Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.C700065200 on July 11, 2007

J. Biol. Chem., Vol. 282, Issue 35, 25177-25181, August 31, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/35/25177    most recent
C700065200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suzuki, S.
Right arrow Articles by Sakurai, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suzuki, S.
Right arrow Articles by Sakurai, H.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Constitutive Activation of TAK1 by HTLV-1 Tax-dependent Overexpression of TAB2 Induces Activation of JNK-ATF2 but Not IKK-NF-{kappa}B*

Shunsuke Suzuki{ddagger}, Pattama Singhirunnusorn{ddagger}, Akinori Mori{ddagger}, Shoji Yamaoka§, Isao Kitajima||, Ikuo Saiki{ddagger}, and Hiroaki Sakurai{ddagger}1

From the {ddagger}Division of Pathogenic Biochemistry, Institute of Natural Medicine, University of Toyama, Toyama 930-0194, Japan, §Department of Molecular Virology, Graduate School of Medicine, Tokyo Medical and Dental University, Tokyo 113-8519, Japan, Department of Clinical and Molecular Pathology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194, Japan, and ||21st Century Center of Excellence Program, University of Toyama, Toyama 930-0194, Japan

Received for publication, April 9, 2007 , and in revised form, June 28, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
HTLV-1 Tax oncoprotein induces persistent activation of the transcription factor NF-{kappa}B and CREB (cAMP-response element-binding protein)/ATF. Transforming growth factor-beta-activated kinase 1 (TAK1) has been shown to play a critical role in these transcription factors. Here, we found that TAK1 was constitutively activated in Tax-positive HTLV-1-transformed T cells. Tax induced persistent overexpression of TAK1-binding protein 2 (TAB2), but not TAB3, which is essential for TAK1 activation. Surprisingly, TAK1 was not involved in the activation of NF-{kappa}B. On the other hand, JNK and p38 mitogen-activated protein kinases were activated by TAK1. In addition, ATF2, but not CREB, was a target for the TAK1-JNK pathway, and p38 negatively regulated TAK1 activity through TAB1 phosphorylation. These results indicate that Tax-mediated TAK1 activation is important for the activation of ATF2 rather than NF-{kappa}B.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Human T-cell lymphotropic virus type 1 (HTLV-1)2 is known as the cause of adult T-cell leukemia/lymphoma (ATLL). Infection with this virus results in the activation of several transcriptional factors including NF-{kappa}B and CREB in host CD4+ T cells. In particular, the activation of NF-{kappa}B correlates with the expression of HTLV-1-derived oncoprotein Tax (1). It has been reported that Tax associates with IKK{gamma} to activate I{kappa}B kinase (IKK) complex (2).

Transforming growth factor-beta-activated kinase 1 (TAK1) is one of the most characterized MAPK kinase kinase family members and is activated by various cellular stresses, including tumor necrosis factor-{alpha} (TNF-{alpha}) and interleukin-1 (3–13). It has recently been shown that TAK1 participates in diverse cellular functions, including activation and differentiation of T lymphocytes (14–17). TAK1 functions as an upstream stimulatory molecule of the JNK, p38, and IKK signaling pathways. We have reported that phosphorylation at Thr-187 is essential for TAK1 activation, and TAK1-binding protein 1 (TAB1) and TAB2 are important for inducing phosphorylation (18). Cheung et al. (12) report that the association of TAB1 with p38{alpha} negatively regulates TAK1 kinase activity by phosphorylating TAB1 at Ser-423, Thr-431, and Ser-438. On the other hand, TAB2 functions as an adaptor protein to recruit TAK1 to TRAF2 (TNF-{alpha} receptor-associated factor) and TRAF6 in the TNF-{alpha} and interleukin-1 signaling pathways, respectively (8, 11, 13). Recently, TAB3 has been reported as a new TAK1-binding protein (13). This molecule has a structure similar to TAB2 and functions as a supportive protein of TAB2.

Various alternations of intracellular functions by infecting HTLV-1 and Tax expression result in the onset of ATLL; however, the molecular mechanisms of these alternations are still unclear. The present study investigated whether TAK1 is involved in Tax-dependent NF-{kappa}B activation and other signaling pathways in HTLV-1-transformed cells.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Antibodies and Reagents—Antibodies against TAK1 (M-579), TAB1 (C-20), TAB2 (K-20), p65 (C-20-G), IKK{alpha} (H-744), IKK{gamma} (FL-419), I{kappa}B{alpha} (C-21), HA tag (Y-11-G), and proliferating cell nuclear antigen (PCNA; PC-10) were obtained from Santa Cruz Biotechnology. Antibodies against phospho-JNK (Thr-183/Tyr-185), phospho-p38 (Thr-180/Tyr-182), phospho-p65 (Ser-536) (93H1), phospho-I{kappa}B{alpha} (Ser-32/Ser-36), phospho-ATF2 (Thr-69/Thr-71), phospho CREB (Ser-133), ATF2 (20F1), and CREB were purchased from Cell Signaling Technology. Phospho-specific anti-TAK1 (Thr-187) and anti-TAB1 (Ser-438) antibodies are described previously (12, 18). Antibody against TAB3 was generated by immunizing rabbits with the synthetic peptide corresponding to amino acids 635–648 of human TAB3. Antibody against Tax was described previously (19). SB203580, SP600125, and IKK inhibitor VI were obtained from Merck Biosciences. 5Z-7-Oxozeaenol (20), a selective TAK1 inhibitor, was a gift from Chugai Pharmaceutical Co. Ltd. All of the chemical inhibitors were dissolved in Me2SO, and the final concentration of Me2SO was less than 0.5%.

Cell Culture—HTLV-1-transformed cells (19) were maintained in RPMI 1640 supplemented with 10% fetal calf serum, 100 units/ml penicillin, and 100 µg/ml streptomycin at 37 °C in 5% CO2.

Immunoblotting—Cell lysates, prepared as described previously (6), were resolved by SDS-PAGE and transferred to Immobilon-P nylon membrane (Millipore). The membrane was treated with BlockAce (Dainippon Pharmaceutical Co. Ltd., Suita, Japan) overnight at 4 °C and probed with primary antibodies as described above. Antibodies were detected using horseradish peroxidase-conjugated anti-rabbit, anti-mouse, anti-goat, and anti-sheep IgG (Dako), and visualized with the ECL system (Amersham Biosciences).

Immunoprecipitation—Cell lysates were diluted with an equal volume of dilution buffer (20 mM HEPES, pH 7.7, 2.5 mM MgCl2, 0.1 mM EDTA, 0.05% Triton X-100, 20 mM beta-glycerophosphate, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, 10 µg/ml aprotinin, and 10 µg/ml leupeptin). After centrifugation, lysates were immunoprecipitated with anti-HA tag antibody (as negative control) or anti-TAB2 antibody or anti-TAB3 antibody on ice for 1.5 h and then rotated with protein G-Sepharose (Amersham Biosciences) at 4 °C for 1.5 h. The Sepharose beads were washed three times with wash buffer (1:1 mixture of whole cell lysate buffer and dilution buffer).

RNA Interference—Cells were electroporated with each siRNA for TAK1, TAB2, Tax, JNK1/2, p38{alpha}, and firefly luciferase (Luc) using the Amaxa electroporation system. Duplex siRNAs with a two-nucleotide overhang at the 3'-end of the sequence were designed at iGENE Therapeutics and synthesized by Hokkaido System Science Co. The target sequences were as follows: TAK1, UGGCUUAUCUUACACUGGA (TAK1–1) and GAGAUCGACUACAAGGAGA (TAK1–2); negative control of TAK1–1, UGGCUUAUCUCACCCUGGA (TAK1-m); TAB2, CAGAAUGGAACGACUUCAAAGAGAA; Tax, ACAAGCGAAUAGAAGAACUCCUCUA; p38{alpha}, GCAUUACAACCAGACAGUUGAUAUU; JNK1 (MAPK8), GCAGUUAGAUGAAAGGGAACACACA; JNK2 (MAPK9), CCAGUUGGAAGAAAGAGAACAUGCA; and firefly luciferase (GL2), CGUACGCGGAAUACUUCGA.

Real-time RT-PCR—Total RNAs were prepared using the RNeasy Mini kit (Qiagen). First-strand cDNAs were synthesized by SuperScript II reverse transcriptase (Invitrogen). The cDNAs were amplified quantitatively using SYBR Green PCR mix (TaKaRa). The primer sequences were as follows: TAB2, forward (5'-GCATTCTGGCTGGGTAT-3') and reverse (5'-GCTGATTTGGCTGTTGA-3'); TAB3, forward (5'-TGTACTCCATCACCATCTCCT-3') and reverse (5'-TGCTTTGCTAACCTCTCCAT-3'); and GAPDH, forward (5'-GGTGAAGGTCGGTGTGAACGGATTT-3') and reverse (5'-GATGCCAAAGTTGTCATGGATG ACC-3'). Real-time quantitative RT-PCR was performed using a Prism 7300 sequence detection system (Applied Biosystems). All data were normalized to GAPDH mRNA.

Electrophoretic Mobility Shift Assay—Nuclear extracts were prepared from HuT-102 cells as described previously (21) and probed with 32P-labeled consensus {kappa}B and Oct-1 sites. The protein-DNA complexes were separated on 4% PAGE as described previously (21).


Figure 1
View larger version (72K):
[in this window]
[in a new window]

  		FIGURE 1.
Activation of intracellular signals in HTLV-1-transformed cells. A and B, cell lysates were immunoblotted with the indicated antibodies. Jurkat cells were stimulated with 100 ng/ml 12-O-tetradecanoylphorbol-13-acetate (TPA) and 0.5 µM A23187 for 10 min (lane 2). IKK activity was measured by in vitro kinase assay using purified IKKs with anti-IKK{alpha} antibody.

 
Cell Viability Assay—HuT-102 cells cultured for 54 h with 5Z-7-oxozeaenol or IKK inhibitor VI. Cell viability was measured using a Cell Titer-Glo kit (Promega).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Tax-induced Activation of NF-{kappa}B and CREB/ATF—We first investigated the relationship between the activation of intracellular signals and Tax expression in HTLV-1 infected cells. As shown in Fig. 1A, Tax expression correlated with activation of the IKK-NF-{kappa}B pathway. Constitutive IKK kinase activity correlated with the phosphorylation of p65 at Ser-536 and I{kappa}B{alpha} at Ser-32/Ser-36 (Fig. 1A). In addition, JNK, p38, CREB, ATF1, and ATF2 were also activated in Tax-expressing T cells (Fig. 1B).

Tax-dependent TAK1 Activation and TAB2 Expression—Although Tax interacts with IKK{gamma} (2), it remains unknown how it activates the IKK complex. Here, we hypothesized that Tax recruits the upstream molecule to activate IKK. TAK1 is a potential candidate for this molecule as it has been shown to be an IKK kinase in several cells including splenic T lymphocytes. We therefore investigated whether Tax could activate TAK1 in HTLV-1-transformed cells. As shown in Fig. 2A, the phosphorylation of TAK1 at Thr-187, a critical site for TAK1 activation, was promoted selectively in Tax-positive cells (Hut-102 and MT-2). Interestingly, in these cells, the expression of TAB2, but not TAB3, increased at the both protein and mRNA levels (Fig. 2, A and B). In addition, the shifted band of TAB1 on SDS-PAGE was detected in Tax-positive cells, although the protein expression levels were comparable. Immunoprecipitation with anti-TAB2 or TAB3 antibodies revealed increased formation of the active TAK1 complex with TAB1 and TAB2 but not TAB3. Furthermore, knockdown of Tax by siRNA decreased TAB2 expression as well as TAK1 activation in HuT-102 cells (Fig. 2C). In addition, down-regulation of TAB2 led to decreased phosphorylation of TAK1 without affecting Tax protein expression. These results indicate that Tax activates TAK1 by increasing TAB2 expression at the endogenous level.


Figure 2
View larger version (80K):
[in this window]
[in a new window]

  		FIGURE 2.
Tax and TAB2 are essential for TAK1 activation in HTLV-1-transformed cells. A, cell lysates were immunoprecipitated with anti-TAB2 and anti-TAB3 antibodies. Whole cell lysates and each immunoprecipitated sample (IP) were immunoblotted (IB) with the indicated antibodies. B, total RNAs were extracted from each HTLV-1-transformed cell. RNA levels were measured by real-time RT-PCR for TAB2, TAB3, and GAPDH. ED, ED40515(–) C, HuT-102 cells were electroporated with each siRNA (5 µM). After incubation at 37 °C in 5% CO2 for 60 h, cell lysates were extracted and immunoblotted with the indicated antibodies.

 
TAK1 Activation Is Important for the Activation of MAPKs but Not of NF-{kappa}B—To examine whether activated TAK1 causes NF-{kappa}B activation, we evaluated the effect of 5Z-7-oxozeaenol, a specific inhibitor for TAK1, on the downstream signaling pathways. Although treatment with the inhibitor resulted in a rapid decrease in the phosphorylation of TAK1 at 3–12 h (Fig. 3A), the phosphorylation of NF-{kappa}B p65 was not affected in HuT-102 and MT-2 cells (Fig. 3B). On the other hand, TAK1 inhibitor suppressed the activation of JNK and p38 (Fig. 3B). In contrast, a specific IKKbeta inhibitor blocked selectively the phosphorylation of NF-{kappa}B p65 (Fig. 3B). This correlated with the fact that TAK1 complex did not physiologically associate with Tax-IKK complex (Fig. 3C). Similarly, RNA interference (RNAi) of TAK1 suppressed the activation of JNK and p38 but not NF-{kappa}B (Fig. 3D). The constitutive IKK kinase activity and the DNA binding activity of NF-{kappa}B were not affected by inactivation of TAK1 by RNAi (Fig. 3, D and E). Moreover, although IKK inhibitor induced a severe apoptotic response, a higher concentration of TAK1 inhibitor did not induce cell death (Fig. 3F). These results clearly demonstrated that Tax-dependent TAK1 activation is independent of NF-{kappa}B activation but is important for the activation of stress-activated MAPKs.

Activation of ATF2 by TAK1 through JNK1—To characterize the physiological role of activated TAK1 in HTLV-1-transformed cells, we next investigated the effects of TAK1 kinase activity blockade on the CREB/ATF family of transcription factors. Both 5Z-7-oxozeaenol and TAK1 siRNA suppressed the constitutive phosphorylation of ATF2, but not of CREB and ATF1 (Fig. 4, A and B). A JNK-specific inhibitor, SP600125, also inhibited the signal leading to ATF2. We further clarify the role of JNK1 and JNK2 by RNAi and found that JNK1 transduced mainly the TAK1 signal to ATF2 activation (Fig. 4D). These results indicate that TAK1 regulates the activation of ATF2 via JNK1 activation.


Figure 3
View larger version (61K):
[in this window]
[in a new window]

  		FIGURE 3.
TAK1 activation is essential for the activation of MAPKs, but not NF-{kappa}B, in Tax-expressed cells. A, HuT-102 cells were treated with 100 nM 5Z-7-oxozeaenol for the indicated time. Cell lysates were immunoprecipitated with anti-TAB2 antibody. Immunoprecipitated samples (IP) were immunoblotted with the indicated antibodies. B, HuT-102 and MT-2 cells were treated with 0.1 µM 5Z-7-oxozeaenol or 0.3 µM IKK inhibitor VI for 3 h. Cell lysates were immunoblotted with the indicated antibody as determined. C, HuT-102 cells were immunoprecipitated with anti-TAB2, anti-HA, anti-IKK{gamma} antibodies. Each immunoprecipitated sample was immunoblotted with indicated antibodies. D, HuT-102 cells were electroporated with each siRNA (5 µM). After incubation at 37 °C in 5% CO2 for 60 h, cell lysates were extracted and immunoblotted with the indicated antibodies. IKK activity was measured by in vitro kinase assay using purified IKK complex with anti-IKK{gamma} antibody. E, HuT-102 cells were electroporated with each siRNA (5 µM). After incubation at 37 °C in 5% CO2 for 60 h, nuclear extracts were prepared. An electrophoretic mobility shift assay (EMSA) was carried out using 32P-labled oligonucleotide probes containing consensus{kappa}B and Oct-1 sites. F, HuT-102 cells were treated with 5Z-7-oxozeaenol (0.1 or 0.9 µM) or 3 µM IKK inhibitor VI when seeded in a 3.5-cm dish. After incubation at 37 °C, 5% CO2 for 54 h, cell viability was measured using Cell Titer-Glo kit.

 
TAK1 Is Negatively Regulated by p38-mediated TAB1 Phosphorylation—On the other hand, a p38 inhibitor, SB203580, and siRNA against p38{alpha} enhanced the JNK-ATF signal (Fig. 4, C and E). It has been reported that the association of TAB1 with p38{alpha} negatively regulates TAK1 kinase activity by phosphorylating TAB1. We therefore hypothesized that the inhibition of p38 promoted the activation of TAK1 by canceling TAB1-dependent feedback inhibition. As expected, p38 inhibitor increased TAK1 activation with decreased TAB1 phosphorylation (Fig. 4F). These results suggest that p38 maintains the level of TAK1 activity by controlling the TAB1-mediated negative feedback mechanism.


Figure 4
View larger version (55K):
[in this window]
[in a new window]

  		FIGURE 4.
Identification of TAK1-regulated signaling pathways in Tax-expressed cells. A, HuT-102 and MT-2 cells were treated with 100 nM 5Z-7-oxozeaenol for 3 h. Cell lysates were immunoblotted with the indicated antibodies. B, HuT-102 cells were electroporated with each siRNA (5 µM). After incubation at 37 °C, 5% CO2 for 60 h, cell lysates were extracted and immunoblotted with the indicated antibodies. C, HuT-102 cells were treated with 20 µM SB203580 (SB), 20 µM SP600125 (SP), and 100 nM 5Z-7-oxozeaenol (OXO) for 1 h. Cell lysates were immunoblotted with the indicated antibodies. D and E, HuT-102 cells were electroporated with each siRNA (1 µM). After incubation at 37 °C, 5% CO2 for 60 h, cell lysates were extracted and immunoblotted with the indicated antibodies. F, HuT-102 cells were treated with 20 µM SB203580 for 1 h. Cell lysates were immunoprecipitated (IP) with anti-TAB2 antibody. Whole cell lysates and each immunoprecipitated sample were immunoblotted with the indicated antibodies.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Constitutive activation of NF-{kappa}B is a typical pathological alteration in several cancer cells including ATLL cells. We reported previously that IKK phosphorylates p65 at Ser-536 (22). In the present study, enhanced phosphorylation of p65 was observed in Tax-positive cells, suggesting that p65 phosphorylation will be a useful marker for detecting the constitutive activation of NF-{kappa}B in cancer cells. We also found that TAK1 is constitutively activated through Tax-mediated overexpression of TAB2 (Fig. 2A). TAK1 has been shown to play a critical role in NF-{kappa}B activation in response to various extracellular stimuli including T cell receptor activation (5, 7, 9–11, 15, 23). Therefore, we hypothesized that Tax-dependent activation of TAK1 might induce IKK activation; however, our data did not support this hypothesis (Fig. 2C). Wu and Sun (24) recently reported that TAK1 is involved in Tax-induced activation of NF-{kappa}B; however, no direct evidence of the role of TAK1 in Tax induction of NF-{kappa}B in HTLV-1-transformed cells was shown. In contrast, this led to the conclusion of direct blockade of TAK1 kinase activity using both chemical inhibitor and siRNA in HTLV-1-transformed cells. They also showed that TAK1 associates with Tax-IKK complex in SLB-1 cells (Tax-positive HTLV-1-transformed cells). We also observed constitutive activation of TAK1 in the cell line (data not shown); however, the association of TAK1 with the Tax-IKK complex could not be detected in HuT-102 cells (Fig. 3C). Consistent with our data, Ghoda et al. (25) reported that Tax is not able to induce IKK phosphorylation in TAK1–/– MEFs. Further study will be necessary to settle this issue; however, we currently believe that Tax-dependent IKK activation is regulated by a factor other than TAK1. Recently, protein phosphatase 2A has been reported as a candidate for this factor (26).

The JNK pathway has been widely accepted as another main signal triggered by activated TAK1. It should be noted that TAK1 is essential for activation of the JNK-ATF2 pathway in HTLV-1-infected cells. RNAi experiment also revealed that JNK1, but not JNK2, is essential for activation of ATF2. In addition, persistent activation of p38{alpha} negatively regulated the TAK1-JNK1-ATF2 pathway by phosphorylating TAB1. Moreover, the Wnt/beta-catenin pathway is known as a target for TAK1 (27, 28); however, TAK1 inhibitor had no inhibitory effect on the stable expression of beta-catenin in HTLV-1-infected cells (data not shown). Collectively, we claim that the constitutive activation of TAK1 led to the activation of stress-activated MAPKs but not NF-{kappa}B.

It has been reported that the expressions of various genes, including cIAP2, CCR6, CCR4, CXCR4, and STAT5, are up-regulated in Tax-positive ATLL cells compared with Tax-negative T cells. We therefore assessed the effects of TAK1 knockdown on the expression of these genes; however, no inhibitory effect was observed (data not shown). In contrast, knockdown of NF-{kappa}B p65 resulted in the down-regulation of cIAP2 gene expression (data not shown). This was correlated with the fact that IKK inhibitor, but not TAK1 inhibitor, induced cell death (Fig. 3E). Microarray analysis will help our understanding of the physiological function of activated TAK1 in HTLV-1-transformed cells.

Another important finding in the present study is that TAB2, but not TAB3, is overexpressed in a Tax-dependent fashion. TAB2 has been characterized as an adaptor protein that regulates the activation of TAK1. Interestingly, it has recently been reported that TAB2 localizes in the nucleus and is able to associate with a transcriptional co-repressor NcoR, an epidermal growth factor receptor family (ErbB4), and nuclear receptors such as androgen receptor (29, 30). These reports suggest that TAB2 has several potential physiological functions apart from TAK1 activation. Therefore, further study from the viewpoint of TAB2 overexpression, including analysis of the transcriptional mechanism of TAB2 expression and a search for its associate proteins in HTLV-1-infected cells, will shed light on the pathophysiological importance of our findings. In addition, it is interesting to speculate whether TAB2 is overexpressed in other cancer cells.

In summary, we have provided a new insight into the pathophysiological function of TAK1 in HTLV-1-infected T cells. TAK1 has also been shown to be an oncoprotein component of the Epstein-Barr virus latent membrane protein 1 complex (31, 32). These findings altogether raise the possibility that TAK1 is a key molecule in virus-related oncogenesis; however, virus infection and oncoproteins dramatically change the intracellular environment. Further basic and clinical investigations will be essential in exploring this possibility.


   FOOTNOTES
 
* This work was supported in part by Grant-in-aid (C)17590055 for Scientific Research; the 21st Century Center of Excellence Program; and the Cooperative Link of Unique Science and Technology for Economy Revitalization from the Ministry of Education, Culture, Sports, Science and Technology, Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Div. of Pathogenic Biochemistry, Inst. of Natural Medicine, University of Toyama, 2630 Sugitani, Toyama 930-0194, Japan. Tel.: 81-76-434-7636, Fax: 81-76-434-5058; E-mail: hsakurai{at}inm.u-toyama.ac.jp.

2 The abbreviations used are: HTLV-1, human T-cell lymphotropic virus type 1; TAK1, transforming growth factor-beta-activated kinase 1; TAB, TAK1-binding protein; JNK, c-jun N-terminal kinase; ATF, activating transcription factor; NF-{kappa}B, nuclear factor-{kappa}B; IKK, I{kappa}B kinase; TNF-{alpha}, tumor necrosis factor-{alpha}; RNAi, RNA interference; siRNA, small interfering RNA; MAPK, mitogen-activated protein kinase; CREB, cAMP-response element-binding protein; ATLL, adult T-cell leukemia/lymphoma; HA, hemagglutinin; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Back


   ACKNOWLEDGMENTS
 
We are grateful to Drs. M. Nishihara, M. Maeda, and P. Cohen for generous gifts of 5Z-7-oxozeaenol, MT-1 cells, and phospho-TAB1 antibody, respectively.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kitajima, I., Shinohara, T., Bilakovics, J., Brown, D. A., Xu, X., and Nerenberg, M. (1992) Science 258, 1792–1795[Abstract/Free Full Text]
  2. Jin, D. Y., Giordano, V., Kibler, K. V., Nakano, H., and Jeang, K. T. (1999) J. Biol. Chem. 274, 17402–17405[Abstract/Free Full Text]
  3. Shirakabe, K., Yamaguchi, K., Shibuya, H., Irie, K., Matsuda, S., Moriguchi, T., Gotoh, Y., Matsumoto, K., and Nishida, E. (1997) J. Biol. Chem. 272, 8141–8144[Abstract/Free Full Text]
  4. Moriguchi, T., Kuroyanagi, N., Yamaguchi, K., Gotoh, Y., Irie, K., Kano, T., Shirakabe, K., Muro, Y., Shibuya, H., Matsumoto, K., Nishida, E., and Hagiwara, M. (1996) J. Biol. Chem. 271, 13675–13679[Abstract/Free Full Text]
  5. Ninomiya Tsuji, J., Kishimoto, K., Hiyama, A., Inoue, J., Cao, Z., and Matsumoto, K. (1999) Nature 398, 252–256[CrossRef][Medline] [Order article via Infotrieve]
  6. Sakurai, H., Miyoshi, H., Toriumi, W., and Sugita, T. (1999) J. Biol. Chem. 274, 10641–10648[Abstract/Free Full Text]
  7. Sakurai, H., Shigemori, N., Hasegawa, K., and Sugita, T. (1998) Biochem. Biophys. Res. Commun. 243, 545–549[CrossRef][Medline] [Order article via Infotrieve]
  8. Takaesu, G., Kishida, S., Hiyama, A., Yamaguchi, K., Shibuya, H., Irie, K., Ninomiya Tsuji, J., and Matsumoto, K. (2000) Mol. Cel. 5, 649–658[CrossRef][Medline] [Order article via Infotrieve]
  9. Wang, C., Deng, L., Hong, M., Akkaraju, G. R., Inoue, J., and Chen, Z. J. (2001) Nature 412, 346–351[CrossRef][Medline] [Order article via Infotrieve]
  10. Jiang, Z., Ninomiya Tsuji, J., Qian, Y., Matsumoto, K., and Li, X. (2002) Mol. Cell. Biol. 22, 7158–7167[Abstract/Free Full Text]
  11. Takaesu, G., Surabhi, R. M., Park, K. J., Ninomiya Tsuji, J., Matsumoto, K., and Gaynor, R. B. (2003) J. Mol. Biol. 326, 105–115[CrossRef][Medline] [Order article via Infotrieve]
  12. Cheung, P. C., Campbell, D. G., Nebreda, A. R., and Cohen, P. (2003) EMBO J. 22, 5793–5805[CrossRef][Medline] [Order article via Infotrieve]
  13. Ishitani, T., Takaesu, G., Ninomiya Tsuji, J., Shibuya, H., Gaynor, R. B., and Matsumoto, K. (2003) EMBO J. 22, 6277–6288[CrossRef][Medline] [Order article via Infotrieve]
  14. Sun, L., Deng, L., Ea, C. K., Xia, Z. P., and Chen, Z. J. (2004) Mol. Cell 14, 289–301[CrossRef][Medline] [Order article via Infotrieve]
  15. Wan, Y. Y., Chi, H., Xie, M., Schneider, M. D., and Flavell, R. A. (2006) Nat. Immunol. 7, 851–858[CrossRef][Medline] [Order article via Infotrieve]
  16. Liu, H. H., Xie, M., Schneider, M. D., and Chen, Z. J. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 11677–11682[Abstract/Free Full Text]
  17. Sato, S., Sanjo, H., Tsujimura, T., Ninomiya Tsuji, J., Yamamoto, M., Kawai, T., Takeuchi, O., and Akira, S. (2006) Int. Immunol. 18, 1405–1411[Abstract/Free Full Text]
  18. Singhirunnusorn, P., Suzuki, S., Kawasaki, N., Saiki, I., and Sakurai, H. (2005) J. Biol. Chem. 280, 7359–7368[Abstract/Free Full Text]
  19. Miura, H., Maeda, M., Yamamoto, N., and Yamaoka, S. (2005) Exp. Cell Res. 308, 29–40[CrossRef][Medline] [Order article via Infotrieve]
  20. Ninomiya Tsuji, J., Kajino, T., Ono, K., Ohtomo, T., Matsumoto, M., Shiina, M., Mihara, M., Tsuchiya, M., and Matsumoto, K. (2003) J. Biol. Chem. 278, 18485–18490[Abstract/Free Full Text]
  21. Sakurai, H., Kurus, R., Sano, K., Tsuchiya, T., and Tsuda, M. (1992) J. Neurochem. 59, 2067–2075[Medline] [Order article via Infotrieve]
  22. Sakurai, H., Chiba, H., Miyoshi, H., Sugita, T., and Toriumi, W. (1999) J. Biol. Chem. 274, 30353–30356[Abstract/Free Full Text]
  23. Jiang, Z., Zamanian Daryoush, M., Nie, H., Silva, A. M., Williams, B. R., and Li, X. (2003) J. Biol. Chem. 278, 16713–16719[Abstract/Free Full Text]
  24. Wu, X., and Sun, S. C. (2007) EMBO Rep. 8, 510–515[CrossRef][Medline] [Order article via Infotrieve]
  25. Gohda, J., Irisawa, M., Tanaka, Y., Sato, S., Ohtani, K., Fujisawa, J., and Inoue, J. (2007) Biochem. Biophys. Res. Commun. 357, 225–230[CrossRef][Medline] [Order article via Infotrieve]
  26. Hong, S., Wang, L. C., Gao, X., Kuo, Y. L., Liu, B., Merling, R., Kung, H. J., Shih, H. M., and Giam, C. Z. (2007) J. Biol. Chem. 282, 12119–12126[Abstract/Free Full Text]
  27. Ishitani, T., Kishida, S., Hyodo Miura, J., Ueno, N., Yasuda, J., Waterman, M., Shibuya, H., Moon, R. T., Ninomiya Tsuji, J., and Matsumoto, K. (2003) Mol. Cell. Biol. 23, 131–139[Abstract/Free Full Text]
  28. Ishitani, T., Ninomiya Tsuji, J., Nagai, S., Nishita, M., Meneghini, M., Barker, N., Waterman, M., Bowerman, B., Clevers, H., Shibuya, H., and Matsumoto, K. (1999) Nature 399, 798–802[CrossRef][Medline] [Order article via Infotrieve]
  29. Schlessinger, J., and Lemmon, M. A. (2006) Cell 127, 45–48[CrossRef][Medline] [Order article via Infotrieve]
  30. Zhu, P., Baek, S. H., Bourk, E. M., Ohgi, K. A., Garcia Bassets, I., Sanjo, H., Akira, S., Kotol, P. F., Glass, C. K., Rosenfeld, M. G., and Rose, D. W. (2006) Cell 124, 615–629[CrossRef][Medline] [Order article via Infotrieve]
  31. Uemura, N., Kajino, T., Sanjo, H., Sato, S., Akira, S., Matsumoto, K., and Ninomiya Tsuji, J. (2006) J. Biol. Chem. 281, 7863–7872[Abstract/Free Full Text]
  32. Wan, J., Sun, L., Mendoza, J. W., Chui, Y. L., Huang, D. P., Chen, Z. J., Suzuki, N., Suzuki, S., Yeh, W. C., Akira, S., Matsumoto, K., Liu, Z. G., and Wu, Z. (2004) Mol. Cell. Biol. 24, 192–199[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Cancer Res.Home page
V. T. Mihaylova, A. M. Green, M. Khurgel, O. J. Semmes, and G. M. Kupfer
Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage
Cancer Res., June 15, 2008; 68(12): 4843 - 4852.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
N. Shembade, N. S. Harhaj, M. Yamamoto, S. Akira, and E. W. Harhaj
The Human T-Cell Leukemia Virus Type 1 Tax Oncoprotein Requires the Ubiquitin-Conjugating Enzyme Ubc13 for NF-{kappa}B Activation
J. Virol., December 15, 2007; 81(24): 13735 - 13742.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/35/25177    most recent
C700065200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suzuki, S.
Right arrow Articles by Sakurai, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suzuki, S.
Right arrow Articles by Sakurai, H.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement