Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M703840200 on July 10, 2007

J. Biol. Chem., Vol. 282, Issue 36, 26089-26100, September 7, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/36/26089    most recent
M703840200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Knecht, W.
Right arrow Articles by Bunnett, N. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knecht, W.
Right arrow Articles by Bunnett, N. W.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Trypsin IV or Mesotrypsin and p23 Cleave Protease-activated Receptors 1 and 2 to Induce Inflammation and Hyperalgesia*Formula

Wolfgang Knecht{ddagger}1, Graeme S. Cottrell§1, Silvia Amadesi§1, Johanna Mohlin{ddagger}, Anita Skåregärde{ddagger}, Karin Gedda{ddagger}, Anders Peterson{ddagger}, Kevin Chapman, Morley D. Hollenberg, Nathalie Vergnolle||**, and Nigel W. Bunnett§2

From the {ddagger}Molecular Pharmacology and Lead Generation, AstraZeneca Research and Development, Mölndal 431 83, Sweden, the §Departments of Surgery and Physiology, University of California, San Francisco, California 94143-0660, the Department of Pharmacology and Therapeutics, and Department of Medicine, University of Calgary, Calgary, Alberta T2N 4N1, Canada, ||INSERM, U563, Centre de Physiopathologie de Toulouse Purpan, Toulouse F-310300, France, and the **Université Toulouse III Paul Sabatier, Toulouse F-31000, France

Received for publication, May 9, 2007 , and in revised form, July 5, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Although principally produced by the pancreas to degrade dietary proteins in the intestine, trypsins are also expressed in the nervous system and in epithelial tissues, where they have diverse actions that could be mediated by protease-activated receptors (PARs). We examined the biological actions of human trypsin IV (or mesotrypsin) and rat p23, inhibitor-resistant forms of trypsin. The zymogens trypsinogen IV and pro-p23 were expressed in Escherichia coli and purified to apparent homogeneity. Enteropeptidase cleaved both zymogens, liberating active trypsin IV and p23, which were resistant to soybean trypsin inhibitor and aprotinin. Trypsin IV cleaved N-terminal fragments of PAR1, PAR2, and PAR4 at sites that would expose the tethered ligand (PAR1 = PAR4 > PAR2). Trypsin IV increased [Ca2+]i in transfected cells expressing human PAR1 and PAR2 with similar potencies (PAR1, 0.5 µM; PAR2, 0.6 µM). p23 also cleaved fragments of PAR1 and PAR2 and signaled to cells expressing these receptors. Trypsin IV and p23 increased [Ca2+]i in rat dorsal root ganglion neurons that responded to capsaicin and which thus mediate neurogenic inflammation and nociception. Intraplantar injection of trypsin IV and p23 in mice induced edema and granulocyte infiltration, which were not observed in PAR –/–1(trypsin IV) and PAR –/–2 (trypsin IV and p23) mice. Trypsin IV and p23 caused thermal hyperalgesia and mechanical allodynia and hyperalgesia in mice, and these effects were absent in PAR –/–2 mice but maintained in PAR –/–1 mice. Thus, trypsin IV and p23 are inhibitor-resistant trypsins that can cleave and activate PARs, causing PAR1- and PAR2-dependent inflammation and PAR2-dependent hyperalgesia.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Trypsinogens are a diverse gene family with considerable interspecies variability. In humans, three serine protease (PRSS) genes encode trypsinogens: PRSS1 encodes trypsinogen I (cationic trypsin), PRSS2 encodes trypsinogen II (anionic trypsin), and PRSS3 encodes mesotrypsinogen (1, 2). Trypsinogen IV is a splice variant of mesotrypsinogen (3). The N-terminal sequences of mesotrypsinogen and trypsinogen IV are dissimilar, because they derive from different exons, but the predicted activated C-terminal proteases, mesotrypsin and trypsin IV, are identical (3, 4). In rats, there are two forms of anionic trypsinogen, and one cationic trypsinogen. p23 trypsinogen, like mesotrypsinogen, is a minor form within the pancreas (5).

The PRSS1 and PRSS2 gene products are major digestive enzymes. Trypsinogens I and II and small quantities of mesotrypsinogen are secreted from pancreatic acinar cells into the intestinal lumen, where enteropeptidase (enterokinase, PRSS7) cleaves these zymogens to generate active proteases that participate in digestion (6, 7). Although PRSS3 evolved late in history, by inter-chromosomal duplication that occurred after the divergence of Old World monkeys and hominids, and was maintained as an active entity (8), the function of mesotrypsin/trypsin IV are unknown. Mesotrypsinogen is only a minor component of pancreatic exocrine secretions (9). Trypsinogen IV is expressed by neurons and glial cells, mainly astrocytes, of human brain and spinal cord, as well as by epithelial cells of the human intestine, airway, and prostate, which also express enteropeptidase (3, 10–12). The physiological functions of this widely expressed protease are unknown. Trypsinogen IV has an unconventional translation initiation site at a CUG codon, with an N-terminal leucine rather than a methionine, and the N terminus may serve to regulate protein expression (13). Trypsinogen IV lacks a discernable signal peptide, and it is not known whether the enzyme is secreted and activated. However, immunoreactive trypsinogen IV has been detected in extracellular matrix of human brain, supporting the possibility of secretion at certain sites (12).

Although the physiological functions of trypsin IV/mesotrypsin and p23 remain to be discovered, several unusual features of these enzymes suggest important biological actions. Trypsin IV/mesotrypsin is resistant to polypeptide inhibitors, such as pancreatic secretory trypsin inhibitor and soybean trypsin inhibitor (SBTI),3 and can degrade these inhibitors (2, 4, 10, 14). Thus, whereas endogenous inhibitors regulate trypsins I and II, trypsin IV/mesotrypsin may remain active in tissues for prolonged periods. p23 is also more resistant to these inhibitors than rat anionic trypsin (15). Moreover, the lysosomal enzyme cathepsin B, which prematurely activates trypsinogens in acinar cells to initiate pancreatitis, preferentially activates mesotrypsinogen over trypsinogen I and II, suggesting a role for trypsin IV/mesotrypsin in pancreatic disease (4). p23 is also up-regulated in the inflamed rat pancreas (5). PRSS3 is up-regulated in metastatic non-small cell lung cancers (16), and epigenetic silencing of the PRSS3 promoter by hypermethylation occurs in bladder, esophageal, and gastric cancers (17, 18). Overexpression of trypsinogen IV in neurons of the mouse brain results in a remarkable overexpression of glial fibrillary acidic protein in astrocytes, suggesting a role for trypsin IV in astrocyte proliferation (19). Trypsin IV also degrades myelin basic protein, the autoantigen of multiple sclerosis, suggesting an involvement in human disease (20). Thus, trypsin IV/mesotrypsin and p23 are up-regulated and prematurely activated during inflammation and in tumors, where the sustained, inhibitor-resistant activity of these proteases could contribute to inflammation, tumor formation, and disease progression by mechanisms that remain to be discovered.

Certain serine proteases regulate cells by cleaving protease-activated receptors (PARs), a family of four G-protein-coupled receptors (reviewed in Ref. 21). PARs are widely expressed and regulate the critically important processes of hemostasis, angiogenesis, inflammation, pain, and repair in many tissues (21). Therefore, it is of great interest to identify and characterize the proteases that can activate these receptors. Trypsin I and II potently activate PAR2 (22, 23) and also activate PAR1 (24–27) and PAR4 (28, 29). However, there are conflicting reports of the ability of trypsin IV/mesotrypsin to activate PARs. Impure preparations of trypsin IV activate human PAR2 and PAR4 in transfected cell lines (10). However, whereas trypsin I and II signal to human epithelial cell lines expressing PAR1 and PAR2, mesotrypsin is inactive (30). In contrast, mesotrypsin signals to rat brain astrocytes by cleaving PAR1 but not PAR2 (31). Thus, the capacity of trypsin IV/mesotrypsin to activate PARs depends on the preparation of proteases, the cell type, and the species. To our knowledge, the effects of trypsin IV/mesotrypsin have not been examined in intact tissues, and it is not known if p23 activates PARs.

The purpose of this investigation was to determine whether trypsin IV and p23 cleave and activate PAR1 and PAR2. To do so, we examined the ability of recombinant proteases to cleave synthetic peptides corresponding to extracellular, N-terminal domains of PAR1 and PAR2, and to activate the receptors in transfected cells. Trypsin IV and p23 are activated and up-regulated during inflammation (4, 5), and agonists of PAR1 and PAR2 induce inflammation and pain, in part by stimulating the release of substance P and calcitonin gene-related peptide from primary spinal afferent neurons (32–38). Therefore, we also determined whether trypsin IV and p23 can signal to primary spinal afferent neurons isolated from the dorsal root ganglia (DRG) by activating PAR1 and PAR2. By administering these proteases to wild-type and PAR-deficient mice, we determined whether they cause inflammation and hyperalgesia by activating PAR1 and PAR2.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Animals—Sprague-Dawley rats (male, 200–250 g) were from Charles River Laboratories. PAR –/– 1 and PAR2–/– were a gift from Dr. P. Andrade-Gordon (Johnson & Johnson Pharmaceutical Research and Development, Spring House, PA) (39, 40). Male knock-out mice and their littermates (6–8 weeks, C57Bl 6 background) were bred and studied at the University of Calgary Animal Care Facility. Institutional Animal Care and Use Committees approved all experiments.

PAR Agonists—Activating peptides (APs) corresponding to the tethered ligand of rat PAR2-AP (SLIGRL-NH2) and the PAR1-selective agonist Xenopus PAR1-AP (TFLLRN-NH2) (25) were from SynPep Corp. (Dublin, CA) and Sigma Genosys (Woodland, TX). Human pancreatic trypsin I was from Sigma.

Trypsinogen IV and p23 Expression Vectors—We generated vectors for expressing trypsinogen IV and pro-p23 in Escherichia coli as N-terminally truncated and His-tagged fusion proteins, which would facilitate purification of the zymogens by immobilized-metal ion-affinity chromatography. To generate the trypsinogen IV expression vector, an Image expressed sequence tag clone (accession number BC030238 [GenBank] , clone ID 4537998) was obtained from Invitrogen. The open reading frame for the catalytic domain and a part of the propeptide of trypsinogen IV was amplified by PCR using the overlapping forward primers (5' to 3'): GGGGACAAGTTTGTACAAAAAAGCAGGCTTCTTTAACTTTAAGAAGGAGATATAACCATG and CTTTAAGAAGGAGATATAACCATGcatcaccatcaccatcaccatcacgtcccctttgacgatgatgacaagattg; and the reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAgctgttggcagcgatggtgtccttaatcc. This also introduced an N-terminal hexa-histidine tag. The PCR fragment was subcloned into pDONR201 using GatewayTM Technology (Invitrogen), forming the plasmid pAM1265. The Gateway-adapted vector pT7#3.3GW (pZen2314, AstraZeneca) was used as the destination vector, and the open reading frame of pAM1265 was transferred into pZen2314 with a LR reaction (Invitrogen), forming the plasmid pAM1270. To generate an expression vector for pro-p23, cDNA for rat prepro-p23 (preprotrypsinogen p23, accession number X15679 [GenBank] ) was obtained using synthesized primers and rapid gene construction technology (Cytomyx Ltd., Cambridge, England) and was subcloned into pcDNA3.0 (EcoRI/NotI). The open reading frame for the catalytic domain and a part of the propeptide of prepro-p23 was amplified by PCR using the overlapping forward primers (5' to 3'): GGGGACAAGTTTGTACAAAAAAGCAGGCTTCTTTAACTTTAAGAAGGAGATATAACCATG, CTTTAAGAAGGAGATATAACCATGCATCACCATCACCATCACCATCACGTCCCCTTTGACGATGATGAC, and CACGTCCCCTTTGACGATGATGACAAGATTGTTGGAGGCTACAC; and the reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGTTGTTCGCCATAGTCTCCTGAATCCAGCTCAGG. This also introduced an N-terminal hexa-histidine tag. The PCR fragment was subcloned, and an expression vector, pAM1579, was generated as described for trypsinogen IV.

Expression and Purification of Trypsinogen IV and Pro-p23—BL21 Star cells (Invitrogen) were transformed with pAM1270 or pAM1579. Cells were grown in LB medium containing 12 µg/ml tetracycline and induced with 100 µM isopropyl-betaD-1-thiogalactopyranoside for 4.5 h at 37 °C. The cell pellet from 1 liter of medium was resuspended in 100 ml of lysis buffer (20 mM Tris-HCl, pH 7.8, 200 mM NaCl, 0.8% Chaps, 1 mg/ml lysozyme, 10 units/ml benzonase), stirred (10 min, room temperature), frozen at –80 °C for >30 min, and centrifuged (10,000 x g, 15 min). The pellet was dissolved in buffer B (8 M urea, 0.1 M NaH2PO4, 0.01 M Tris-HCl, pH 8), stirred (1 h, room temperature), and centrifuged. The supernatant was applied to a nickel-nitrilotriacetic acid fast-flow resin column (Qiagen) equilibrated in buffer B. The column was washed with 10 column volumes of buffer C (buffer B, pH 6.3), 2.5 volumes of buffer D (buffer B, pH 5.9), and the zymogens were eluted with buffer E (buffer B, pH 4.5). Fractions were analyzed by SDS-PAGE (4–12% Bis-Tris Gel, NuPAGE System, Invitrogen), and proteins were identified by Coomassie staining. Fractions containing trypsinogen IV or pro-p23 fractions were pooled, and the protein concentration was determined using the BCA method (Pierce) with bovine serum albumin as standard.

Refolding of Trypsinogen IV and Pro-p23—Buffer exchange into 6 M guanidine-HCl, 0.1 M Tris-HCl, pH 8.5, 2 mM EDTA, 30 mM dithiothreitol was accomplished with a PD10 chromatography column (Amersham Biosciences, Piscataway, NJ). The final concentration of trypsinogen IV or pro-p23 was adjusted to 1 mg/ml, and samples were reduced by incubation for 30 min at 37 °C. Samples were diluted 30-fold with refolding buffer (0.9 M guanidine-HCl, 0.1 M Tris-HCl, pH 8.5, 2 mM EDTA, 1 mM L-cysteine, 1 mM L-cystine) and stirred (overnight, 4 °C). Samples were dialyzed against 2.5 mM HCl, the dialysate was centrifuged (10,000 g, 30 min), and the supernatant was concentrated with Spin Concentrators (Millipore, Billerica, MA, molecular mass cut-off, 5 kDa). The protein concentration was determined by measuring the absorbance at 280 nm (1 mg/ml equals an A280 nm of 1.512 for trypsinogen IV and 1.28 for pro-p23).

Enteropeptidase Activation of Trypsinogen IV and Pro-p23 and Purification of Trypsin IV and p23—Trypsinogen IV and Pro-p23 (1 mg) were activated with 40–50 units/ml of EKmax enteropeptidase according to the manufacturer's directions (Invitrogen). Buffer exchange into MES-buffer 1 (50 mM MES, pH 6, 1 mM CaCl2, 10% glycerol (v/v)) was accomplished with PD10 columns (Amersham Biosciences). Trypsin IV and p23 were purified by ion exchange chromatography using a SP-Sepharose column (Amersham Biosciences). Proteases were loaded onto the column that was equilibrated in MES-buffer 1. The column was washed with 5 column volumes of MES-buffer 1, and trypsin IV and p23 were eluted using a linear gradient up to 1 M NaCl in MES-buffer 1. Fractions containing active trypsin IV and p23 were pooled, concentrated using spin concentrators, and buffer was exchanged to 0.1 M Tris-HCl, pH 8, 1 mM CaCl2, 150 mM NaCl. The protein concentration was determined by measuring the absorbance at 280 nm (1 mg/ml equals an A280 nm of 1.6 for trypsin IV and 1.4 for p23).

N-terminal Amino Acid Sequencing—Samples were blotted on polyvinylidene difluoride membrane (Immobilon P, Millipore), stained with Amido Black, and N-terminal residues were sequenced (Applied Biosystems Procise 494, Foster City, CA), using Procise2.1 and SequencePro 2.1 software.

Trypsin IV and p23 Activity Assays—Protease activity was measured using tosyl-GPR-pNA or tosyl-GPK-pNA as substrates (Sigma, 150 µM substrate, 100 mM Tris/HCl, 1 mM CaCl2, pH 8, 25 °C). The change in absorbance at 405 nm was determined over time. 1 unit is defined as the enzymatic activity converting 1 µmol of substrate per minute ({epsilon} = 9920 M–1 cm–1). On average, the maximum specific activity of trypsin IV used for our work was ~100 units/mg, using tosyl-GPR-pNA as substrate (supplemental Table S1). To assess the susceptibility to inhibitors, enzymes were preincubated for 5 min with aprotinin, SBTI, benzamidine, p-aminobenzamidine (all from Sigma) or nafamostat (FUT-175, Toronto Research Chemicals, North York, Canada) before addition of the substrate.

Cleavage of PAR-derived Peptides—The following peptides corresponding to extracellular N-terminal domains of human (h) and rat (r) PAR1, PAR2, and PAR4 were from the Faculty Peptide Synthesis Facility at the University of Calgary (tethered ligand activating sequences underlined): hPAR1: NATLDPRSFLLRNPNDKYE; hPAR2: N-acetyl-GTNRSSKGRSLIGKVDGTSHVTGKGVT-amide; hPAR4: GDDSTPSILPAPRGYPGQV; rPAR2: GPNSKGRSLIGRLDTP-YGGC (non-PAR2 residues, YGGC, added for affinity-column coupling). Peptides (100 µM final) were incubated with trypsin I (1 or 5 units/ml corresponding to 2 or 10 nM), trypsin IV (30 or 360 nM), or p23 (3.8 nM) for 0–30 min at 37 °C. Reactions were stopped by adding 1 volume of 50% acetonitrile and 0.1% trifluoroacetic acid in water. Samples were fractionated by reverse-phase high-performance liquid chromatography, and eluted peptides were analyzed by mass spectrometry (41).

Cell and Neuronal Culture—Generation and maintenance of sarcoma virus-transformed rat kidney epithelial cells (KNRK) expressing hPAR1 or hPAR2 have been described previously (10, 23, 42). For experiments with p23, KNRK cells were transiently transfected with cDNA encoding hPAR1, hPAR2,or empty vector (control) using Lipofectamine 2000 (Invitrogen), and were studied after 48 h. Neurons were isolated from DRG of thoracic and lumbar spinal cord of adult rats, and were cultured for 2–3 days, as described (32, 36, 37).

Measurement of [Ca2+]i—[Ca2+]i was measured in KNRK cells and DRG neurons using Fura-2AM or Fluo-4 (Invitrogen) (32, 36, 37, 42). For analysis of populations of KNRK cells loaded with Fura-2AM, fluorescence was measured at 340 nm and 380 nm excitation and 510 nm emission in an F-2500 spectrophotometer (Hitachi Instruments, San Jose, CA), and results are expressed as the 340/380 nm emission ratio, which is proportional to [Ca2+]i. For analysis of populations of KNRK cells loaded with Fluo-4, fluorescence was measured using FLIPR (Molecular Devices Corp., Sunnyvale, CA), and results are expressed as FLIPR fluorescence units. For analysis of DRG neurons loaded with Fura-2AM, fluorescence of individual cells was measured at 340 nm and 380 nm excitation and 510 nm emission using a Zeiss Axiovert microscope, an intensified charge-coupled device (ICCD) video camera (Stanford Photonics, Stanford, CA), and a video microscopy acquisition program (Axon Instruments, Inc., Union City, CA). Neurons were challenged with capsaicin to identify nociceptive neurons, and with 50 mM KCl, to distinguish neurons from other cell types, and results are expressed as the 340/380 nm emission ratio. To examine the effects of aprotinin on the ability of trypsin I, trypsin IV, and p23 to activate PARs, proteases (250 nM to 250 µM) were preincubated for 30 min on ice with a 5-fold molar excess of aprotinin or vehicle (control) before assay.


Figure 1
View larger version (33K):
[in this window]
[in a new window]

  		FIGURE 1.
Cleavage of extracellular fragments of hPAR1 (A), hPAR4 (B), hPAR2 and rPAR2 (C and D) by trypsin IV (A–C) and trypsin I/II (D). Fragments were incubated with the indicated concentration of proteases for 0–30 min. Products were fractionated by high-performance liquid chromatography to assess the extent of degradation and identified by mass spectrometry. n = 4 experiments.

 
Measurement of Inflammation and Pain—Trypsin IV (5 ng or 13 units), p23 (13 units), or heat-inactivated proteases (boiled for >5 min, cooled on ice, and immediately tested), all in 10 µl of 0.9% NaCl, was injected into the plantar surface of the mouse paw. To assess edema, paw thickness was measured using an electronic caliper (Fisher Scientific, Hampton, NH). To assess granulocyte infiltration, myeloperoxidase (MPO) activity was measured in the paw tissue collected 4 h after protease administration (32). Tissues were homogenized in 0.5% hexadecyltrimethylammonium bromide phosphate-buffered (pH 6.0) solution, and homogenates were centrifuged (13,000 x g, 3 min, 4 °C) and assayed for MPO activity using 3,3'-dimethoxybenzidine and 1% hydrogen peroxide. MPO activity is expressed as units of enzyme per milligram tissue. Nociceptive responses to thermal stimuli were measured using a plantar test apparatus (34, 43) (Stoelting, Chicago, IL). Mice were placed in individual boxes on a glass floor and were allowed to acclimatize for >10 min. A source of radiant heat was placed under the mouse paw, and the withdrawal reflex latency was measured in response to this thermal stimulus. Nociceptive responses to mechanical stimuli were measured using von Frey filaments (34, 43). Filaments were selected to cause innocuous stimulation (filament 3.61) or noxious stimulation (3.84 and 4.18) under basal conditions. Mice were placed in individual boxes on a metal grid floor, and were allowed to acclimatize for >10 min. Filaments were applied to the hind paw in sequential order of diameter (>3 times for each filament and each animal). Nociceptive scores were assigned based on responses: 0 = no movement, 1 = removal of the paw, 2 = removal of the paw with vocalization, licking of paw, or holding paw. Results are expressed as a percentage of maximal nociceptive score.

Statistical Analysis—Results are reported as mean ± S.E. and were compared using Student's t test for two comparisons, or the unpaired ANOVA test for repeated measures and a parametric Dunnett's test for multiple comparisons. p < 0.05 was considered significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Expression and Purification of Trypsinogen IV and Pro-p23— We expressed trypsinogen IV in E. coli as an N-terminal truncated, His-tagged fusion protein (supplemental Fig. S1A). Trypsinogen IV was produced by E. coli as insoluble protein present in inclusion bodies, which we solubilized and purified using immobilized metal affinity chromatography (supplemental Fig. S1B). Enteropeptidase cleaved trypsinogen IV at DDDDK{downarrow}Ito remove the His tag and the partial propeptide, and generate trypsin IV (supplemental Fig. S1C). To separate the His tag-propeptide sequence from trypsin IV, we used ion exchange chromatography with an SP-Sepharose column. The His-tagged propeptide ran through the column, whereas trypsin IV was bound to SP-Sepharose and was eluted by an increasing salt-gradient (supplemental Fig. S1D).

We assessed the purity of trypsin IV by SDS-PAGE and N-terminal amino acid sequencing. Recombinant trypsin IV migrated as a homogenous protein with an apparent molecular mass of ~24 kDa (supplemental Fig. S2A, lane 1). Human pancreatic trypsin also migrated as a homogenous protein with an apparent molecular mass of ~27 kDa (supplemental Fig. S2A, lane 2). The N-terminal sequence of trypsin IV was IVGGYT, which agrees with the predicted sequence. The N-terminal sequence of human pancreatic trypsin was IVGGYN?E, corresponding to trypsin I (accession number P07477 [GenBank] , IVGGYNCE) rather than trypsin II (accession number P07478 [GenBank] , IVGGYICE).

We used an identical strategy to express and purify pro-p23 (data not shown). Enteropeptidase cleaved pro-p23 to generate p23, with an apparent molecular mass of ~24 kDa (supplemental Fig. S2B). The N-terminal sequence of p23 was IVGGYT-?PKH, which agrees with the predicted sequence of this enzyme after activation by enteropeptidase.


Figure 2
View larger version (24K):
[in this window]
[in a new window]

  		FIGURE 2.
Trypsin IV and p23 signaling to cell lines expressing PAR1 and PAR2. A, effects of graded concentrations of trypsin IV on [Ca2+]i in KNRK-PAR1, KNRK-PAR2, and untransfected KNRK cells. Results are mean data from n = 3–4 experiments. B–E, effects of p23 on [Ca2+]i in KNRK-PAR1, KNRK-PAR2, and KNRK vector control cells. p23 had a small effect on [Ca2+]i in KNRK-PAR1 cells, strongly increased [Ca2+]i in KNRK-PAR2 cells, and was inactive in KNRK vector control cells. Each line in B–D is from one experiment.

 
Enzymatic Activity of Trypsin IV and p23—We compared the activity of trypsin IV, trypsin I, and p23 using the synthetic substrates tosyl-GPR-pNA and tosyl-GPK-pNA. Trypsin IV and p23 both preferred tosyl-GPR-pNA over tosyl-GPK-pNA, as shown by the kinetic constants (supplemental Fig. S3 and Table S1). However, the specific activity of trypsin IV for this arginine-containing substrate was ~5-fold greater (100 units/mg) than that of p23 (18 units/mg) (supplemental Table S1). The polypeptide inhibitors aprotinin and SBTI had little or no effect on activity of trypsin IV, had minimal effects on activity of p23, but potently inhibited trypsin I (supplemental Table S2). In contrast, the small molecular weight inhibitors benzamidine, p-aminobenzamidine and nafamostat, inhibited all enzymes with similar Kic.

Trypsin IV and p23 Cleave N-terminal Fragments of PAR1, PAR2, and PAR4 to Expose Tethered Ligand Domains—To determine if trypsin IV and p23 can cleave PARs to expose the tethered ligand domain, we examined the hydrolysis of synthetic N-terminal peptide fragments of PAR1, PAR2, and PAR4. Trypsin IV and p23 were incubated with peptides for 0–30 min, and products were separated by high-performance liquid chromatography and identified by mass spectrometry. Trypsin IV (30 nM) cleaved hPAR1 and hPAR4 at similar rates (Fig. 1, A and B). The products of hPAR1 hydrolysis were NATLDPR and SFLLRNPNDKYE, indicating cleavage at NATLDPR {downarrow} SFLLRNPNDKYE (Fig. 1A, {downarrow} cleavage site, underlined tethered ligand domain). The main product of hPAR4 hydrolysis was GDDSTPSILPAPR, indicating cleavage at GDDSTPSILPAPR {downarrow} GYPGQV. Trypsin IV cleaved hPAR2 and rPAR2 more slowly than hPAR1 or hPAR4, and a ~10-fold higher concentration of protease (360 nM) was required to achieve similar rates of hydrolysis (Fig. 1C). The main product of hPAR2 hydrolysis was SLIGKVDGTSHVTGKGVT, indicating cleavage at SSKGR {downarrow} SLIGKVDGTSHVTGKGVT (Fig. 1C). The main product of rPAR2 hydrolysis was SLIGRLDTP, indicating cleavage at SSKGRGPNSKGR {downarrow} SLIGRLDTP (Fig. 1C). Trypsin I cleaved hPAR2 and rPAR2 more rapidly than did trypsin IV, with a lower concentration of protease (4 nM) required to achieve similar rates of hydrolysis (Fig. 1D). Trypsin I cleaved hPAR2 and rPAR2 at the same sites as trypsin IV (Fig. 1D). Thus, trypsin IV cleaves fragments of hPAR1, hPAR4, hPAR2, and rPAR2 at the activation sites to expose the tethered ligand domains. Trypsin IV cleaves fragments of PAR1 and PAR4 faster than PAR2, and trypsin I cleaves PAR2 faster than does trypsin IV.

We similarly determined if p23 cleaved fragments of hPAR1, hPAR2, and rPAR2. When p23 (3.8 nM) was incubated with peptides for 15 min, there was ~60% degradation of hPAR1 and >90% degradation of hPAR2 and rPAR2. The products of degradation indicated that the peptides were cleaved to expose the tethered ligand domains (not shown). Thus, p23 cleaves PAR2-derived peptides more rapidly than trypsin IV. p23 also cleaves PAR2-derived peptides faster than PAR1-derived peptides at sites consistent with receptor activation.

Trypsin IV and p23 Activate PAR1 and PAR2 Expressed in KNRK Cells—Because trypsin IV and p23 cleaved peptides corresponding to the extracellular N-terminal domains of hPAR1 and hPAR2 at sites that would reveal the tethered ligand domains, we investigated whether these proteases would activate hPAR1 and hPAR2 expressed in KNRK cells by measuring [Ca2+]i. Trypsin IV induced a prompt, concentration-dependent increase in [Ca2+]i in KNRK-PAR1 cells and KNRK-PAR2 cells (Fig. 2A). There was no response in untransfected KNRK cells to the maximal concentrations of proteases that were tested (30 µM). The EC50 with which trypsin IV increased [Ca2+]i was 0.45 ± 0.10 µM in KNRK-PAR1 cells (n = 4 experiments) and 0.59 ± 0.15 µM in KNRK-PAR2 cells (n = 3). In contrast, the EC50 with which trypsin I increased [Ca2+]i was 3.64 nM in KNRK-PAR1 cells (n = 2) and 0.51 ± 0.24 nM in KNRK-PAR2 cells (n = 3) (not shown). Thus, trypsin IV can activate hPAR1 and hPAR2 with similar potencies when these receptors are overexpressed in KNRK cells. Trypsin I activates hPAR2 with a ~1000-fold higher potency and activates hPAR1 with a ~100-fold higher potency than trypsin IV.

p23 (10 or 30 nM) had a small effect on [Ca2+]i in KNRKPAR1 cells (Fig. 2, B and E) but robustly increased [Ca2+]i in KNRK-PAR2 cells (Fig. 2, C and E). p23 did not affect [Ca2+]i in KNRK cells expressing the empty vector (Fig. 2, D and E). Thus, p23 strongly activates PAR2 but weakly activates PAR1.

Trypsin IV and p23 Activate PAR1 and PAR2 Expressed in KNRK Cells in the Presence of Aprotinin—We examined whether aprotinin treatment of trypsin I, trypsin IV, and p23 inhibited their ability to mobilize Ca2+ in KNRK-PAR1 and KNRK-PAR2 cells. Proteases were preincubated with a 5-fold molar excess of aprotinin or vehicle (control) for 30 min before assay. Concentrations of proteases were chosen that had similar effects on [Ca2+]i in control experiments (no inhibitor). In KNRK-PAR1 cells, aprotinin reduced responses to p23 to 28 ± 4% and to trypsin IV to 74 ± 1% of controls (Fig. 3A). In KNRKPAR2 cells, aprotinin abolished responses to trypsin I, and reduced responses to p23 to 39 ± 5% and to trypsin IV to 89 ± 20% of controls (Fig. 3B). Thus, both p23 and trypsin IV can signal through PAR1 and PAR2 even in the presence of aprotinin, whereas aprotinin abolishes responses to trypsin I. These results are consistent with the relative insensitivity of trypsin IV and p23 to inhibition by aprotinin and SBTI compared with trypsin I (supplemental Table S2).


Figure 3
View larger version (16K):
[in this window]
[in a new window]

  		FIGURE 3.
Effects of aprotinin on the ability of trypsin I, trypsin IV, and p23 to signal to cell lines expressing PAR1 and PAR2. Proteases were preincubated with 5-fold molar excess of aprotinin or vehicle (control) before assay (30 min on ice). A, effects of aprotinin-treated or vehicle-treated trypsin IV (10 nM) and p23 (100 nM) on [Ca2+]i in KNRK-PAR1 cells. B, effects of aprotinin-treated or vehicle-treated trypsin I (10 nM), trypsin IV (1 µM), and p23 (100 nM) on [Ca2+]i in KNRK-PAR2 cells. Results are expressed as % of response to vehicle-treated protease (100%, control) from n = 3 experiments. Note that, whereas aprotinin abolished the ability of trypsin I to activate PAR2,ithad little or no effect on the ability of trypsin IV to activate PAR1 and PAR2, and only partially inhibited the ability of p23 to activate PAR1 and PAR2.*, p < 0.05.

 
Trypsin IV and p23 Signal to DRG Neurons by Activating PAR1 and PAR2—A large proportion of DRG neurons express PAR1 and PAR2, and proteases (thrombin, trypsin, and tryptase), PAR1-AP and PAR2-AP can signal to these neurons by increasing [Ca2+]i (32, 33). Therefore, we also examined whether trypsin IV and p23 can signal to rat DRG neurons by increasing [Ca2+]i. Trypsin IV (1, 3, or 5 µM) induced a prompt increase in [Ca2+]i in 52% of DRG neurons (79 of 152 neurons) (Fig. 4A), with an EC50 of ~3 µM (not shown). Of those neurons that responded to trypsin IV (1 µM), 77% also responded to capsaicin, a selective agonist of transient receptor potential vanilloid 1, a mediator of inflammatory pain (44–46). Thus, trypsin IV can signal to sensory neurons that mediate neurogenic inflammation and nociception.

Other proteases that activate PAR1 and PAR2 desensitize responses of DRG neurons to PAR-APs (32, 33). To determine if trypsin IV signals to DRG neurons by cleaving PAR1 or PAR2, we evaluated its ability to desensitize responses to selective agonists of these receptors. Preincubation of DRG neurons with trypsin IV (1 µM, 5 min) desensitized responses to a selective PAR1-AP (100 µM) by 69 ± 8% and to PAR2-AP (100 µM) by 67 ± 5%, compared with preincubation with vehicle (Fig. 4, B and C). Thus, trypsin IV desensitizes responses to PAR1- and PAR2-selective agonists, suggesting that trypsin IV activates both PAR1 and PAR2 on DRG neurons.


Figure 4
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 4.
Trypsin IV and p23 signaling to rat DRG neurons. A, effects of trypsin IV (1 µM) on [Ca2+]i in DRG neurons. Note that cells responding to trypsin IV also responded to capsaicin. Each trace is the mean signal from n = 4 neurons. B, trypsin IV-induced desensitization of responses to agonists of PAR1 and PAR2. Cells were exposed to trypsin IV (1 µM) or vehicle for 5 min and then challenged with the PAR1-AP or PAR2-AP (100 µM). Note that trypsin IV strongly desensitized responses to both APs. Each line is the mean signal from n = 2–3 neurons. C, effects of trypsin IV (1 µM, 5 min) on responsiveness to PAR1-AP and PAR2-AP (100 µM). D, effects of p23 (500 nM, 5 min) on responsiveness to PAR1-AP and PAR2-AP (100 µM). *, p < 0.05. pretreatment with trypsin IV (C) or p23 (D) desensitized responses to PAR1-AP and PAR2-AP. (n) refers to numbers of neurons.

 
We similarly determined if p23 signals to rat DRG neurons. p23 (500 nM and 5 µM) increased [Ca2+]i in 59% of DRG neurons (43 of 73 neurons) (not shown). Of the p23-responsive neurons, 98% also responded to capsaicin. Preincubation of neurons with p23 (500 nM, 5 min) desensitized responses to a selective PAR1-AP by 49 ± 11% and to PAR2-AP by 49 ± 10%, compared with preincubation with vehicle (Fig. 4D). Thus, p23 also signals to nociceptive neurons by activating PAR1 and PAR2.

Trypsin IV and p23 Induce Inflammation by a PAR-dependent Mechanism—Proteases and selective agonists of PAR1 and PAR2 activate primary spinal afferent neurons in peripheral tissues to cause neurogenic inflammation (32, 33). Because we observed that trypsin IV activates PAR1 and PAR2 in these neurons, we examined whether trypsin IV causes inflammation and determined the contributions of PAR1 and PAR2 to this response. Intraplantar injection of trypsin IV (5 ng, 13 units) into wild-type mice increased paw diameter after 1 and 2 h, which returned to basal values after 3 h, indicative of edema (Figs. 5A and 6A). Although trypsin IV-induced edema was not detectable after 3 h, tissue MPO activity was increased 4 h after trypsin IV administration, indicative of a sustained stimulation of granulocyte infiltration (Figs. 5B and 6B). Heat-inactivated trypsin IV did not affect paw diameter or MPO activity (Fig. 6, A and B). Trypsin IV had minimal effects on paw diameter and tissue MPO activity in PAR –/–1 or PAR –/–2 mice (Figs. 5A, 5B, 6A, and 6B). Thus, trypsin IV causes inflammation of the paw that is characterized by edema and granulocyte infiltration, and PAR1 and PAR2 are required for this effect.

p23 (13 units) increased paw diameter and MPO activity in wild-type mice, characteristic of edema and leukocyte recruitment (Fig. 7, A and B). Since p23 potently activated PAR2 but not PAR1, we evaluated the effects of deletion of PAR2 and not PAR1 on the pro-inflammatory actions of p23. p23-induced edema and MPO-activity were diminished in PAR –/–2 mice, although only the effect on edema was significant (Fig. 7, A and B).

Trypsin IV and p23 Cause Thermal Hyperalgesia and Mechanical Allodynia and Hyperalgesia by PAR-dependent Mechanisms—Agonists of PAR2 cause hyperalgesia to thermal and mechanical stimulation of the paw (34–38). In contrast, agonists of PAR1 promote analgesia to thermal and mechanical stimuli (43). We examined whether trypsin IV causes allodynia and hyperalgesia of the paw and determined the contributions of PAR1 and PAR2 to this response.


Figure 5
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 5.
Effects of trypsin IV on inflammation and pain in wild-type and PAR –/–1 mice. Trypsin IV (5 µg, 13 units) was injected into the paw of mice. Paw diameter (A), MPO activity (B), paw withdrawal latency to a thermal stimulus (C), and mechanical nociceptive scores to graded von Frey filaments (D–F) were measured. In wild-type mice, trypsin IV increased paw diameter and MPO activity, indicating inflammation. Trypsin IV decreased the latency of paw withdrawal to a thermal stimulus, indicating thermal hyperalgesia. Trypsin IV increased the nociceptive score to stimulation with the 3.61 von Frey filament, which was innocuous under basal conditions, indicating mechanical allodynia. Trypsin IV increased the nociceptive scores to the larger von Frey filaments (3.84 and 4.08), indicating mechanical hyperalgesia. In PAR –/–1 mice, trypsin IV did not increase paw volume or MPO activity, but still induced thermal hyperalgesia, mechanical allodynia, and mechanical hyperalgesia. n = 6–8 mice per observation. *, p < 0.05 compared with basal levels.

 
Intraplantar injection of trypsin IV (5 ng, 13 units), but not heat-inactivated trypsin IV, decreased the latency of paw withdrawal to a thermal stimulus in wild-type mice after 1–3 h, indicative of thermal hyperalgesia (Figs. 5C and 6C). Similarly, trypsin IV, but not heat-inactivated enzyme, increased the nociceptive score to all von Frey filament stimuli in wild-type (Figs. 5, D–F, and 6, D–F). The smaller size von Frey filament (3.61), for which no nociceptive response was measured under basal conditions (innocuous stimulus: score of 0 at time 0), provoked a 30–40% increase in nociceptive response at 1 and 2 h after intraplantar injection of trypsin IV, indicative of allodynia (Figs. 5D and 6D). The larger size von Frey filaments (noxious stimuli: 3.84 and 4.08) provoked a marked increase in nociceptive score measured at 1, 2, and 3 h after intraplantar trypsin IV, indicative of mechanical hyperalgesia (Figs. 5E,5F, 6E, and 6F). Trypsin IV did not cause detectable thermal hyperalgesia or mechanical allodynia or hyperalgesia in PAR –/–2 mice (Fig. 5, C and D–F). In contrast, trypsin IV caused a similar or increased thermal hyperalgesia or mechanical allodynia or hyperalgesia in PAR –/–1 compared with wild-type mice (Fig. 5, C and D–F). Thus, trypsin IV causes hyperalgesia to thermal and mechanical stimuli and allodynia to mechanical stimuli. These effects require expression of PAR2 but not PAR1.

Intraplantar injection of p23 (13 units), but not heat-inactivated enzyme, decreased the latency of paw withdrawal to a thermal stimulus characteristic of thermal hyperalgesia (Fig. 7A). p23, but not heat-inactivated enzyme, also increased nociceptive score in response to the innocuous stimulation of the 3.61 von Frey filament, characteristic of allodynia (Fig. 7D), and increased nociceptive score to noxious stimuli (von Frey filaments 3.84 and 4.08), characteristic of mechanical hyperalgesia (Fig. 7, E and F). p23-induced mechanical allodynia and thermal or mechanical hyperalgesia were not observed in PAR –/–2 mice (Fig. 7, C–F). Thus, PAR2 mediates p23-induced hyperalgesia and allodynia.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Our results show that trypsin IV cleaves extracellular fragments of PAR1 and PAR2 to expose tethered ligand do mains, which is consistent with receptor activation. Trypsin IV signals to KNRK cells expressing PAR1 and PAR2, but not to untransfected cells, suggesting that trypsin IV activates these receptors. Trypsin IV also signals to nociceptive DRG neurons that naturally express PAR1 and PAR2, and desensitizes responses to selective agonists of these receptors, suggesting that trypsin IV signals to neurons by PAR1- and PAR2-dependent mechanisms. Intraplantar injection of trypsin IV induces inflammation, thermal hyperalgesia, and mechanical allodynia and hyperalgesia in mice. Inflammatory responses depend on expression of both PAR1 and PAR2, whereas nociception depends on PAR2 but not PAR1. p23, a rat protease that resembles trypsin IV, also cleaves and activates PAR2, causing inflammation and pain. Thus, trypsin IV and p23, widely expressed and inhibitor-resistant proteases that are up-regulated during inflammation and cancer, can cleave PARs to promote inflammation and pain.


Figure 6
View larger version (33K):
[in this window]
[in a new window]

  		FIGURE 6.
Effects of trypsin IV on inflammation and pain in wild-type and PAR –/–2 mice. Trypsin IV (5 µg, 13 units) was injected into the paw of mice. Paw diameter (A), MPO activity (B), paw withdrawal latency to a thermal stimulus (C), and mechanical nociceptive scores to graded von Frey filaments (D–F) were measured. In wild-type mice, trypsin IV increased paw diameter and MPO activity, indicating inflammation. Trypsin IV decreased the latency of paw withdrawal to a thermal stimulus, indicating thermal hyperalgesia. Trypsin IV increased the nociceptive score to stimulation with the innocuous 3.61 von Frey filament, indicating mechanical allodynia. Trypsin IV increased the nociceptive scores to the larger von Frey filaments (3.84 and 4.08), indicating mechanical hyperalgesia. Heat-inactivated trypsin had no effect. Trypsin IV did not increase paw volume or MPO activity and failed to induce thermal hyperalgesia, mechanical allodynia, or mechanical hyperalgesia in PAR –/–2 mice. n = 6–8 mice per observation. *, p < 0.05 compared with boiled enzyme for A, and compared with basal levels for C–F; **, p < 0.01 and ***, p < 0.005 compared with trypsin IV in PAR +/+2 for B.

 
Trypsin IV and p23 Are Inhibitor-resistant Forms of Trypsin— We examined the activity and inhibitor sensitivity of recombinant trypsin IV, which was homogenous as determined by SDS-PAGE and N-terminal sequencing, and compared trypsin IV with human pancreatic trypsin I. Although trypsin IV and trypsin I were similarly active, as assessed by hydrolysis of synthetic substrates, they exhibited remarkably different susceptibilities to polypeptide inhibitors. Whereas aprotinin and SBTI inhibited trypsin I, they had little effect on trypsin IV. In contrast, the small molecular weight inhibitors benzamidine, p-aminobenzamidine, and nafamostat similarly inhibited trypsin IV and trypsin I. Our results are consistent with previous observations that trypsin IV/mesotrypsin is resistant to these inhibitors and is capable of degrading them (2– 4, 10). Comparisons of the x-ray structures and amino acid sequences of trypsins have revealed the structural basis of the resistance of trypsin IV/mesotrypsin to endogenous polypeptide inhibitors (47). A single nucleotide base difference between trypsin IV and trypsin I/II results in an arginine to glycine substitution (Arg255 in trypsinogen IV, Gly198 in trypsinogens I and II) at a site that is important for interaction with polypeptide inhibitors. The positively charged side chain of this arginine residue of trypsin IV sterically hinders the P2' side chain of inhibitors and repels inhibitors such as SBTI. The importance of this arginine residue has been confirmed by mutagenesis experiments (4, 47). Thus, an arginine to glycine mutation of human trypsin IV increases sensitivity to polypeptide inhibitors, whereas a glycine to arginine mutation of trypsin I has the reverse effect. This substitution also affects the substrate selectivity of trypsin IV/mesotrypsin. Thus, in contrast to trypsin I and II, trypsin IV/mesotrypsin does not activate chymotrypsinogen or trypsinogen I and II (4, 9, 48). This substitution may also affect the capacity of trypsin IV to cleave and activate PARs.

In common with trypsin IV, p23 was also resistant to inhibition by SBTI and aprotinin but susceptible to benzamidine, p-aminobenzamidine, and nafamostat, which is consistent with previous reports (15). This resistance may be attributable to a glutamine to aspartate substitution in p23, at residue 198, which is close to the active site.

Trypsin IV and p23 Cleave and Activate PAR1 and PAR2— Several observations from the current study suggest that trypsin IV can cleave and activate PAR1 and PAR2. First, trypsin IV cleaved extracellular fragments of PAR1 and PAR2 at sites that would expose the tethered ligand domain, consistent with activation. The observation that mesotrypsin exhibits high selectivity for hydrolysis of Arg/Lys-Ser/Thr bonds is consistent with its ability to cleave PARs at sites that would expose the tethered ligand domain and thus activate these receptors (49). Second, trypsin IV increased [Ca2+]i in KNRK cells expressing PAR1 and PAR2. There were no responses in untransfected KNRK cells, suggesting that responses in transfected cell lines are due to cleavage and activation of PARs. Third, trypsin IV increased [Ca2+]i in DRG neurons. Although trypsin IV could increase [Ca2+]i in neurons by several mechanisms, including cleaving PARs or ion channels, the observation that preincubation with trypsin IV strongly desensitized responses to PAR1-AP and PAR2-AP suggests that trypsin IV can signal to these cells by cleaving both receptors. Finally, the pro-inflammatory effects of trypsin IV in mice depended on expression of both PAR1 and PAR2, and the nociceptive effects depended on PAR2 expression, indicating that the biological actions of trypsin IV in vivo depend on PAR1 and PAR2. Like trypsin IV, p23 also cleaved extracellular fragments of PAR1 and PAR2 at activation sites, although p23 more potently activated PAR2 that PAR1 in KNRK cells. p23 also induced inflammation and pain by PAR2-dependent mechanisms. Thus, p23 can also activate PAR2 and may also activate PAR1 at high concentrations.


Figure 7
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 7.
Effects of p23 on inflammation and pain responses in wild-type and PAR –/–2 mice. p23 (equivalent to 13 units/per paw of trypsin IV) was injected into the paw of mice. Paw diameter (A), MPO levels (B), paw withdrawal latency to a thermal stimulus (C), and mechanical nociceptive scores to graded von Frey filaments (D–F) were measured. In wild-type mice, p23 increased paw diameter and MPO levels, indicating inflammation. p23 decreased the latency of paw withdrawal to a thermal stimulus, indicating thermal hyperalgesia. p23 increased the nociceptive score to stimulation with the innocuous 3.61 von Frey filament, indicating mechanical allodynia. p23 increased the nociceptive scores to the larger von Frey filaments (3.84 and 4.08), indicating mechanical hyperalgesia. Heat-inactivated p23 had no effect. p23 did not increase paw volume or MPO levels and failed to induce thermal hyperalgesia, mechanical allodynia, or mechanical hyperalgesia in PAR –/–2 mice. n = 6–8 mice per observation. *, p < 0.05 compared with boiled enzyme for A, compared with p23 in PAR +/+2 for B, and compared with basal levels for C–F.

 
Our results showing that trypsin IV activates PAR1 are consistent with reports that mesotrypsin can signal to human astrocytoma cells (30) and rat brain astrocytes (31) by PAR1-dependent mechanisms, but contradict a previous report that mesotrypsin is unable to signal to human epithelial cell lines that naturally express PAR1 (30). Our results showing that trypsin IV can activate PAR2 agree with our previous observation that impure preparations of trypsin IV can activate this receptor but contradict other reports that mesotrypsin does not activate PAR2 in human epithelial cells (30) or rat astrocytes (31). These discrepancies could be attributable to differences in protease preparations, species, levels of receptor expression, or cell type, and further experimentation is necessary to address these issues.

Our results reveal differences in the ability of trypsin IV to cleave fragments of PAR1 and PAR2, to activate PAR1 and PAR2 in cell lines and to induce inflammation and pain by PAR-dependent mechanisms in mice. Trypsin IV cleaved fragments of hPAR1 considerably faster than it cleaved fragments of hPAR2, which might suggest that trypsin IV more potently activates PAR1. However, trypsin IV activated PAR1 and PAR2 in KNRK cells with similar potencies. The reason for this discrepancy is presently unknown. One possibility is that the tertiary structure of the intact receptor at the cell surface is different from that of the receptor fragment, which may influence rates of receptor cleavage and activation. In addition, certain proteases can directly interact with receptors or with other cell surface proteins, which enhances PAR activation. For example, the anion binding site of thrombin interacts with a region of negatively charged residues within the extracellular N terminus of PAR1, and this interaction facilitates receptor cleavage and activation (24). Similarly, coagulation factors VIIa and Xa activate PAR1 and PAR2 by a mechanism that is enhanced by the expression of tissue factor, an integral membrane protein that binds factor VIIa, and thereby concentrates the protease at the cell surface (50, 51). Post-translational modifications, such as glycosylation, also affect the ability of certain proteases, such as tryptase, to activate PAR2 (52, 53). It remains to be determined if trypsin IV interacts with cell surface proteins or whether PAR2 glycosylation affects activation by trypsin IV.

Trypsin IV activated PAR2 in cell lines and neurons with ~1000-fold reduced potency than trypsin I. Although the reason for this reduced potency of trypsin IV is unknown, the arginine to glycine substitution of trypsin IV is a probable explanation, because it affects the ability of trypsin IV/mesotrypsin to cleave other proteins (4, 9, 48). Trypsin IV also activated PAR1, but with reduced potency compared with trypsin I or thrombin (24). Trypsin can cleave fragments of PAR1 at the thrombin cleavage site to activate this receptor (27), and high concentrations of bovine pancreatic trypsin can activate PAR1 in cell lines (25, 26). However, pancreatic trypsin also cleaves PAR1 at sites distal to the tethered ligand, which would disable this receptor (27), and trypsin can inactivate PAR1 in endothelial cells (54). Thus, trypsin IV may cleave PAR1 at sites that would both activate and disable this receptor. This dual action could account for its diminished potency.

Physiological Functions of Trypsin IV and p23—Trypsin IV induced edema and granulocyte infiltration in the mouse paw by mechanisms that depended on expression of both PAR1 and PAR2. Because deletion of either receptor prevented trypsin IV-induced inflammation, the simultaneous activation of both receptors may be required for the full inflammatory response, which is in agreement with our finding that trypsin IV can activate PAR1 and PAR2 with similar potencies. Although trypsin IV could signal to several cell types to cause edema and granulocyte infiltration, the inflammation is consistent with a neurogenic mechanism, requiring activation of PAR1 and PAR2 on sensory nerves and release of substance P and calcitonin generelated peptide. In support of this suggestion, agonists of PAR1 and PAR2 stimulate neuropeptide release in the paw and the intestine to cause neurogenic inflammation (32, 33, 55, 56).

Like trypsin IV, p23 caused edema and inflammatory cell recruitment. Whereas p23-induced edema was markedly diminished in PAR –/–2 mice and is thus dependent on PAR2, p23-induced granulocyte recruitment was maintained in PAR –/–2 mice and may thus involve a different mechanism. This discrepancy could be explained by the cell type that is activated by PAR2 agonists. Although PAR2 agonists cause edema by a neurogenic mechanism, PAR2-induced granulocyte recruitment is independent of sensory neurons (32, 33, 55, 56). Thus, p23 and trypsin IV may induce inflammation in vivo in large part by activating PAR2 on sensory nerves.

Trypsin IV caused hyperalgesia to a thermal stimulus, and allodynia and hyperalgesia to mechanical stimuli. These effects were absent in PAR –/–2 mice and thus depend on the presence of this receptor. Our results support other reports that PAR2 agonists cause thermal and mechanical hyperalgesia in the paw and intestine (34, 35, 57). The effects of trypsin IV on thermal hyperalgesia and mechanical allodynia and hyperalgesia were not reduced by PAR1 deletion. In contrast, these effects of trypsin IV were enhanced in PAR –/–1 mice at some time points (Fig. 5C, 3 h; Fig. 5F, 4 h). This result is in accord with the reported analgesic properties of PAR1 activation to mitigate thermal and mechanical hyperalgesia (43). Because trypsin IV cause hyperalgesia rather than analgesia in wild-type mice, the PAR2-dependent hyperalgesic effects outweigh any analgesic actions of this enzyme.

Despite the diminished potency of trypsin IV to activate PAR1 and PAR2 in transfected cells, low doses of trypsin IV (5 ng per paw) induced a marked inflammatory and pain response. In previous experiments, a minimal dose of 50 ng of pancreatic trypsin and 500 ng of tryptase per paw was required to cause edema, and 10 ng of pancreatic trypsin and 50 ng of tryptase caused hyperalgesia without detectable inflammation (34). Thus, despite its diminished potency in vitro, trypsin IV causes inflammation and pain at lower doses than pancreatic trypsin or tryptase. The explanation of this apparently paradoxical effect remains to be determined. One possibility is that trypsin IV can robustly signal in tissues due to its resistance to endogenous polypeptide inhibitors (2–4, 10). Indeed, we observed that trypsin IV retained its ability to activate PAR1 and PAR2 in the presence of aprotinin, which completely abolished the capacity of trypsin I to activate these receptors. Another possibility is that trypsin IV stimulates the generation of other proteases that can activate PARs, such as kallikreins (41), thereby amplifying the inflammatory and nociceptive responses.

Additional studies are required to determine whether endogenously released trypsin IV/mesotrypsin contributes to inflammation and pain. Given that trypsinogen IV lacks a discernable signal peptide, it remains to be determined whether the trypsinogen IV is secreted, although the detection of immunoreactive trypsinogen IV in the extracellular matrix of human brain suggests secretion (12), but by mechanisms that remain to be determined. Moreover, trypsinogen IV is co-expressed with enteropeptidase in many epithelial cells and tissues (10), and inflammatory mediators can up-regulate trypsinogen IV expression in epithelial cells (58). In addition. mesotrypsinogen may be preferentially activated during pancreatitis (4), and p23 is up-regulated by stimulation with cerulein, which can induce pancreatitis (5). Thus, if secreted or released from damaged cells and activated during inflammation, trypsin IV/mesotrypsin and p23 could have widespread effects by cleaving and activating multiple PARs. This possibility awaits investigation.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grants DK57480, DK43207, and DK39957 (to N. W. B.), by a Proteinases and Inflammation Network group grant from the Canadian Institutes of Health Research (to M. D. H. and N. V.), and by INSERM-Avenir and the "Fondation BettencourtSchueller" (to N. V.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

This article is dedicated to the memory of our colleague Anita Skåregärde, who died during the completion of this work. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1–S3 and Tables S1 and S2. Back

1 These authors contributed equally to this work. Back

2 To whom correspondence should be addressed: University of California San Francisco, 513 Parnassus Ave., San Francisco, CA 94143-0660. Tel.: 415-476-0489; Fax: 415-476-0936; E-mail: nigel.bunnett{at}ucsf.edu.

3 The abbreviations used are: SBTI, soybean trypsin inhibitor; PAR, protease-activated receptor; DRG, dorsal root ganglia; MPO, myeloperoxidase; AP, activating peptide; Chaps, 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonic acid; Bis-Tris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl) propane-1,3-diol; MES, 4-morpholineethanesulfonic acid; h, human; r, rat; KNRK, rat kidney epithelial cell; pNA, p-nitroanilide. Back


   ACKNOWLEDGMENTS
 
We thank Andreas Lundqvist, Fritz Schweikart, Stella Pikios, Bernard Renaux, and Lorna Divino for technical assistance.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Emi, M., Nakamura, Y., Ogawa, M., Yamamoto, T., Nishide, T., Mori, T., and Matsubara, K. (1986) Gene (Amst.) 41, 305–310[CrossRef][Medline] [Order article via Infotrieve]
  2. Nyaruhucha, C. N., Kito, M., and Fukuoka, S. I. (1997) J. Biol. Chem. 272, 10573–10578[Abstract/Free Full Text]
  3. Wiegand, U., Corbach, S., Minn, A., Kang, J., and Muller-Hill, B. (1993) Gene (Amst.) 136, 167–175[CrossRef][Medline] [Order article via Infotrieve]
  4. Szmola, R., Kukor, Z., and Sahin-Toth, M. (2003) J. Biol. Chem. 278, 48580–48589[Abstract/Free Full Text]
  5. Schick, J., Kern, H., and Scheele, G. (1984) J. Cell Biol. 99, 1569–1574[Abstract/Free Full Text]
  6. Kunitz, M. (1939) J. Gen. Physiol. 22, 429–446[Abstract/Free Full Text]
  7. Yamashina, I. (1956) Acta Chem. Scand. 10, 739–743
  8. Rowen, L., Williams, E., Glusman, G., Linardopoulou, E., Friedman, C., Ahearn, M. E., Seto, J., Boysen, C., Qin, S., Wang, K., Kaur, A., Bloom, S., Hood, L., and Trask, B. J. (2005) Mol. Biol. Evol. 22, 1712–1720[Abstract/Free Full Text]
  9. Rinderknecht, H., Renner, I. G., Abramson, S. B., and Carmack, C. (1984) Gastroenterology 86, 681–692[Medline] [Order article via Infotrieve]
  10. Cottrell, G. S., Amadesi, S., Grady, E. F., and Bunnett, N. W. (2004) J. Biol. Chem. 279, 13532–13539[Abstract/Free Full Text]
  11. Gallatz, K., Medveczky, P., Nemeth, P., Szilagyi, L., Graf, L., and Palkovits, M. (2007) Ideggyogy Sz. 60, 118–123[Medline] [Order article via Infotrieve]
  12. Toth, J., Siklodi, E., Medveczky, P., Gallatz, K., Nemeth, P., Szilagyi, L., Graf, L., and Palkovits, M. (2007) Neurochem. Res. 32, 1423–1433[CrossRef][Medline] [Order article via Infotrieve]
  13. Nemeth, A. L., Medveczky, P., Toth, J., Siklodi, E., Schlett, K., Patthy, A., Palkovits, M., Ovadi, J., Tokesi, N., Nemeth, P., Szilagyi, L., and Graf, L. (2007) FEBS J. 274, 1610–1620[CrossRef][Medline] [Order article via Infotrieve]
  14. Sahin-Toth, M. (2005) Protein Pept. Lett 12, 457–464[CrossRef][Medline] [Order article via Infotrieve]
  15. Fukuoka, S., and Nyaruhucha, C. M. (2002) Biochim. Biophys. Acta 1588, 106–112[Medline] [Order article via Infotrieve]
  16. Diederichs, S., Bulk, E., Steffen, B., Ji, P., Tickenbrock, L., Lang, K., Zanker, K. S., Metzger, R., Schneider, P. M., Gerke, V., Thomas, M., Berdel, W. E., Serve, H., and Muller-Tidow, C. (2004) Cancer Res. 64, 5564–5569[Abstract/Free Full Text]
  17. Marsit, C. J., Karagas, M. R., Danaee, H., Liu, M., Andrew, A., Schned, A., Nelson, H. H., and Kelsey, K. T. (2006) Carcinogenesis 27, 112–116[Abstract/Free Full Text]
  18. Yamashita, K., Mimori, K., Inoue, H., Mori, M., and Sidransky, D. (2003) Cancer Res. 63, 6575–6578[Abstract/Free Full Text]
  19. Minn, A., Schubert, M., Neiss, W. F., and Muller-Hill, B. (1998) Glia 22, 338–347[CrossRef][Medline] [Order article via Infotrieve]
  20. Medveczky, P., Antal, J., Patthy, A., Kekesi, K., Juhasz, G., Szilagyi, L., and Graf, L. (2006) FEBS Lett. 580, 545–552[CrossRef][Medline] [Order article via Infotrieve]
  21. Ossovskaya, V. S., and Bunnett, N. W. (2004) Physiol. Rev. 84, 579–621[Abstract/Free Full Text]
  22. Nystedt, S., Emilsson, K., Wahlestedt, C., and Sundelin, J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 9208–9212[Abstract/Free Full Text]
  23. Bohm, S. K., Kong, W., Bromme, D., Smeekens, S. P., Anderson, D. C., Connolly, A., Kahn, M., Nelken, N. A., Coughlin, S. R., Payan, D. G., and Bunnett, N. W. (1996) Biochem. J. 314, 1009–1016[Medline] [Order article via Infotrieve]
  24. Vu, T. K., Hung, D. T., Wheaton, V. I., and Coughlin, S. R. (1991) Cell 64, 1057–1068[CrossRef][Medline] [Order article via Infotrieve]
  25. Blackhart, B. D., Emilsson, K., Nguyen, D., Teng, W., Martelli, A. J., Nystedt, S., Sundelin, J., and Scarborough, R. M. (1996) J. Biol. Chem. 271, 16466–16471[Abstract/Free Full Text]
  26. Kawabata, A., Saifeddine, M., Al-Ani, B., Leblond, L., and Hollenberg, M. D. (1999) J. Pharmacol. Exp. Ther. 288, 358–370[Abstract/Free Full Text]
  27. Loew, D., Perrault, C., Morales, M., Moog, S., Ravanat, C., Schuhler, S., Arcone, R., Pietropaolo, C., Cazenave, J. P., van Dorsselaer, A., and Lanza, F. (2000) Biochemistry 39, 10812–10822[CrossRef][Medline] [Order article via Infotrieve]
  28. Kahn, M. L., Zheng, Y. W., Huang, W., Bigornia, V., Zeng, D., Moff, S., Farese, R. V., Jr., Tam, C., and Coughlin, S. R. (1998) Nature 394, 690–694[CrossRef][Medline] [Order article via Infotrieve]
  29. Xu, W. F., Andersen, H., Whitmore, T. E., Presnell, S. R., Yee, D. P., Ching, A., Gilbert, T., Davie, E. W., and Foster, D. C. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 6642–6646[Abstract/Free Full Text]
  30. Grishina, Z., Ostrowska, E., Halangk, W., Sahin-Toth, M., and Reiser, G. (2005) Br. J. Pharmacol. 146, 990–999[CrossRef][Medline] [Order article via Infotrieve]
  31. Wang, Y., Luo, W., Wartmann, T., Halangk, W., Sahin-Toth, M., and Reiser, G. (2006) J. Neurochem. 99, 759–769[CrossRef][Medline] [Order article via Infotrieve]
  32. Steinhoff, M., Vergnolle, N., Young, S. H., Tognetto, M., Amadesi, S., Ennes, H. S., Trevisani, M., Hollenberg, M. D., Wallace, J. L., Caughey, G. H., Mitchell, S. E., Williams, L. M., Geppetti, P., Mayer, E. A., and Bunnett, N. W. (2000) Nat. Med. 6, 151–158[CrossRef][Medline] [Order article via Infotrieve]
  33. de Garavilla, L., Vergnolle, N., Young, S. H., Ennes, H., Steinhoff, M., Ossovskaya, V. S., D'Andrea, M. R., Mayer, E. A., Wallace, J. L., Hollenberg, M. D., Andrade-Gordon, P., and Bunnett, N. W. (2001) Br. J. Pharmacol. 133, 975–987[CrossRef][Medline] [Order article via Infotrieve]
  34. Vergnolle, N., Bunnett, N. W., Sharkey, K. A., Brussee, V., Compton, S. J., Grady, E. F., Cirino, G., Gerard, N., Basbaum, A. I., Andrade-Gordon, P., Hollenberg, M. D., and Wallace, J. L. (2001) Nat. Med. 7, 821–826[CrossRef][Medline] [Order article via Infotrieve]
  35. Kawabata, A., Kawao, N., Kuroda, R., Tanaka, A., Itoh, H., and Nishikawa, H. (2001) Neuroreport. 12, 715–719[CrossRef][Medline] [Order article via Infotrieve]
  36. Amadesi, S., Nie, J., Vergnolle, N., Cottrell, G. S., Grady, E. F., Trevisani, M., Manni, C., Geppetti, P., McRoberts, J. A., Ennes, H., Davis, J. B., Mayer, E. A., and Bunnett, N. W. (2004) J. Neurosci. 24, 4300–4312[Abstract/Free Full Text]
  37. Amadesi, S., Cottrell, G. S., Divino, L., Chapman, K., Grady, E. F., Bautista, F., Karanjia, R., Barajas-Lopez, C., Vanner, S., Vergnolle, N., and Bunnett, N. W. (2006) J. Physiol. 575, 555–571[Abstract/Free Full Text]
  38. Grant, A. D., Cottrell, G. S., Amadesi, S., Trevisani, M., Nicoletti, P., Materazzi, S., Altier, C., Cenac, N., Zamponi, G. W., Bautista-Cruz, F., Lopez, C. B., Joseph, E. K., Levine, J. D., Liedtke, W., Vanner, S., Vergnolle, N., Geppetti, P., and Bunnett, N. W. (2007) J. Physiol. 578, 715–733[Abstract/Free Full Text]
  39. Darrow, A. L., Fung-Leung, W. P., Ye, R. D., Santulli, R. J., Cheung, W. M., Derian, C. K., Burns, C. L., Damiano, B. P., Zhou, L., Keenan, C. M., Peterson, P. A., and Andrade-Gordon, P. (1996) Thromb. Haemost. 76, 860–866[Medline] [Order article via Infotrieve]
  40. Damiano, B. P., Cheung, W. M., Santulli, R. J., Fung-Leung, W. P., Ngo, K., Ye, R. D., Darrow, A. L., Derian, C. K., de Garavilla, L., and AndradeGordon, P. (1999) J. Pharmacol. Exp. Ther. 288, 671–678[Abstract/Free Full Text]
  41. Oikonomopoulou, K., Hansen, K. K., Saifeddine, M., Tea, I., Blaber, M., Blaber, S. I., Scarisbrick, I., Andrade-Gordon, P., Cottrell, G. S., Bunnett, N. W., Diamandis, E. P., and Hollenberg, M. D. (2006) J. Biol. Chem. 281, 32095–32112[Abstract/Free Full Text]
  42. Bohm, S. K., Khitin, L. M., Grady, E. F., Aponte, G., Payan, D. G., and Bunnett, N. W. (1996) J. Biol. Chem. 271, 22003–22016[Abstract/Free Full Text]
  43. Asfaha, S., Brussee, V., Chapman, K., Zochodne, D. W., and Vergnolle, N. (2002) Br. J. Pharmacol. 135, 1101–1106[CrossRef][Medline] [Order article via Infotrieve]
  44. Caterina, M. J., Schumacher, M. A., Tominaga, M., Rosen, T. A., Levine, J. D., and Julius, D. (1997) Nature 389, 816–824[CrossRef][Medline] [Order article via Infotrieve]
  45. Caterina, M. J., Leffler, A., Malmberg, A. B., Martin, W. J., Trafton, J., Petersen-Zeitz, K. R., Koltzenburg, M., Basbaum, A. I., and Julius, D. (2000) Science 288, 306–313[Abstract/Free Full Text]
  46. Davis, J. B., Gray, J., Gunthorpe, M. J., Hatcher, J. P., Davey, P. T., Overend, P., Harries, M. H., Latcham, J., Clapham, C., Atkinson, K., Hughes, S. A., Rance, K., Grau, E., Harper, A. J., Pugh, P. L., Rogers, D. C., Bingham, S., Randall, A., and Sheardown, S. A. (2000) Nature 405, 183–187[CrossRef][Medline] [Order article via Infotrieve]
  47. Katona, G., Berglund, G. I., Hajdu, J., Graf, L., and Szilagyi, L. (2002) J. Mol. Biol. 315, 1209–1218[CrossRef][Medline] [Order article via Infotrieve]
  48. Szilagyi, L., Kenesi, E., Katona, G., Kaslik, G., Juhasz, G., and Graf, L. (2001) J. Biol. Chem. 276, 24574–24580[Abstract/Free Full Text]
  49. Szepessy, E., and Sahin-Toth, M. (2006) FEBS J. 273, 2942–2954[CrossRef][Medline] [Order article via Infotrieve]
  50. Camerer, E., Huang, W., and Coughlin, S. R. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 5255–5260[Abstract/Free Full Text]
  51. Riewald, M., Kravchenko, V. V., Petrovan, R. J., O'Brien, P. J., Brass, L. F., Ulevitch, R. J., and Ruf, W. (2001) Blood 97, 3109–3116
  52. Compton, S. J., Renaux, B., Wijesuriya, S. J., and Hollenberg, M. D. (2001) Br. J. Pharmacol. 134, 705–718[CrossRef][Medline] [Order article via Infotrieve]
  53. Compton, S. J., Sandhu, S., Wijesuriya, S. J., and Hollenberg, M. D. (2002) Biochem. J. 368, 495–505[CrossRef][Medline] [Order article via Infotrieve]
  54. Nakayama, T., Hirano, K., Shintani, Y., Nishimura, J., Nakatsuka, A., Kuga, H., Takahashi, S., and Kanaide, H. (2003) Br. J. Pharmacol. 138, 121–130[CrossRef][Medline] [Order article via Infotrieve]
  55. Cenac, N., Garcia-Villar, R., Ferrier, L., Larauche, M., Vergnolle, N., Bunnett, N. W., Coelho, A. M., Fioramonti, J., and Bueno, L. (2003) J. Immunol. 170, 4296–4300[Abstract/Free Full Text]
  56. Nguyen, C., Coelho, A. M., Grady, E., Compton, S. J., Wallace, J. L., Hollenberg, M. D., Cenac, N., Garcia-Villar, R., Bueno, L., Steinhoff, M., Bunnett, N. W., and Vergnolle, N. (2003) Can J. Physiol. Pharmacol. 81, 920–927[CrossRef][Medline] [Order article via Infotrieve]
  57. Coelho, A. M., Vergnolle, N., Guiard, B., Fioramonti, J., and Bueno, L. (2002) Gastroenterology 122, 1035–1047[CrossRef][Medline] [Order article via Infotrieve]
  58. Cottrell, G. S., Amadesi, S., Pikios, S., Camerer, E., Willardsen, J. A., Murphy, B. R., Caughey, G. H., Wolters, P. J., Coughlin, S. R., Peterson, A., Knecht, W., Pothoulakis, C., Bunnett, N. W., and Grady, E. F. (2007) Gastroenterology 132, 2422–2437[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
A. J. Ramsay, Y. Dong, M. L. Hunt, M. Linn, H. Samaratunga, J. A. Clements, and J. D. Hooper
Kallikrein-related Peptidase 4 (KLK4) Initiates Intracellular Signaling via Protease-activated Receptors (PARs): KLK4 AND PAR-2 ARE CO-EXPRESSED DURING PROSTATE CANCER PROGRESSION
J. Biol. Chem., May 2, 2008; 283(18): 12293 - 12304.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. A. Salameh, A. S. Soares, A. Hockla, and E. S. Radisky
Structural Basis for Accelerated Cleavage of Bovine Pancreatic Trypsin Inhibitor (BPTI) by Human Mesotrypsin
J. Biol. Chem., February 15, 2008; 283(7): 4115 - 4123.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/36/26089    most recent
M703840200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Knecht, W.
Right arrow Articles by Bunnett, N. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knecht, W.
Right arrow Articles by Bunnett, N. W.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement