|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 282, Issue 31, 22678-22688, August 3, 2007
Suppression of Diacylglycerol Acyltransferase-2 (DGAT2), but Not DGAT1, with Antisense Oligonucleotides Reverses Diet-induced Hepatic Steatosis and Insulin Resistance*
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
activation, we next sought to understand the paradoxical reduction in diacylglycerol in Dgat2 ASO-treated rats. Within 3 days of starting Dgat2 ASO therapy in high fat-fed rats, plasma fatty acids increased, whereas hepatic lysophosphatidic acid and diacylglycerol levels were similar to those of control rats. These changes were associated with reduced expression of lipogenic genes (SREBP1c, ACC1, SCD1, and mtGPAT) and increased expression of oxidative/thermogenic genes (CPT1 and UCP2). Taken together, these data suggest that knocking down Dgat2 protects against fat-induced hepatic insulin resistance by paradoxically lowering hepatic diacylglycerol content and protein kinase C
activation through decreased SREBP1c-mediated lipogenesis and increased hepatic fatty acid oxidation. | INTRODUCTION |
|---|
|
|
|---|
(PKC
), a serine/threonine kinase that in turn binds to the insulin receptor and inhibits its tyrosine kinase activity (11). Until very recently, long chain acyl-coenzymes A (LCCoAs) were a favored candidate for fat-induced insulin resistance, but recent studies in mitochondrial acyl-coenzyme A (CoA):glycerol-sn-3-phosphate acyltransferase (mtGPAT) knock-out mice, which accumulate LCCoAs in the liver but have reduced liver DAG content and are protected from fat-induced hepatic insulin resistance (12), suggested that DAG may be a better candidate. DAG is also a potent activator of novel PKCs (13–15), making it an excellent candidate for this role.
Acyl-CoA:diacylglycerol acyltransferase (Dgat) catalyzes the final step in TG synthesis by facilitating the linkage of sn-1,2-diacylglycerol (DAG) with an LCCoA. Dgat exists in two primary isoforms: Dgat1 and Dgat2 (16, 17); Dgat1 is most highly expressed in small intestine and white adipose tissue, whereas Dgat2 is primarily expressed in liver and white adipose tissue (16, 17) where its expression is insulin-responsive. There is some evidence suggesting that the two enzymes play different roles in TG metabolism. DGAT1 knock-out mice have
50% less TG in tissues and are protected from diet-induced obesity and insulin resistance through a mechanism involving increased energy expenditure (at least partly attributable to increased physical activity) (18, 19). Study of Dgat2 has been more difficult as homozygous DGAT2 knock-out mice die shortly after birth because of severe lipopenia (
90% TG reduction in DGAT2 null carcasses) and impaired skin barrier function (20).
Here we sought to address two key questions. First, what effect does DGAT1 or DGAT2 knockdown in liver and fat have on hepatic insulin action? Other than the mtGPAT knock-out model, previous successful therapeutic strategies for NAFLD have primarily focused on increasing fat oxidation as opposed to inhibiting fat synthesis. In this study, we were therefore interested in examining the effect of inhibiting another key regulator of fat synthesis. Second, which lipid intermediates are increased or decreased by DGAT knockdown? Conventional wisdom suggests that DAG, a substrate for the enzyme activity of Dgat, might accumulate in the face of Dgat knockdown, an event which we have suggested induces insulin resistance (21–23). The present study demonstrates that Dgat2, but not Dgat1 ASO treatment, improves hepatic steatosis, insulin sensitivity, and somewhat surprisingly reduces hepatic DAG content. In addition, we provide evidence suggesting a potential mechanism to explain this paradoxical effect of DGAT2 inhibition on hepatic DAG content.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
200 g were obtained from Charles River Laboratories and acclimated for 1 week after arrival before initiation of the experiment. Rats received food and water ad libitum and were maintained on a 12:12 h light/dark cycle (lights on at 6:30 a.m.). They were housed individually, and food consumption and body weight were monitored. Rats received either regular rodent chow (60% carbohydrate, 10% fat, 30% protein calories) or a high fat diet (26% carbohydrate, 59% fat, 15% protein calories). Safflower oil was the major constituent of the high fat diet (Dyets Inc.). We have shown previously that this diet produces hepatic steatosis and hepatic insulin resistance within 3 days (6). Intraperitoneal ASO therapy was initiated 3 days after commencing the high fat diet. All ASOs (control, Dgat1, and Dgat2) were prepared in normal saline, and the solutions were sterilized through a 0.2-µm filter. Rats were given ASO solutions or saline twice per week via intraperitoneal injection at a dose of 50 or 75 mg/kg/week for 4 weeks. ASO control rats were treated at the higher dose (75 mg/kg/week). During the treatment period, body weight and food intake were measured twice weekly. The Yale Animal Care and Use Committee approved all protocols. Selection of Rat Dgat ASOs—To identify rat Dgat1 and Dgat2 ASO inhibitors, rapid throughput screens were performed in vitro as described previously (24). In brief, 80 ASOs were designed to the rat DGAT1 and DGAT2 mRNAs sequences, respectively, and initial screens identified several potent and specific ASOs, all of which targeted a binding site within the coding region of the DGAT1 and DGAT2 mRNAs. After extensive dose-response characterization of the most potent ASOs from the screen, two lead ASOs, ISIS-327822 (sequence CCTTCGCTGGCGGCACCACA) for Dgat1 and ISIS-369235 (sequence GCATTACCACTCCCATTCTT) for Dgat2, were chosen. The control ASO, ISIS-141923, has the following sequence, 5'-CCTTCCCTGAAGGTTCCTCC-3', and does not have perfect complementarity to any known gene in public data bases. The first five bases and last five bases of chimeric ASOs have a 2'-O-(2-methoxy)-ethyl modification, and the ASOs also have a phosphorothioate backbone. This chimeric design has been shown to provide both increased nuclease resistance and mRNA affinity, while maintaining the robust RNase H terminating mechanism utilized by these types of ASOs (25). These benefits result in an attractive in vivo pharmacological and toxicological profile for 2'-O-(2-methoxy)-ethyl chimeric ASOs.
Determination of DGAT Activity in Liver Homogenates and Fatty Acid Oxidation and Triglyceride Synthesis in Transfected Rat Hepatocytes in Vitro—Total DGAT activity was measured in liver tissue homogenates from ASO-treated rats as described previously (16, 26). Primary rat hepatocytes were isolated as described previously and plated onto collagen-coated 25-cm2 flasks for fatty acid oxidation measurement or 60-mm plates for triglyceride synthesis measurement (27). Hepatocytes were treated with ASO (150 nM) and Lipofectin® (Invitrogen) mixture for 4 h in serum-free William's E media (Invitrogen). ASO and Lipofectin were mixed in a ratio of 3 µg of Lipofectin® for every 1 ml of 100 nM ASO concentration. After 4 h, ASO reaction mixture was replaced with normal maintenance media (William's E media with 10% fetal bovine serum and 10 nM insulin). The cells were incubated under normal conditions for 20–24 h, and then fatty acid ([14C]oleate) oxidation and triglyceride synthesis (incorporation of [3H]glycerol into triglyceride) were measured as described previously (27).
Hyperinsulinemic-Euglycemic Clamp Studies—Seven days prior to the hyperinsulinemic-euglycemic clamp studies, indwelling catheters were placed into the right internal jugular vein extending to the right atrium, and the left carotid artery extending to the aortic arch. After an overnight fast, [3-3H]glucose (HPLC-purified; PerkinElmer Life Sciences) was infused at a rate of 0.15 µCi/min for 3 h to assess the basal glucose turnover. Following the basal period, the hyperinsulinemic-euglycemic clamp was conducted for 135 min with a primed/continuous infusion of human insulin (60 milliunits/kg prime, 4 milliunits/kg/min infusion) (Novo Nordisk) and a variable infusion of 20% dextrose to maintain euglycemia (
100 mg/dl). [3-3H]Glucose was infused at a rate of 0.4 µCi/min throughout the clamps. A 25-µCi bolus of 2-deoxy-D-[1-14C]glucose (PerkinElmer Life Sciences) was injected at the 90th min of the clamp to estimate the rate of insulin-stimulated tissue glucose uptake. Additional blood samples (20–60 µl) were taken at 0, 70, and 135 min for the determination of plasma FFA and/or insulin concentrations. At the end of the clamp, rats were anesthetized with pentobarbital sodium injection (150 mg/kg), and all tissues were taken within 4 min, frozen immediately using liquid N2-cooled aluminum tongs, and stored at -80 °C for subsequent analysis.
Biochemical Analysis and Calculations—Plasma glucose was analyzed during the clamps using 10 µl of plasma by a glucose oxidase method on a Beckman glucose analyzer II (Beckman Coulter). Plasma insulin, adiponectin, and leptin were measured by radioimmunoassay using kits from Linco Research Inc. The adiponectin kit was primarily designed to measure mouse adiponectin, but it shows significant cross-reactivity with rat adiponectin. Plasma fatty acid concentrations were determined using an acyl-CoA oxidase-based colorimetric kit (Wako Pure Chemical Industries Ltd.). Plasma lipoprotein and cholesterol profiling in pooled samples of each group was performed with a Beckman System Gold 126 HPLC system, 507e refrigerated antosampler, 126-photodiode array detector (Beckman Instruments, Fullerton, CA) and a Superose 6 HR 10/30 column (Pfizer, Chicago) as described by Crooke et al. (28). For the determination of plasma [3H]glucose, plasma was deproteinized with ZnSO4 and Ba(OH)2, dried to remove 3H2O, resuspended in water, and counted in scintillation fluid (Ultima Gold, PerkinElmer Life Sciences) on a Beckman scintillation counter. Rates of basal and insulin-stimulated whole body glucose turnover were determined as the ratio of the [3-3H]glucose infusion rate (disintegrations per min (dpm)) to the specific activity of plasma glucose (dpm per mg) at the end of the basal period and during the final 30 min of the clamp experiment, respectively. Hepatic glucose production was determined by subtracting the glucose infusion rate from the rate of total glucose appearance. The plasma concentration of 3H2O was determined by the difference between 3H counts without and with drying, and whole body glycolysis was calculated from the rate of increase in plasma 3H2O concentration, determined by linear regression of the measurements at 100, 105, 115, 125, and 135 min (29). Whole body glycogen synthesis was estimated by subtracting whole body glycolysis from whole body glucose uptake, assuming that glycolysis and glycogen synthesis account for the majority of insulin-stimulated glucose uptake (30). Glucose uptake and glycogen synthesis in individual muscles were calculated from muscle 2-[14C]deoxyglucose 6-phosphate (2-DG-6-P) content and 3H incorporation into muscle glycogen as described previously (29). For the determination of muscle 2-DG-6-P content, muscle samples were homogenized, and the supernatants were subjected to an ion-exchange column to separate 2-DG-6-P from 2-DG as described previously (31). The radioactivity of 3H in muscle glycogen was determined by digesting muscle samples in KOH and precipitating glycogen with EtOH as described previously (30).
Tissue Lipid Measurement—The solid-phase extraction and purification of medium, long chain, and very long chain fatty acyl-CoAs from liver have been described previously (32, 33). After purification, fatty acyl-CoA fractions were dissolved in methanol/H2O (1:1, v/v) and subjected to lipid chromatography/tandem mass spectrometry analysis. A turbo ion spray source was interfaced with an API 3000 tandem mass spectrometer (Applied Biosystems) in conjunction with two 200 series micro pumps and a 200 series autosampler (PerkinElmer Life Sciences). The DAG extraction and analysis were performed as described previously (12, 15). Total DAG content is expressed as the sum of individual species. Tissue TG was extracted using the method of Bligh and Dyer (32) and measured using a DCL triglyceride reagent (Diagnostic Chemicals Ltd.). Tissue lysophosphatidic acid (LPA) content was measured as described previously (12). In short,
100 mg of liver tissue was homogenized in chloroform/methanol (1:1 v/v) with 1 nmol of C17-lysophosphatidic acid as an internal standard. After phase separation with H2O, samples were vortexed and centrifuged, and the methanol/water phase was collected. The supernatant was applied to conditioned Waters Oasis HLB extraction cartridges (Waters), and after a washing step LPA was eluted using methanol. Individual LPA derivatives were measured using lipid chromatography/tandem mass spectrometry analysis, and total LPA content was expressed as the sum of individual species.
Insulin Signaling—IRS2-associated PI3K and Akt2 activity were assessed in protein extracts from livers harvested after short term insulin stimulation. PI3K and Akt2 assays were performed according to methods previously described (6, 34–36). Primary antibodies used for experiments were rabbit polyclonal IgG. Antibodies for PI3K and Akt2 were obtained from Upstate (Charlottesville, VA).
For PKC
membrane translocation, 50 µg of crude membrane and cytosol protein extracts were resolved by SDS-PAGE using 8% gel and electroblotted onto polyvinylidene difluoride membrane (DuPont) using a semidry-transfer cell (Bio-Rad). The membrane was then blocked for 2 h at room temperature in phosphate-buffered saline/Tween (PBS-T:10 mmol/liter NaH2PO4, 80 mmol/liter Na2HPO4, 0.145 mol/liter NaCl, and 0.1% Tween 20, pH 7.4) containing 5% (w/v) nonfat dried milk, washed twice, and then incubated overnight with rabbit anti-peptide antibody against PKC
(Santa Cruz Biotechnology) diluted 1:100 in rinsing solution. After further washings, membranes were incubated with horseradish peroxidase-conjugated IgG fraction of goat anti-rabbit IgG (Bio-Rad), diluted 1:5000 in PBS-T, for 2 h. PKC
translocation was expressed as the ratio of membrane bands over cytosol bands (arbitrary units).
Total RNA Preparation, Real Time Quantitative RT-PCR Analysis, and Immunoblotting Analysis—Total RNA was extracted using total RNA isolation reagent (BL-10500, Biotecx Laboratories Inc.) according to manufacturer's instructions. Real time quantitative RT-PCR was performed using custom- made RT-PCR enzymes and reagents kit (Invitrogen.) and ABI Prism 7700 sequence detector (Applied Biosciences). Primers and probes for analysis of the expression of different genes (supplemental Table 1) were designed using Primer Express Software (Applied Biosciences). For the analysis, 100 ng of total RNA was used. Each RNA sample was run in duplicate, and the mean value was used to calculate the gene expression level. For Western protein analysis, 200 µl of homogenization buffer (160 NaCl, 20 Trizma (Tris base), 1 EDTA, 1 EGTA, 1 dithiothreitol, 1% Triton X-100, 0.1% SDS, 1 sodium orthovanadate, 1 sodium fluoride, 1 phenylmethylsulfonyl fluoride, 0.5 µg/ml leupeptin, and 0.5 µg/ml pepstatin A) was added to 20 mg of powdered tissue. After homogenization for 15 min on ice, the samples were transferred to microcentrifuge tubes and rotated on a rocking platform for 30 min in the cold room. After centrifugation for 60 min at 20,500 relative centrifugal fields in a refrigerated centrifuge at 4 °C, insoluble debris was removed. Forty micrograms of tissue lysates were then separated on 4–12% SDS-PAGE and immunoblotted with SREBP1 (Santa Cruz Biotechnology, catalog number 13551), ACC1 (Cell Signaling, catalog number 36620), SCD1 (Santa Cruz Biotechnology, catalog number 14720), or UCP2 (Santa Cruz Biotechnology, catalog number 6526) antibodies.
|
Statistical Analysis—Data are expressed as means ± S.E. The significance of the differences in mean values among the three groups was evaluated using the one-way analysis of variance, followed by ad hoc analysis using the (Duncan's test). Statistical analyses for the two groups were made using a two-tailed Student's t test, and p < 0.05 was considered statistically significant.
| RESULTS |
|---|
|
|
|---|
84 and 70%, respectively, in the liver. Both ASOs significantly reduced total Dgat activity in liver homogenates (Fig. 1C). Dgat1 ASO had a greater effect on total Dgat activity than Dgat2 ASO because assay conditions for total Dgat activity with 20 mM MgCl2 are optimized for DGAT1 rather than DGAT2 activity (16, 17). To exclude off-target effects of Dgat2 ASO, mRNA expression of acyl-coenzyme A:monoacylglycerol acyltransferase (Mgat) 1, 2, and 3 were tested in liver because they catalyze the synthesis of DAG from monoacylglycerol and share sequence homology with DGAT2 (38–41). In addition, they have some Dgat activity (38–41). MGAT1 mRNA expression is unaltered in the liver (ASOctrl versus Dgat2 ASO; 0.09 ± 0.01 versus 0.11 ± 0.02 arbitrary units, not significant). MGAT2 is expressed at very low levels in rat liver (barely detectable using RT-PCR), and MGAT3 is suggested to be specific to the intestine in rodents (40). Target gene expression was reduced to a similar extent in adipose tissue (90 and 87% for DGAT1 and DGAT2, respectively), but no significant changes were seen in DGAT expression in muscle (Fig. 1, D and E). There was no compensatory increase in the untargeted isoform. None of the ASOs appeared to be associated with overt toxicity as assessed by hepatic transaminase levels (Table 1) and food intake.
|
|
Dgat2 ASO Reduces Liver and Muscle Steatosis and Plasma Triglycerides—Hepatic TGs were markedly reduced by Dgat2 ASO (50% reduction, p < 0.05) but not by Dgat1 ASO treatment (Fig. 2, A and B). DAG levels were also substantially decreased by 4 weeks of Dgat2 ASO therapy (53% reduction, p < 0.05) (Fig. 2C), whereas LCCoAs were unchanged (Fig. 2D). Fasting plasma TGs and total cholesterol fell by 28 and 19%, respectively, in the Dgat2 ASO group, whereas plasma fatty acids were unchanged in fasting rats after 4 weeks of treatment (Table 1). Very low density lipoprotein and high density lipoprotein cholesterol were both substantially reduced in Dgat2 ASO-treated rats (Fig. 2E). In vitro studies in primary rat hepatocytes suggest that reduced TG synthesis is likely to be the primary mechanism for the observed reduction in liver lipids (Fig. 2, F–H), although fat oxidation was also significantly increased. In addition, muscle TG content was reduced by 33% in the Dgat2 ASO group (ASOctrl versus Dgat2; 5.67 ± 0.51 versus 3.80 ± 0.69 mg/g tissue, p < 0.05).
Dgat2 ASO Treatment Improves Hepatic Insulin Sensitivity—Fasting plasma glucose and fatty acid concentrations were similar in both groups after 4 weeks of ASO therapy, whereas plasma insulin concentrations were significantly reduced in Dgat2 ASO-treated rats (Table 1). Leptin levels were also lower in Dgat2 ASO-treated rats, but adiponectin levels were unchanged. To independently assess hepatic and peripheral (predominantly muscle) insulin sensitivity, we performed hyperinsulinemic-euglycemic clamps (including radioisotope labeled glucose infusions) in ASO-treated rats. Glucose infusion rates were significantly higher in Dgat2 ASO but not in Dgat1 ASO-treated high fat fed rats than in the ASOctrl group (Fig. 3A). The ability of insulin to suppress endogenous glucose production was significantly increased in the Dgat2 ASO group (Fig. 3B) as was insulin-stimulated peripheral glucose turnover (47% increase, see Fig. 3C). Dgat2 ASO treatment did not change whole body glycolysis (Fig. 3D) but significantly increased glycogen synthesis rates by 71% as compared with ASOctrl therapy (Fig. 3E). The increase in insulin-stimulated glucose uptake was predominantly accounted for by a 35 and 230% increase in insulin-stimulated glucose uptake in skeletal muscle (gastrocnemius) and white adipose tissue (epididymal) (Fig. 3, F and G). The ability of insulin to suppress peripheral lipolysis and decrease fatty acid concentration also serves as an indicator of adipose tissue insulin sensitivity. In comparison with the control and Dgat1 ASO groups, Dgat2 ASO treatment increased insulin-mediated suppression of lipolysis, demonstrated by significantly lower fatty acid levels during the clamp (Table 1).
|
(as reflected by an increase in the plasma membrane: cytosol ratio of PKC
), an event that we believe may be causally related to the development of hepatic insulin resistance. Dgat2 ASO therapy significantly reduced hepatic glucose production during the hyperinsulinemic phase of the hyperinsulinemiceuglycemic clamp (Fig. 4, A and B) and significantly reduced PKC
membrane translocation (Fig. 4C). These changes were associated with increased insulin-stimulated PI3K (Fig. 4D) and Akt2 activity (Fig. 4E).
|
and increase PPAR
target gene expression. In this regard, PPAR
mRNA levels were unchanged, but CPT1 mRNA and UCP2 (uncoupling protein 2) mRNA and protein levels were increased, as were plasma ketones (2.23 ± 0.12 mmol/liter versus 1.92 ± 0.06 mmol/liter in control rats), an indirect marker of hepatic fatty acid oxidation (Fig. 6, B–D). | DISCUSSION |
|---|
|
|
|---|
|
, a key transcriptional regulator of hepatic fat oxidation in rodents. Taken together, we believe that the reason DAG does not accumulate and induce hepatic insulin resistance in Dgat2 ASO-treated animals is at least in part attributable to activation of compensatory pathways in response to increased hepatocellular fatty acid content. One compensatory pathway might involve polyunsaturated fatty acid (PUFA) suppression of the lipogenic pathway by inhibiting Srebp1c expression and activity, as reflected by reduced Srebp1c target gene and protein expression (Fig. 7). Exactly how PUFAs suppress Srebp1c activity remains to be determined, but suggested mechanisms include interference with liver X receptor activity at the promoter of SREBP1c (43), effects on Srebp1c maturation, and possibly even effects on another key lipogenic regulator, carbohydrate-response element-binding protein (49). Fatty acids are also known to activate PPAR
(50), potentially accounting for the observed increase in genes involved in fat oxidation, the early increase in plasma ketones, and weight loss. As Dgat ASO therapy had no effect on Dgat expression in skeletal muscle, we believe that the improvement in insulin-stimulated peripheral glucose turnover is a consequence of reduced body weight and lower intramuscular lipid content.
|
|
activation may be causally implicated in hepatic lipid-induced insulin resistance as Dgat2 knockdown led to a significant decrease in DAG content and PKC
activation in association with improvements in insulin signaling and in vivo hepatic insulin sensitivity. PKC
activation has now been linked to fatty liver and hepatic insulin resistance in several rodent models (6, 12) and in humans (13). We have also recently shown that reducing hepatic PKC
expression in the liver of high fat-fed rats prevents the development of hepatic insulin resistance (11). Co-immunoprecipitation studies suggest that PKC
binds to the insulin receptor and inhibits its tyrosine kinase activity (11).
In summary, our study suggests that in this rat model of diet-induced NAFLD, targeting Dgat2, but not Dgat1, with antisense oligonucleotides successfully improves hepatic steatosis, hepatic insulin signaling, and in vivo hepatic insulin sensitivity. We also proposed a novel explanation for the paradoxical decrease in diacylglycerol concentrations in Dgat2 ASO-treated rats and provided further support for the notion that diacylglycerol accumulation and PKC
activation cause insulin resistance in NAFLD. It will be of great interest to see if alternative strategies for lowering hepatic diacylglycerol levels yield similar therapeutic results in patients with NAFLD and T2DM.
| FOOTNOTES |
|---|
The on-line version of this article (available at http://www.jbc.org) contains supplemental Table 1. ![]()
1 These authors contributed equally to this work. ![]()
2 Supported by the Wellcome Trust. ![]()
3 Employee of and owns stock and/or holds stock options in Isis Pharmaceuticals. ![]()
4 To whom correspondence should be addressed: TAC S269 P. O. Box 9812, Yale University School of Medicine, New Haven, CT 06536-9812. Tel.: 203-785-5447; Fax: 203-737-4059; E-mail: gerald.shulman{at}yale.edu.
5 The abbreviations used are: NAFLD, nonalcoholic fatty liver disease; ASOs, antisense oligonucleotides; ASOctrl, ASO control; CPT1, carnitine palmitoyltransferase 1; CoA, coenzyme A; DAG, diacylglycerol; DGAT, acyl-CoA: diacylglycerol acyltransferase; FFA, free fatty acid; HFD, high fat diet; LCCoA, long chain acyl CoA; LPA, lysophosphatidic acid; mtGPAT, mitochondrial acyl-CoA:glycerol-sn-3-phosphate acyltransferase; PPAR
, peroxisome proliferator-activated receptor
; PKC, protein kinase C; PUFAs, polyunsaturated fatty acids; SCD1, stearoyl-CoA desaturase 1; SREBP1c, sterol-regulatory element-binding protein 1c; TG, triglyceride; T2DM, type 2 diabetes mellitus; RT, reverse transcription; HPLC, high pressure liquid chromatography; 2-DG-6-P, 2-[14C]deoxyglucose 6-phosphate; PI3K, phosphatidylinositol 3-kinase. ![]()
6 X. X. Yu, S. K. Pandey, J. G. Geisler, S. Bhanot, and B. P. Monia, unpublished observations. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Shi and D. Cheng Beyond triglyceride synthesis: the dynamic functional roles of MGAT and DGAT enzymes in energy metabolism Am J Physiol Endocrinol Metab, July 1, 2009; 297(1): E10 - E18. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Deevska, K. A. Rozenova, N. V. Giltiay, M. A. Chambers, J. White, B. B. Boyanovsky, J. Wei, A. Daugherty, E. J. Smart, M. B. Reid, et al. Acid Sphingomyelinase Deficiency Prevents Diet-induced Hepatic Triacylglycerol Accumulation and Hyperglycemia in Mice J. Biol. Chem., March 27, 2009; 284(13): 8359 - 8368. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kotronen, T. Seppanen-Laakso, J. Westerbacka, T. Kiviluoto, J. Arola, A.-L. Ruskeepaa, M. Oresic, and H. Yki-Jarvinen Hepatic Stearoyl-CoA Desaturase (SCD)-1 Activity and Diacylglycerol but Not Ceramide Concentrations Are Increased in the Nonalcoholic Human Fatty Liver Diabetes, January 1, 2009; 58(1): 203 - 208. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Stefan, K. Kantartzis, and H.-U. Haring Causes and Metabolic Consequences of Fatty Liver Endocr. Rev., December 1, 2008; 29(7): 939 - 960. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Villena, C. S. Choi, Y. Wang, S. Kim, Y.-J. Hwang, Y.-B. Kim, G. Cline, G. I. Shulman, and H. S. Sul Resistance to High-Fat Diet-Induced Obesity but Exacerbated Insulin Resistance in Mice Overexpressing Preadipocyte Factor-1 (Pref-1): A New Model of Partial Lipodystrophy Diabetes, December 1, 2008; 57(12): 3258 - 3266. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-L. E. Yen, S. J. Stone, S. Koliwad, C. Harris, and R. V. Farese Jr. Thematic Review Series: Glycerolipids. DGAT enzymes and triacylglycerol biosynthesis J. Lipid Res., November 1, 2008; 49(11): 2283 - 2301. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Brown, S. Chung, J. K. Sawyer, C. Degirolamo, H. M. Alger, T. Nguyen, X. Zhu, M.-N. Duong, A. L. Wibley, R. Shah, et al. Inhibition of Stearoyl-Coenzyme A Desaturase 1 Dissociates Insulin Resistance and Obesity From Atherosclerosis Circulation, September 30, 2008; 118(14): 1467 - 1475. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Anderson and J. Borlak Molecular Mechanisms and Therapeutic Targets in Steatosis and Steatohepatitis Pharmacol. Rev., September 1, 2008; 60(3): 311 - 357. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Gomez-Valades, A. Mendez-Lucas, A. Vidal-Alabro, F. X. Blasco, M. Chillon, R. Bartrons, J. Bermudez, and J. C. Perales Pck1 Gene Silencing in the Liver Improves Glycemia Control, Insulin Sensitivity, and Dyslipidemia in db/db Mice Diabetes, August 1, 2008; 57(8): 2199 - 2210. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Singhal, R. T. Patel, Y. Qi, Y.-S. Lee, and R. S. Ahima Loss of resistin ameliorates hyperlipidemia and hepatic steatosis in leptin-deficient mice Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E331 - E338. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. X. Yu, S. F. Murray, L. Watts, S. L. Booten, J. Tokorcheck, B. P. Monia, and S. Bhanot Reduction of JNK1 expression with antisense oligonucleotide improves adiposity in obese mice Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E436 - E445. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Adiels, S.-O. Olofsson, M.-R. Taskinen, and J. Boren Overproduction of Very Low-Density Lipoproteins Is the Hallmark of the Dyslipidemia in the Metabolic Syndrome Arterioscler. Thromb. Vasc. Biol., July 1, 2008; 28(7): 1225 - 1236. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Minahk, K.-W. Kim, R. Nelson, B. Trigatti, R. Lehner, and D. E. Vance Conversion of Low Density Lipoprotein-associated Phosphatidylcholine to Triacylglycerol by Primary Hepatocytes J. Biol. Chem., March 7, 2008; 283(10): 6449 - 6458. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. X. Yu, S. K. Pandey, S. L. Booten, S. F. Murray, B. P. Monia, and S. Bhanot Reduced adiposity and improved insulin sensitivity in obese mice with antisense suppression of 4E-BP2 expression Am J Physiol Endocrinol Metab, March 1, 2008; 294(3): E530 - E539. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Strissel, Z. Stancheva, H. Miyoshi, J. W. Perfield II, J. DeFuria, Z. Jick, A. S. Greenberg, and M. S. Obin Adipocyte Death, Adipose Tissue Remodeling, and Obesity Complications Diabetes, December 1, 2007; 56(12): 2910 - 2918. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |