies.

 
The F and IL amino acids in the E domain motif might localize steroid receptors to the modifying PAT in a subcellular partition, and/or promote the physical interaction of the enzyme(s) with the SRs. To investigate this, we cloned a myristoylation sequence from Src to wt, F445A, and IL453/454AA mutant ER{alpha}. wtER{alpha} without the myristoylation fusion sequence was expressed in CHO cells and revealed predominantly a nuclear distribution, with cytoplasmic and membrane localization also seen (data not shown). In contrast, wt and mutant ER{alpha} containing the myristoylation sequence localized only at the cytoplasmic/membrane interface (Fig. 3E). wtER but not mutant ER underwent palmitoylation despite myristolate-induced membrane localization of all constructs. This suggests that the amino acids flanking cystine facilitate the physical and functional interaction of ER{alpha} with a palmitoyl acyltransferase.

Analysis of Other SRs—ERbeta contains a comparable 9 amino acid motif except that tyrosine is present rather than phenylalanine at 416 in the native protein (Fig. 1A). Expressed wtERbeta localized to the cell membrane in 93% of transfected cells, not seen with the mutant forms (Fig. 4A and Table 2). All mutations, especially at cysteine 418, impaired cytoplasmic/membrane ERbeta palmitoylation (Fig. 4B). As with ER{alpha}, wild-type nuclear ERbeta was not palmitoylated. Further, 2-Br prevented both the palmitoylation and membrane localization of cyto/memb wtERbeta. Activation of p38beta MAP kinase by E2 contributes to cell survival in several cell types (16, 23). We report the novel finding that wtERbeta supports E2-induced activation of p38beta, prevented by 2-Br. In contrast, mutant (s) ERbeta does not support this signaling (Fig. 4C).

Rapid signaling by progestins and androgens has previously been demonstrated, indicating that these sex SRs probably exist at the PM (15, 24–26). The identity of membrane PR is unclear, because a separate family of heptahelical PRs that span the PM has been described (14). Using antibodies to classical PR, this endogenous protein was localized to the membrane (and nucleus and cytoplasm) of MCF-7 breast cancer cells (Fig. 5A). PRA and PRB isoforms were found at the PM of MCF-7 cells, with PRB localized in excess of PRA (Fig. 5A).


Figure 4
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 4.
Localization of other steroid receptors. A,ERbeta at the PM. CHO cells were transfected to express wtERbeta or Y, C, or IL mutants. B, palmitoylation of ERbeta in CHO cells expressing wt or mutant ERbeta. Bar graph of labeled palmitate incorporation is the mean ± S.E. from three experiments. *, p < 0.05 for wtERbeta in cyto/mem versus any other condition. +, p < 0.05 for mutant ERbeta versus wtERbeta in cyto/mem fraction. C, E2-induced p38beta MAP kinase activation in wtERbeta-expressing cells.

 
We also found membrane, nuclear, and cytoplasmic AR in LnCap prostate cancer cells, identified with antibodies to the "classical" receptor (Fig. 5B). Mouse and human AR and PRB contained sequences in their E domains almost identical to ER{alpha} (Fig. 1A), and comparable mutations were created. While expressed wtAR and PR localize to the PM in 95 and 92% of cells, respectively, each mutation prevents this (Fig. 5C and Table 2). 2-Br prevented membrane localization of wtAR and PR (Fig. 5C), and palmitoylation was seen in wt but not mutant AR or PRB-expressing cells (Fig. 5D). Signaling to ERK and PI3K (Fig. 5E) and DNA synthesis (Fig. 5F) was significantly stimulated by specific steroid ligands, more so in cells expressing wtSRs compared with mutant SRs. We also determined cell viability after UV-radiation of transfected CHO cells (Fig. 5G). Cell viability was reduced by ~50% in irradiated cells expressing the wtSRs in the absence of steroid, when compared with sham radiation of these cells. The specific ligands E2, T, and P, respectively, prevented 55, 52 and 40% of the cell death caused by UV exposure, seen from wtSR expression. In contrast, mutant SR expression and steroid exposure failed to significantly prevent UV-induced cell death. Previous studies have proposed that rapid signaling by SRs contributes to cell viability (27–29).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Rapid signaling effects of sex steroids E2, P, and T have been increasingly recognized (20, 24–26), and ascribed to membrane-localized ER (28), PR (14, 25), and AR (30). Recently, it was shown that the membrane ER (31) in human breast cancer cells is the classical ER{alpha} (13). The exact nature of membrane P and T binding proteins is not clearly defined, and the mechanisms required for membrane localization are unknown.

Here we identify a unifying mechanism as to how classical sex steroid receptors translocate to the PM to enact rapid signaling. A signature, 9 amino acid motif was found to be highly conserved in the ligand binding domains of all sex steroid receptors, identical in both mouse and human genes. Interestingly, the glucocorticoid receptor but not the mineralocorticoid receptor also contains the identified motif. Thyroid receptors A and B contain a comparable sequence (lpcedqiil) but peroxisome proliferative-activated receptors {alpha}, {delta}, and {gamma}, and the retinoic acid receptor do not. In addition, this motif was 1) similar to a sequence in typical GPCRs that are not palmitoylated because they do not contain the cysteine residue, and 2) the GPCR motif was found necessary for the angiotensin II and alpha adrenergic receptors to be exported from the endoplasmic reticulum (17).

The motif mediated SR palmitoylation, and blocking palmitoylation of expressed or endogenous wtSRs with 2-Br prevented membrane localization and signaling. SRs mutated in key motif residues (F or T, C, IL/LL) were not normally palmitoylated, and PM localization and rapid kinase signaling to downstream functions were decreased. Mammalian PATs that interact with many membrane-bound signaling proteins (Fyn, Rho, Src, G proteins, etc.) have not been isolated to date. Recently, a conserved family of proteins (DHHC) has been found in yeast-through mammals, promoting palmitoylation of a few identified membrane proteins (32). Whether these PATs interact with steroid receptors is unknown.


Figure 5
Figure 5
View larger version (82K):
[in this window]
[in a new window]

  		FIGURE 5.
A, membrane localization of endogenous PR in MCF-7 cells (left) and immunoblot of PR in MCF-7 cell fractions (right). B, AR distribution in LnCap cells. C, intact but not mutant AR (left) and PR (right) localize to the PM in CHO cells. D, palmitoylation of cytoplasmic/membrane AR (left) and PR (right) expressed in CHO cells. E, ERK and PI 3-kinase activity in CHO cells expressing wild-type or mutant AR or PR. F, wild-type AR and PR support ligand-stimulated thymidine incorporation. CHO cells were transfected to express wt or mutant AR (left)orPR(right), recovered and incubated with 10 nM T or 100 nM P, and thymidine incorporation was carried out as described. Bar graph data are the mean ± S.E. of three experiments, duplicate determinations per condition in each. *, p < 0.05 for pCMV5 versus wtPR (plus P), or wtCMVAR (plus T); +, p < 0.05 for PR + PorAR + T versus mutant PR or AR + ligand. G, cell viability of SR-expressing CHO cells subjected to UV radiation. wt or mutant ER{alpha}-, AR-, or PR-expressing cells were exposed or sham-exposed to UV radiation(50 J/M2), cells incubated with specific steroid receptor ligand, and viability was determined by the MTT assay. Bar graphs are from n = 3. *, p < 0.05 for vector control versus same plus UV or other condition; +, p < 0.05 for UV plus wtSR versus same plus SR ligand.

 
In contrast, mutated receptors translocated to the nucleus comparably to wild-type receptors. Importantly, only wild-type SRs in the cytoplasmic/membrane (but not the nuclear) fraction of the cell underwent palmitoylation. Thus, a limited number of receptors outside the nucleus undergo this post-translational modification, facilitating PM translocation. We observed that palmitoylation increases the physical association of ER{alpha} with caveolin-1. This protein-protein interaction was required for membrane localization, demonstrated by knocking down caveolin-1 with siRNA. Caveolin-1-null cancer cells that contain endogenous ER show only a nuclear pool of sex steroid receptor; upon introducing caveolin-1, ER translocates to the PM (4).

Our findings extend results from Acconcia et al. (5) who showed that human ER{alpha} is palmitoylated at cysteine 447, promoting caveolin-1 interaction, and membrane translocation. We corroborate these findings and report that 1) the nuclear-localized ER pool is not palmitoylated, 2) additional sequences flanking the cysteine residue are needed for optimal palmitoylation, and 3) thymidine incorporation and cell survival are stimulated in part from membrane-localized ER{alpha} action. Most importantly, we show that ERbeta,PR and AR utilize this same mechanism and conserved motif to facilitate PM translocation. Both Acconcia et al. (5) and we do not find that E2 promotes palmitoylation; in fact, the earlier report suggests that the sex steroid promotes de-palmitoylation, perhaps a function of the timing of the studies. Upon attaining membrane localization, de-palmitoylation of many proteins rapidly ensues (6). We speculate that de-palmitoylation of PM-localized ER{alpha} (5) allows important proteinprotein interactions to occur in subcellular domains, necessary for membrane signaling. Previous studies from Li et al. (33) showed that a 46-kDa membrane ER{alpha} produced in immortalized endothelial cells undergoes posttranslational palmitoylation at an undetermined residue, leading to membrane localization.

We provide novel evidence of endogenous, PM-localized, classical PR and AR in cancer cells. It is controversial as to the nature of PR at the PM. Membrane-localized PR (mPR) have been identified as typical GPCRs in fish through humans (14). In contrast, other data (including shown here) indicate that classical, "nuclear PR" can localize and function at the membrane (24). We report that endogenous PRA and PRB isoforms are present at the PM of MCF-7 cells with PRB the most abundant form. Further work will determine if endogenous, heptahelical P-binding proteins exist at the membrane, and function either separately or co-operatively with classical PR. Nevertheless, we showed that classical wt PR expression results in membrane localization and rapid P signaling to enhanced thymidine incorporation and cell viability. Regarding AR, our findings support the idea that the classical "nuclear"receptor mediates rapid signaling by male sex steroids at the PM. To date, the endogenous membranelocalized AR has not been isolated and analyzed in a manner comparable to ER (13).

Our results suggest that mutations selectively preventing membrane localization will help sort out the distinct but integrated functions of the various SR pools. In this regard, blocking membrane localization or signaling only partially prevents cell cycle progression. This indicates the important role in this regard for nuclear SR (4), and suggests collaboration of subcellular receptor pools to effect cellular actions.


   FOOTNOTES
 
* This work was supported in part by grants from the Research Service of the Department of Veteran's Affairs, and National Institutes of Health Grant CA-100366 (to E. R. L.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Medical Service (111-I)Long Beach VA Medical Center/UC-Irvine, 5901 E. 7th St. Long Beach, CA 90822. Tel.: 562-826-5748; Fax: 562-826-5515; E-mail: ellis.levin{at}med.va.gov.

2 The abbreviations used are: SR, steroid receptor; ER{alpha}, estrogen receptor {alpha}; PM, plasma membrane; AR, androgen receptor; P, progesterone; GFP, green fluorescent protein; wt, wild-type; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; PR, progesterone receptor; PI, phosphatidylinositol; MAP, mitogen-activated protein; GPCR, G-protein-coupled receptor; PAT, palmitoyl acyltransferase enzyme; ERK, extracellular signal-regulated kinase. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Jensen, E. V., and Jacobson, H. I. (1962) Rec. Prog. Horm. Res. 18, 387–414
  2. Pietras, R. J., and Szego, C. M. (1977) Nature 265, 69–72[CrossRef][Medline] [Order article via Infotrieve]
  3. Losel, R., and Wehling, M. (2003) Nat. Rev. Mol. Cell Biol. 4, 46–56[CrossRef][Medline] [Order article via Infotrieve]
  4. Razandi, M., Alton, G., Pedram, A., Ghonshani, S., Webb, D., and Levin, E. R. (2003) Mol. Cell Biol. 23, 1633–1646[Abstract/Free Full Text]
  5. Acconcia, F., Ascenzi, P., Bocedi, A., Spisni, E., Tomasi, V., Trentalance, A., Visca, P., and Marino, M. (2005) Mol. Biol. Cell 16, 231–237[Abstract/Free Full Text]
  6. Basu, J. (2004) Curr. Sci. 87, 212–217
  7. Song, R. X., McPherson, R. A., Adam, L., Bao, Y., Shupnik, M., Kumar, R., and Santen, R. J. (2002) Mol. Endocrinol. 16, 116–127[Abstract/Free Full Text]
  8. Kim, H. P., Lee, J. Y., Jeong, J. K., Bae, S. W., Lee, H. K., and Jo, I. (1999) Biochem. Biophys. Res. Commun. 263, 257–262[CrossRef][Medline] [Order article via Infotrieve]
  9. Chambliss, K. L., Yuhanna, I. S., Anderson, R. G., Mendelsohn, M. E., and Shaul, P. W. (2002) Mol. Endocrinol. 16, 938–946[Abstract/Free Full Text]
  10. Kelly, M. J., and Wagner, E. J. (1999) Trends Endocrinol. Metab. 10, 369–374[CrossRef][Medline] [Order article via Infotrieve]
  11. Levin, E. R. (2005) Mol. Endocrinol. 19, 1951–1959[Abstract/Free Full Text]
  12. Razandi, M., Pedram, A., Merchenthaler, I., Greene, G. L., and Levin, E. R. (2004) Mol. Endocrinol. 18, 2854–2865[Abstract/Free Full Text]
  13. Pedram, A., Razandi, M., and Levin, E. R. (2006) Mol. Endocrinol. 20, 1996–2009[Abstract/Free Full Text]
  14. Zhu, Y., Bond, J., and Thomas, P. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 2237–2242[Abstract/Free Full Text]
  15. Boonyaratanakornkit, V., Scott, M. P., Ribon, V., Sherman, L., Anderson, S. M., Maller, J. L., Miller, W. T., and Edwards, D. P. (2001) Mol. Cell 8, 269–280[CrossRef][Medline] [Order article via Infotrieve]
  16. Pedram, A., Razandi, M., Aitkenhead, M., Hughes, C. C. W., and Levin, E. R. (2002) J. Biol. Chem. 277, 50768–50775[Abstract/Free Full Text]
  17. Drisdel, R. C., Alexander, J. K., Sayeed, A., and Green, W. G. (2006) Methods 40, 127–134[CrossRef][Medline] [Order article via Infotrieve]
  18. Duvernay, M. T., Zhou, F., and Wu, G. (2004) J. Biol. Chem. 279, 30741–30750[Abstract/Free Full Text]
  19. Razandi, M., Oh, P., Pedram, A., Schnitzer, J., and Levin, E. R. (2002) Mol. Endocrinol. 16, 100–115[Abstract/Free Full Text]
  20. Simoncini, T., Hafezi-Moghadam, A., Brazil, D. P., Ley, K., Chin, W. W., and Liao, J. K. (2000) Nature 407, 538–541[CrossRef][Medline] [Order article via Infotrieve]
  21. Kousteni, S., Chen, J. R., Bellido, T., Han, L., Ali, A. A., O'Brien, C. A., Plotkin, L., Fu, Q., Mancino, A. T., Wen, Y., Vertino, A. M., Powers, C. C., Stewart, S. A., Ebert, R., Parfitt, A. M., Weinstein, R. S., Jilka, R. L., and Manolagas, S. C. (2002) Science 298, 843–846[Abstract/Free Full Text]
  22. Hagve, T. A., and Christophersen, B. O. (1987) Biochim. Biophys. Acta 917, 333–336[Medline] [Order article via Infotrieve]
  23. Kim, J. K., Pedram, A., Razandi, M., and Levin, E. R. (2006) J. Biol. Chem. 281, 6760–6767[Abstract/Free Full Text]
  24. Tian, J., Kim, S., Heilig, E., and Ruderman, J. V. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 14358–14363[Abstract/Free Full Text]
  25. Skildum, A., Faivre, E., and Lange, C. A. (2005) Mol. Endocrinol. 19, 327–339[Abstract/Free Full Text]
  26. Unni, E., Sun, S., Nan, B., McPhaul, M. J., Cheskis, B., Mancini, M. A., and Marcelli, M. (2004) Cancer Res. 64, 7156–7168[Abstract/Free Full Text]
  27. Lange, C. A., Gioeli, D., Hammes, S. R., and Marker, P. C. (2007) Annu. Rev. Physiol. 69, 171–199[CrossRef][Medline] [Order article via Infotrieve]
  28. Marquez, D. C., and Pietras, R. J. (2001) Oncogene. 20, 5420–5430[CrossRef][Medline] [Order article via Infotrieve]
  29. Razandi, M., Pedram, A., and Levin, E. R. (2000) J. Biol. Chem. 275, 38540–38546[Abstract/Free Full Text]
  30. Heinlein, C. A., and Chang, C. (2002) Mol. Endo. 16, 2181–2187[Abstract/Free Full Text]
  31. Pietras, R. J., and Szego, C. M. (1975) Nature 253, 357–359[CrossRef][Medline] [Order article via Infotrieve]
  32. Roth, A. F., Wan, J., Bailey, A. O., Sun, B., Kuchar, J. A., Green, W. N., Phinney, B. S., Yates, J. R., 3rd, and Davis, N. G. (2006) Cell 125, 1003–1013[CrossRef][Medline] [Order article via Infotrieve]
  33. Li, L., Haynes, M. P., and Bender, J. R. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 4807–4812[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 FASEB J.Home page
C. M. Klinge, N. S. Wickramasinghe, M. M. Ivanova, and S. M. Dougherty
Resveratrol stimulates nitric oxide production by increasing estrogen receptor {alpha}-Src-caveolin-1 interaction and phosphorylation in human umbilical vein endothelial cells
FASEB J, July 1, 2008; 22(7): 2185 - 2197.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
P. Galluzzo, P. Ascenzi, P. Bulzomi, and M. Marino
The Nutritional Flavanone Naringenin Triggers Antiestrogenic Effects by Regulating Estrogen Receptor {alpha}-Palmitoylation
Endocrinology, May 1, 2008; 149(5): 2567 - 2575.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
G. Arpino, L. Wiechmann, C. K. Osborne, and R. Schiff
Crosstalk between the Estrogen Receptor and the HER Tyrosine Kinase Receptor Family: Molecular Mechanism and Clinical Implications for Endocrine Therapy Resistance
Endocr. Rev., April 1, 2008; 29(2): 217 - 233.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
X.-D. Fu, M. Flamini, A. M. Sanchez, L. Goglia, M. S. Giretti, A. R. Genazzani, and T. Simoncini
Progestogens regulate endothelial actin cytoskeleton and cell movement via the actin-binding protein moesin
Mol. Hum. Reprod., April 1, 2008; 14(4): 225 - 234.
[Abstract] [Full Text] [PDF]

Home page
 J ANIM SCIHome page
F. Stormshak and C. V. Bishop
BOARD-INVITED REVIEW: Estrogen and progesterone signaling: Genomic and nongenomic actions in domestic ruminants
J Anim Sci, February 1, 2008; 86(2): 299 - 315.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
S. R. Hammes and E. R. Levin
Extranuclear Steroid Receptors: Nature and Actions
Endocr. Rev., December 1, 2007; 28(7): 726 - 741.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
J. Iqbal, O. Latchoumanin, and I. J. Clarke
Rapid in Vivo Effects of Estradiol-17{beta} in Ovine Pituitary Gonadotropes Are Displayed by Phosphorylation of Extracellularly Regulated Kinase, Serine/Threonine Kinase, and 3',5'-Cyclic Adenosine 5'-Monophosphate-Responsive Element-Binding Protein
Endocrinology, December 1, 2007; 148(12): 5794 - 5802.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/31/22278    most recent
M611877200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pedram, A.