HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 282, Issue 36, 26460-26470, September 7, 2007

This Article Abstract Full Text (PDF) All Versions of this Article: 282/36/26460    most recent M610579200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Deng, W.-G. Articles by Ji, L. Search for Related Content PubMed PubMed Citation Articles by Deng, W.-G. Articles by Ji, L. Social Bookmarking                      What's this?

Tumor-specific Activation of Human Telomerase Reverses Transcriptase Promoter Activity by Activating Enhancer-binding Protein-2 in Human Lung Cancer Cells^*

From the Section of Thoracic Molecular Oncology, Department of Thoracic and Cardiovascular Surgery, University of Texas M. D. Anderson Cancer Center, Houston, Texas, 77030

Received for publication, November 14, 2006 , and in revised form, July 12, 2007.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The up-regulated expression and telomerase activity of human telomerase reverse transcriptase (hTERT) are hallmarks of tumorigenesis. The hTERT promoter has been shown to promote hTERT gene expression selectively in tumor cells but not in normal cells. However, little is known about how tumor cells differentially activate hTERT transcription and induce telomerase activity. In this study, we identified activating enhancer-binding protein-2 (AP-2) as a novel transcription factor that specifically binds to and activates the hTERT promoter in human lung cancer cells. AP-2 was detected in hTERT promoter DNA-protein complexes formed in nuclear extracts prepared only from lung cancer cells but not from normal cells. We verified the tumor-specific binding activity of AP-2 for the hTERT promoter in vitro and in vivo and detected high expression levels of AP-2 in lung cancer cells. We found that ectopic expression of AP-2 reactivated hTERT promoter-driven reporter green fluorescent protein (GFP) gene and endogenous hTERT gene expression in normal cells, enhanced GFP gene expression in lung cancer cells, and prolonged the life span of primary lung bronchial epithelial cells. Furthermore, we found that inhibition of endogenous AP-2 expression by AP-2 gene-specific small interfering RNAs effectively attenuated hTERT promoter-driven GFP expression, suppressed telomerase activity, accelerated telomere shortening, and inhibited tumor cell growth by induction of apoptosis in lung cancer cells. Our results demonstrate the tumor-specific activation of the hTERT promoter by AP-2 and imply the potential of AP-2 as a novel tumor marker or a cancer therapeutic target.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Telomerase is an RNA-dependent DNA polymerase ribonucleoprotein enzyme that synthesizes telomeres after cell division and maintains chromosomal stability, leading to cellular immortalization (1, 2). It comprises a template-containing RNA component and a human telomerase reverse transcriptase (hTERT)² in humans (3-6). The high activity of telomerase has been implicated in cellular immortalization, transformation, and oncogenesis. Most normal somatic cells do not display telomerase activity, whereas a high level of telomerase activity is detected in germinal cells, immortalized cell lines, and 85-90% of human cancer specimens (7-13). hTERT is the catalytic subunit of telomerase (4, 5). The elevated expression of hTERT is necessary to transform normal human cells into cancer cells and is regarded as a hallmark of tumorigenesis (14). The hTERT promoter has been showed to be capable of promoting both constitutive hTERT gene and transgene expression selectively in tumors but not in normal cells (15-17). This is largely attributed to the unique ability of tumor cells to up-regulate hTERT transcription. The expression of hTERT is tightly regulated by various cellular factors. For example, expression of c-Myc has been shown to induce the expression of hTERT, whereas the expression of SP1 (stimulating protein-1) suppresses it (18, 19). Two E-boxes and an activating enhancer-binding protein-2 (AP-2) site in a 320-bp region of the hTERT promoter have been shown to be essential for the transcriptional activity of the hTERT gene in RD rhabdomyosarcoma cells (20). The transforming growth factor- signaling molecule Smad3 has also been shown recently to participate in regulating hTERT gene transcription by acting as a repressor directly (21). However, it remains unclear how hTERT is inactivated during development and how it is reactivated during tumorigenesis. We hypothesized that certain cellular regulatory factors that are differentially expressed or specifically bind to the hTERT promoter in either tumor or normal cells regulate cell-selective activation or repression of hTERT expression. In this study, we discovered and identified several potential tumor-specific hTERT promoter-binding proteins by streptavidin-agarose pulldown assay and high-throughout proteomics in human lung cancer cells. One of the proteins we identified is the transcription factor AP-2, which was detected in the hTERT promoter DNA-protein complexes in nuclear extracts prepared only from lung cancer cells but not from normal cells.

AP-2 is a member of the AP-2 transcription factor family, the members of which bind GC-rich consensus sequences and regulate the expression of many downstream genes. The AP-2 family consists of five different isoforms known as AP-2, AP-2, AP-2, AP-2, and AP-2. They are encoded by separate genes and have different biologic functions (22-25). The expression of AP-2 is tissue- and cell-specific. AP-2 and AP-2 have been shown to be capable of controlling the expression of many cancer-related genes such as HER-2 (26), p21 (27), c-kit (28), bcl-2 (29), vascular endothelial growth factor (30), MUC18 (31), and p53 (32). Recent studies have also shown that AP-2 and AP-2 have tumor-suppressive activity in breast cancer, melanoma, and prostate cancer cells (30, 32-38). Decreased expression of AP-2 or AP-2 has been found in these tumor cells and is associated with disease progression and the metastatic capabilities of the tumors. Restoration of AP-2 or AP-2 expression reduces tumorigenesis and inhibits tumor cell growth. However, so far, the role of AP-2 in regulating cancer-related gene expression is largely unknown. Here we show that AP-2 specifically bound to the hTERT promoter and activated hTERT promoter-driven gene expression in human cancer cells. In vitro and in vivo DNA-protein binding assays revealed the tumor cell-selective binding of AP-2 to the hTERT promoter. Reverse transcription (RT)-PCR and immunoblot analyses also showed high expression of AP-2 at the mRNA and protein levels in various lung cancer cells. Moreover, we found that exogenous overexpression of AP-2 considerably enhanced hTERT promoter-driven green fluorescent protein (GFP) gene expression in human lung cancer cells and reactivated GFP gene expression in normal lung cells cotransfected with AP-2- and hTERT-GFP-expressing plasmids. However, treatment with AP-2-specific small interfering RNA (siRNA) largely attenuated hTERT promoter-mediated gene expression in lung cancer cells. Furthermore, we found that the AP-2 siRNA could greatly inhibit telomerase activity and tumor cell growth in human lung cancer cells. Because the expression of hTERT is closely related to tumorigenesis and tightly regulated at the transcriptional level, our identification of AP-2 as a tumor-specific hTERT promoter activator suggests that the AP-2 protein might serve as a biomarker for diagnosing cancer or as a cancer therapeutic target by inhibiting hTERT activity and tumor cell growth.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Cell Lines—Human non-small cell lung cancer (NSCLC) cell lines (H1299, A549, and H322) and an immortalized human embryonic kidney cell line (293) were maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum and 5% glutamine. Telomerase-transformed and immortalized normal human bronchial epithelial (HBE) and primary HBE (PHBE) cells (Clonetics, Walkersville, MD) were cultured in the medium supplied by the manufacturer according to the instructions provided. Normal human lung fibroblast WI-38 and VA13 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. All cells were incubated in a humidified incubator supplied with 5% carbon dioxide.

Plasmid Vectors—Recombinant plasmid vectors expressing wild-type AP-2 (driven by a cytomegalovirus (CMV) promoter) and a GFP reporter (driven by a CMV or an hTERT promoter) were used in the transfection experiments. The plasmid vector LacZ, which contains a -galactosidase gene, was used as a nonspecific negative control. These recombinant plasmid vectors were constructed at our laboratory.

DNA-Protein Binding Assay—DNA-protein binding assays were performed using a streptavidin-agarose bead pulldown assay as described previously (39, 40). Briefly, 80-90% confluent cells were harvested, and nuclear extracts were prepared. The biotin-labeled double-stranded oligonucleotide probes were synthesized by Sigma based on hTERT promoter sequence -378 to +60 or the AP-2 consensus sequence (sense, 5'-GATCGAACTGACCGCCCGCGGCCCGT-3'). A non-relevant biotinylated sequence (5'-AGAGTGGTCACTACCCCCTCTG-3') was included as a control. The binding assay was performed by mixing 1 mg of the nuclear proteins, 10 µg of the biotin-labeled DNA oligonucleotides, and 100 µl of streptavidin-agarose beads (Sigma). The mixture was incubated at room temperature for 2 h with shaking. The beads were then pelleted by centrifugation at 500 x g in a microcentrifuge for 1 min and washed three times with cold phosphate-buffered saline (PBS). The bound proteins were eluted for further analysis.

Identification of hTERT Promoter-binding Proteins—The hTERT promoter-binding proteins were separated by 4-15% SDS-PAGE and visualized by silver staining. The protein bands of interest were cut and digested with trypsin on a gel or chip. The digested samples were subjected to peptide mapping and N-terminal amino acid sequencing using surface-enhanced laser desorption ionization interfaced with new high-end quad-ruple time-of-flight tandem mass spectrometry (MS/MS) (Ciphergen Biosystems, Inc. Fremont, CA) and other micro-protein sequencing methods. The identities of the proteins were searched and verified via available data bases and software such as TagIdent (ca.expasy.org) for calculated protein pI and mass, ProFound (prowl.rockefella.edu/) for peptide mass, and Biomarker Wizard (Ciphergen Biosystems, Inc.) for MS-based peptide mapping.

Chromatin Immunoprecipitation (ChIP)—The ChIP assay was done as described previously (39, 40). Briefly, 1% formaldehyde was added to the culture medium; after incubation for 20 min at 37 °C, the cells were washed twice with PBS, scraped, and lysed for 10 min at 4 °C in lysis buffer (10 mM Tris-HCl (pH 8.0), 1% SDS, 1 mM phenylmethylsulfonyl fluoride, pepstatin A, and aprotinin). Lysates were sonicated three times for 10 s each, and the debris was removed by centrifugation. One-third of the lysate was used as the DNA input control. The remaining two-thirds of the lysate was diluted 10-fold with dilution buffer (10 mM Tris-HCl (pH 8.0), 50 mM NaCl, 0.01% SDS, 1% Triton X-100, and 1 mM EDTA), followed by incubation overnight at 4 °C with anti-AP-2 antibody or non-immune rabbit IgG (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Immunoprecipitated complexes were collected using protein A/G-agarose beads (Santa Cruz Biotechnology, Inc.). The precipitates were extensively washed and incubated in elution buffer (1% SDS and 0.1 M NaHCO₃) at room temperature for 20 min. Cross-linking of DNA-protein complexes was reversed at 65 °C for 5 h, followed by treatment with 100 µg/ml proteinase K for 3 h at 50 °C. The DNA was extracted three times with phenol/chloroform and precipitated with ethanol. Pellets were resuspended in Tris/EDTA buffer and subjected to PCR amplification using specific hTERT promoter primers (5'-primer, ^-378TGGCCCCTCCCTCGGGTTAC^-359; and 3'-primer, ⁺⁶⁰CCAGGGCTTCCCACGTGCGC⁺⁴¹). The resulting product of 438 bp for the hTERT promoter was separated by 2% agarose gel electrophoresis.

Transient Transfection—The cells were transfected with N-(1-(2,3-dioleoyloxyl)propyl)-N,N,N-trimethylammoniummethyl sulfate/cholesterol-encapsulated plasmid DNA nano-particles. In brief, 2 µl of N-(1-(2,3-dioleoyloxyl)propyl)-N,N,N-trimethylammoniummethyl sulfate/cholesterol and 4 µg of plasmid DNA were mixed, and the mixture was slowly added to each well in a 6-well plate and incubated for 72 h. The GFP-expressing plasmid vector was used a transfection control to assess the transfection efficiency. The transfection efficiency was in the range of 40-60% in these cell lines.

Western Blot Analysis—Western blots were probed with a specific antibody to AP-2, general transcription factor IIB, or -actin (Santa Cruz Biotechnology, Inc.). The protein bands were detected by enhanced chemiluminescence.

RT-PCR—Total cellular RNA was isolated using TriReagent RNA isolation reagent (Invitrogen) according to the manufacturer's instructions. Aliquots (1 µg) of total RNA were used to produce cDNA using Moloney murine leukemia virus reverse transcriptase (Invitrogen) and oligo(dT)₁₅ primer (Roche Applied Science) in a final volume of 20 µl. The cDNA products (1 µl) obtained were used for the PCR amplification of AP-2. The sense and antisense primers used for AP-2 were as follows ^-378TGGCCCCTCCCTCGGGTTAC^-359 (5'-primer) and ⁺⁶⁰CCAGGGCTTCCCACGTGCGC⁺⁴¹ (3'-primer), respectively. The 438-bp DNA fragment amplified by PCR was obtained. The PCR conditions were 95 °C for 5 min; 30 amplification cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min; with a final extension at 72 °C for 5 min. The PCR products from each sample were subjected to electrophoresis on 2% agarose gels, stained with ethidium bromide, and photographed.

Cell Viability and Apoptosis Assay—Cell growth inhibition and apoptosis analysis was performed as described previously (41). Cell viability was analyzed by counting viable cells using a trypan blue exclusion assay. The percentage of viable cells was calculated in terms of the number of treated cells relative to the number of control cells. Apoptosis was measured by flow cytometry using a terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling (TUNEL)-based fluorescence-activated cell sorting (FACS) assay. The relative number of apoptotic cells was calculated in terms of the TUNEL-positive values in cells. Experiments were repeated three times with quadruplicate samples for each treatment in each experiment.

siRNAs—The siRNAs expressing vector were prepared with a transcription-based method using a Silencer siRNA construction kit (Ambion, Inc., Austin, TX) according to the manufacturer's instructions. Cells were transfected with siRNA duplexes using Oligofectamine reagent (Invitrogen). The sequences of 21-nucleotide sense and antisense RNAs were as follows: siAP-2-1, 5'-GCUGUUCACUUAGCUAGGGTT-3' (sense) and 5'-CCCUAGCUAAGUGAACAGCTT-3' (antisense) for the AP-2 gene (-998 to -978); siAP-2-2, 5'-GCUGUUCACUUAGCUAGGGTT-3' (sense) and 5'-CCCUAGCUAAGUGAACAGCTT-3' (antisense); and nonspecific control siRNA (siNSC), 5'-AAUGGUCCGAAUCUAGUGUUU-3' (sense) and 5'-AAAAACACUAGAUUCGGACCA-3' (antisense) (as a nonspecific control scrambled siRNA). These siRNAs were prepared with a transcription-based method using the Silencer siRNA construction kit according to manufacturer's instructions. Cells were transfected with siRNA duplexes using Oligofectamine reagent.

Electrophoretic Mobility Shift Assay (EMSA)—The AP-2 consensus oligonucleotides (sense, 5'-GATCGAACTGACCGCCCGCGGCCCGT-3'; and antisense, 5'-CAGGGCCGCGGGCGGTCAGTTCGATC-3') were obtained from Promega Corp. (Madison, WI). The hTERT promoter oligonucleotides with an AP-2-binding site (-43 to -18) were synthesized by Sigma. The probes were end-labeled with [-³²P]ATP using T4 kinase (Promega Corp.). EMSA was prefomed by incubating 10 µg of nuclear extract with a labeled probe (10,000 cpm, 10 fmol) in binding buffer containing 15 mM Tris-HCl (pH 7.5) 100 mM KCl, 5 mM MgCl₂, 1 mM EDTA, 12% glycerol, 5 µg of bovine serum albumin, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, and 1.5 µg of poly(dI-dC). To assess the specificity of DNA-protein binding, up to a 50-fold molar excess of unlabeled wild-type or mutant oligonucleotide was added. The mixture was applied to 4% polyacrylamide gel and subjected to electrophoresis at 300 V for 45 min, and the complex was detected by autoradiography.

Telomerase Activity Assays—Telomerase activity was analyzed by a highly sensitive qualitative photometric enzyme immunoassay utilizing the telomeric repeat amplification protocol with a TeloTAGGG telomerase PCR enzyme-linked immunosorbent assay kit (Roche Applied Science) according to the manufacturer's instruction.

Telomere Length Assay—Telomere length was measured by a highly sensitive nonradioactive chemiluminescence assay utilizing Southern blot analysis of terminal restriction fragments obtained by digestion of genomic DNA with frequently cutting restriction enzymes (HinfI/RsaI) with a TeloTAGGG telomere PCR length assay kit (Roche Applied Science) according to the manufacturer's instructions. Telomeric smears were revealed by exposure on x-ray film.

Statistical Analyses—All experiments were performed at least three times with triplicate samples. Analysis of variance and Student's t test were used to compare the values of the test and control samples in vitro and in vivo. p < 0.05 was considered statistically significant. StatView 5.0 (Abacus Concepts, Inc., Berkeley, CA) and SAS software were used for all statistical analyses. The significance was evaluated by the paired t test.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Detection and Identification of Tumor-specific hTERT Promoter-binding Proteins—The streptavidin-agarose bead pulldown assay is a useful and feasible approach for detecting DNA-binding proteins such as transcription activators and coactivators (42). In this study, we also used this technique to discover and detect the tumor-specific cellular protein factors that specifically bind to the hTERT promoter. We designed and synthesized a 438-bp biotin-labeled double-stranded oligonucleotide corresponding to the 5'-flanking sequence of the hTERT gene from -378 to +60 as a DNA probe (Fig. 1A) to assess the binding of cellular protein factors to the hTERT promoter region. Nuclear extracts prepared from human lung cancer cells (H1299, A549, and H322) and normal lung cell lines (HBE, WI-38, and VA13) were incubated with the 5'-biotinylated hTERT promoter probe to form a DNA-protein complex, and the nuclear proteins that specifically bound to the hTERT probe were pulled down using streptavidin-agarose beads. The nuclear extract prepared from 293 cells, which possess a high intrinsic hTERT activity, was used as a positive control. After elution, the hTERT promoter-binding proteins were separated by 4-20% SDS-PAGE and visualized by silver staining.

View larger version (76K): [in this window] [in a new window]   FIGURE 1. Detection and identification of tumor-specific hTERT promoter-binding proteins. Nuclear proteins prepared from lung cancer and normal lung cells were incubated with biotin-labeled hTERT oligonucleotide probes and streptavidin-agarose beads. Nuclear protein from the immortalized cell line 293 was used as a positive control. The DNA-protein complexes were separated by SDS-PAGE, and protein bands were visualized by silver staining. The protein of interest was dissected from the gel and digested with trypsin. The peptide digests were loaded onto an H50 ProteinChip array and analyzed by surface-enhanced laser desorption ionization MS. The hTERT promoter-binding protein was identified by peptide mapping using the Pro-Found program. A, the schematic illustration of the prototypic probe used in this study shows a biotin-labeled double-stranded DNA corresponding to hTERT promoter sequence -378 to +60. Key regulatory elements are shown. B, the SDS-PAGE image shows hTERT promoter-binding proteins. The arrow indicates the tumor cell-selective hTERT promoter-binding protein.

Validation of AP-2 as a Tumor-specific hTERT Promoter-binding Protein—To verify that AP-2 is a tumor cell-selective hTERT promoter-binding protein, we performed immunoblot analyses with the complexes consisting of nuclear proteins, the hTERT promoter probe, and streptavidin-agarose beads using anti-AP-2 antibody. A small biotinylated oligonucleotide probe that does not harbor any known regulatory element was included as a probe control in each experiment. Antibodies against von Willebrand factor (a plasma protein) and AP-2 (an isoform of the AP-2 family) were used as negative and nonspecific positive controls, respectively. We clearly detected the AP-2 proteins in the complexes prepared from the human lung cancer cell lines H1299, A549, and H322 and from the immortalized 293 cells but not from the normal lung cell lines HBE and WI-38 (Fig. 2A), demonstrating the tumor cell-selective binding of AP-2 to the hTERT promoter. However, we detected the binding of AP-2 to the hTERT promoter probe in the complexes prepared from both lung cancer and normal cell lines. Because von Willebrand factor is a plasma protein, we included it in every experiment as a negative control. It was undetectable in the complexes from nuclear extracts of lung cancer and normal cells (Fig. 2A). Thus, these results show the specificity of AP-2 binding to the hTERT promoter in human lung cancer cells. Because a computer-aided transcription factor-binding site analysis revealed a consensus AP-2-binding site in the hTERT promoter, we also detected the binding of AP-2 to a specific AP-2 consensus sequence probe. Consistent with the results observed above, a high level of binding of AP-2 to the AP-2 consensus probe was detected in lung cancer cells but not in normal cells (Fig. 2B), supporting the finding that AP-2 binding is tumor-specific.

To determine whether the tumor-specific binding of AP-2 to the hTERT promoter observed in vitro could be reproduced under a physiological condition, we also analyzed the binding of AP-2 to the chromatin hTERT promoter in living cells by a ChIP assay using a specific antibody against AP-2. Normal IgG and AP-2 were used as negative and positive controls, respectively. As expected, we detected a high degree of binding of AP-2 to the chromatin hTERT promoter in lung cancer and immortalized cells but not in normal lung cells (Fig. 2C). In contrast, the binding of AP-2 to the hTERT promoter was seen in both lung cancer and normal lung cells. The DNA binding was undetectable when using a normal IgG control in the ChIP assay (Fig. 2C). These results confirmed the specificity of AP-2 binding in tumor cells.

Because EMSA is a conventional approach for detecting binding between transcription factors and promoter DNA, we also evaluated the binding of AP-2 to the hTERT promoter by this gel shift assay. EMSA was performed using a radiolabeled DNA probe corresponding to the hTERT promoter region with AP-2-binding sites (-43 to -18) and nuclear proteins prepared from lung cancer cells (H1299 and H322) and normal lung cells (HBE and WI-38). Supershifts of the protein-probe complex were detected by a specific antibody against AP-2. Consistent with the results from immunoblotting and ChIP assays, the binding of AP-2 to the hTERT promoter probe could be detected in lung cancer and normal cells. However, the protein-probe complexes were supershifted only in the presence of anti-AP-2 antibodies and nuclear proteins prepared from lung cancer cells; no supershifts were detected using anti-AP-2 antibodies, the hTERT promoter probe, and nuclear proteins from normal lung cells (WI-38 and HBE) (Fig. 2D).

View larger version (61K): [in this window] [in a new window]   FIGURE 2. Validation of AP-2 as a tumor-specific hTERT promoter-binding protein. A and B, immunoblot assay for detection of AP-2 binding to a biotinylated hTERT promoter probe (-378 to +60) or to an AP-2 consensus oligonucleotide probe, respectively. AP-2 protein in the nuclear protein-hTERT probe-streptavidin bead complexes was detected by Western blot assay using anti-AP-2 antibody. The antibodies (Abs) against von Willebrand factor (vWF) and AP-2 were used as negative and positive controls, respectively. A nonspecific probe(NSP)was used as a probe control.C,ChIP assay for detection of AP-2 binding to the hTERT promoter in the chromatin structure. ChIP was performed as described under "Experimental Procedures" using anti-AP-2 antibody. Normal IgG and anti-AP-2 antibody were used as negative and positive controls, respectively. PCR amplification was performed using primers corresponding to the hTERT promoter sequence, and the resultant DNA fragments of 438 bp for hTERT were separated on 2% agarose gels. D, EMSA for detection of AP-2 binding to the hTERT promoter probe. EMSA was carried out using a radiolabeled hTERT promoter oligonucleotide probe corresponding to hTERT promoter sequence -43 to -18. The results of the supershift assay showed a complex of AP-2 with the hTERT promoter probe using anti-AP-2 antibody (Ab). The specificity of binding was determined by the addition of a 50-fold molar excess of unlabeled wild-type AP-2 probe (WT) or a 50-fold molar excess of unlabeled mutant probe (MT). The data are representative of three experiments with similar results.

Endogenous Expression of AP-2 in Human Lung Cancer Cells—To determine whether the tumor-specific binding of AP-2 to the hTERT promoter is due to tumor-selectively elevated expression of AP-2, we detected AP-2 expression at the mRNA and protein levels in human lung cancer and normal lung cells by RT-PCR and Western blot analysis, respectively. We detected the expression of AP-2 mRNA (Fig. 3A) and protein in both the cytosol (Fig. 3B) and nuclei (Fig. 3C) in all three lung cancer cell lines and the immortalized cell line 293. The expression of AP-2 at the mRNA and protein levels was also detected in the normal lung cell lines WI-38 and HBE. However, a 3-4-fold reduction in AP-2 in the normal cell nuclei was observed compared with the cancer cell lines (Fig. 3, A-C). These results suggest that the function of AP-2 in regulating hTERT or other cancer-related gene expression may be controlled not just by AP-2 protein abundance or expression level but mainly by its nuclear translocation or DNA binding activity.

Activation of hTERT Promoter-driven Gene Expression by AP-2 Overexpression—To understand the specific function of AP-2 in regulation of hTERT promoter-mediated gene expression, we cotransfected normal lung cells (WI-38 and HBE) and lung cancer cells (H1299 and H322) with plasmids expressing AP-2 driven by a CMV promoter and a GFP reporter driven by the hTERT or CMV promoter. LacZ was used as a transfection control. The expression of the GFP gene was detected by fluorescence microscopy, and the GFP-positive cell population and intensity of the sorted GFP cells were analyzed by a FACS assay. Exogenous expression of AP-2 reactivated hTERT promoter-mediated GFP expression in normal cells and greatly enhanced GFP expression in lung cancer cells (Fig. 4A), resulting in a considerable increase in both the GFP-positive cell population (Fig. 4B) and the fluorescence intensity of the GFP protein (Fig. 4C) in cells cotransfected with AP-2 and hTERT-GFP plasmids compared with those in cells cotransfected with LacZ and hTERT-GFP plasmids. In contrast, overexpression of AP-2 did not alter CMV promoter-driven GFP expression in normal lung and lung cancer cells cotransfected with AP-2 and CMV-GFP plasmids (Fig. 4, A-C).

To confirm the role of AP-2 in regulating hTERT promoter activity, we further evaluated the effect of ectopic expression of AP-2 on endogenous hTERT expression and hTERT activity in normal WI-38 and HBE cells. We found that ectopic expression of AP-2 up-regulated the expression of the endogenous hTERT gene in AP-2-transfected WI-38 and HBE cells compared with LacZ-transfected control cells as indicated by a semiquantitative RT-PCR assay (Fig. 4D). Ectopic expression of AP-2 also markedly activated hTERT as indicated by a 40-50% in increase in telomerase activity in AP-2-transfected WI-38 and HBE cells compared with LacZ-transfected control cells (Fig. 4E), suggesting that AP-2 specifically regulates hTERT promoter activity and thus activates hTERT promoter-driven gene expression.

View larger version (36K): [in this window] [in a new window]   FIGURE 3. Expression of AP-2 in lung cancer and normal lung cells. The levels of AP-2 mRNA (A) and AP-2 proteins in the cytosol (B) and nuclei (C) were detected by RT-PCR and Western blot assay in lung cancer cells (H1299, A549, and H322), normal lung cells (WI-38 and HBE), and immortalized cells (293). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), -actin, and general transcription factor IIB (TFIIB) were used as loading controls. All experiments were performed at least three times. C1 and C2 denote DNA-positive control and PCR control, respectively.

View larger version (54K): [in this window] [in a new window]   FIGURE 4. Effect of AP-2 overexpression on hTERT promoter-driven gene expression. A-C, activation of hTERT promoter-driven GFP gene expression by AP-2 overexpression. Normal human lung cells (WI-38 and HBE) and lung cancer cells (H1299 and H322) were cotransfected with AP-2- and hTERT or CMV promoter-driven GFP-expressing plasmids. CMV-driven LacZ was used as a negative control. At 72 h after transfection, the expression of GFP was analyzed by fluorescence microscopy (magnification x40) (A). The percentage of the GFP-positive cell population (B) and the fluorescence intensity of the GFP protein derived from 5000 cells (C) were determined by FACS analysis. D and E, activation of endogenous hTERT expression by ectopic expression of AP-2. Normal lung cell lines (WI-38 and HBE) were transfected with AP-2-expressing plasmids. LacZ was used as a negative control. After 72 h, the cells were harvested; the levels of hTERT mRNA (D) were determined by RT-PCR using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a loading control; and the activity of telomerase (E) was analyzed using a telomeric repeat amplification protocol assay-based TeloTAGGG telomerase PCR enzyme-linked immunosorbent assay. At least three separate experiments with duplicate samples were performed. The error bars represent S.E. from the three separate experiments. NC and PC, negative and positive controls, respectively, for telomerase analysis.

View larger version (36K): [in this window] [in a new window]   FIGURE 5. Effect of AP-2 siRNA on hTERT promoter-driven gene expression. Human lung cancer cells (H1299 and H322) were cotransfected with AP-2-specific siRNA (siAP-2-1 or siAP-2-2) and hTERT promoter-driven GFP-expressing plasmids. PBS and siNSC were used as negative and transfection controls, respectively. At 72 h after transfection, the expression of nuclear AP-2 in H1299 cells (A) was detected by Western blotting. General transcription factor IIB (TFIIB) was used a loading control. The binding of AP-2 to a biotinylated hTERT promoter probe (B) or to the chromatin hTERT promoter in living cells (C) was analyzed in H1299 cells by streptavidin-agarose pulldown and ChIP assays, respectively. The expression of GFP was detected by fluorescence microscopy (magnification x40) (D). The percentage of the GFP-positive cell population (E) and the fluorescence intensity of the GFP protein derived from 5000 cells (F) were measured by FACS analysis. siNSC was used as a control. At least three separate experiments done in duplicate were performed. The error bars represent S.E. from three separate experiments. NSP, nonspecific oligonucleotide probe; Abs, antibodies; Ctrl, control.

To further verify the involvement of hTERT expression and activity in AP-2 siRNA-mediated tumor suppression, we constructed a ponasterone A-inducible hTERT-expressing plasmid and used it to establish an H1299 subline stably expressing hTERT. We determined the effect of AP-2 siRNAs on telomerase activity and tumor suppression in the absence and presence of induced ectopic expression of hTERT in hTERT-expressing stable H1299 cells. The PBS- and siNSC-treated cells were used as negative controls. Consistent with the results observed in the parental H1299 cells, a considerable inhibition of both telomerase activity (Fig. 7A) and cell viability (Fig. 7B) and elevated induction of apoptosis (Fig. 7C) were detected in the hTERT-expressing stable H1299 cells treated with AP-2 siRNAs in the absence of the ponasterone A inducer. However, the AP-2 siRNA-induced telomerase activity inhibition (Fig. 7A) and tumor suppression (Fig. 7, B and C) clearly appeared to be partially rescued by the induced ectopic expression of AP-2 in these siRNA-treated stable H1299 cells in the presence of 10 µM ponasterone A. These results suggest that one of the pathways in the AP-2 siRNA-induced inhibition of tumor cell growth and apoptosis is mediated by a specific inhibition of hTERT activity.

View larger version (33K): [in this window] [in a new window]   FIGURE 6. Effect of AP-2 siRNA on telomerase activity and tumor suppression in normal lung and lung cancer cells. Normal human lung fibroblast (WI-38) and HBE cells and lung cancer cells (H322 and H1299) were transfected with AP-2 siRNA (siAP-2-1 or siAP-2-2)- or siNSC-expressing plasmids. At 72 h after transfection, telomerase activity was measured using a telomeric repeat amplification protocol-based qualitative photometric enzyme immunoassay with a TeloTAGGG telomerase PCR enzyme-linked immunosorbent assay kit (A). Cell viability was analyzed by counting the number of viable cells (B). Cells treated with siNSC were used as the reference group, with cell viability set at 100%. Apoptosis was measured by a TUNEL-based FACS assay (C). Three separate experiments done in duplicate were performed, and the means ± S.E. were calculated. NC and PC, negative and positive controls, respectively, for telomerase analysis.

View larger version (27K): [in this window] [in a new window]   FIGURE 7. Effect of AP-2 siRNA on telomerase activity and tumor cell growth in inducible hTERT-expressing stable H1299 cells. Ectopic hTERT-expressing stable H1299 cells were transfected with AP-2 siRNA (siAP-2-1 or siAP-2-2)- or siNSC-expressing plasmids. At 48 h after transfection, cells were treated with or without 10 µM ponasterone A (PA) inducer. After 48 h of ponasterone A induction, cells were harvested, and telomerase activity (A), cell viability (B), and apoptosis (C) were analyzed. Relative cell viability was calculated using the parental H1299 cells treated with PBS alone as 100%. The results represent the means of three separate experiments with duplicate samples, and the error bars indicate S.E. NC and PC, negative and positive controls, respectively, for telomerase analysis.

View larger version (72K): [in this window] [in a new window]   FIGURE 8. Effect of AP-2 on telomere length and cell life span. NSCLC H1299 or normal PHBE cells were continuously transfected with AP-2 siRNA (siAP-2-1)- or AP-2-expressing plasmid vectors over 28 days through seven cell passages. At 28 days (seventh passage, H1299) or 12 days (third passage, PHBE), the AP-2 protein levels (A), telomerase activity (B), and telomere length (C) were determined in viable cells. For cell life span experiments, pictures of PHBE cells at each transfection passage (D) were taken by microscopy (magnification x40). siNSC and LacZ were used as negative controls for H1299 and PHBE cells, respectively. Three experiments for each sample were performed, and the means ± S.E. were calculated. TRF, terminal restriction fragments; MK, marker; P, passage number of transfection.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In this study, we used the hTERT promoter as a model because high expression of hTERT is an important hallmark of tumorigenesis. Recently, hTERT was proposed as a therapeutic target for cancer because of its nearly universal expression in human tumors and its critical functional role in oncogenesis (44). Consequently, it is rather reasonable to hypothesize that the tumor-specific activation of the hTERT promoter may be regulated by various cellular factors such as transcription factors and effectors, which are differentially activated in tumor cells or repressed in normal cells. These tumor-specific cellular factors can either specifically bind to the hTERT promoter or interact with its effectors to differentially regulate hTERT transcription. A large class of cancer-linked genes can be assigned to the DNA-binding proteins, the function of which is controlled not just by their abundance or expression level, but mainly at the level of their activity in terms of their interactions with DNA and protein targets. Because the AP-2 protein was selectively detected in DNA-binding protein complexes from lung cancer cells but not from normal cells, we postulated that the up-regulated hTERT promoter activity in those tumor cells was due to an increase in the binding activity of AP-2 or to the increased import of AP-2 into the nucleus. The results from our in vitro and in vivo experiments confirmed this notion and illustrate the high specificity of AP-2 in tumor-specific telomerase activation, although the exact molecular mechanism controlling this import process is unknown. Moreover, because we did not detect an obvious difference in the binding of AP-2 (another isoform of the AP-2 family) between lung cancer and normal lung cells, it seems unlikely that the AP-2 isoform plays a key role in regulating hTERT gene expression in lung cancer development and progression. Taken together, our results indicate the specificity of AP-2 binding to the hTERT promoter in lung cancer cells and imply that AP-2 might be a potential biomarker for the diagnosis of lung cancer.

Furthermore, our findings shed light on the biologic roles of AP-2 in regulating activation of the hTERT promoter. The results from our transfection experiments indicate that exogenous expression of AP-2 not only greatly enhances the activity of the hTERT promoter in tumor cells but also reactivates the hTERT promoter in normal cells. Overexpression of AP-2 elevated the expression of the hTERT promoter-driven GFP reporter gene without altering the expression of the CMV promoter-driven GFP gene. We also found that ectopic expression of AP-2 in primary normal bronchial epithelial cells increased endogenous telomerase activity and prolonged cell proliferation and survival, although no measurable loss of telomeres was detected in untransfected and LacZ-transfected cell controls. The data from our siRNA experiments in lung cancer cells further confirmed the role of AP-2 in selectively regulating telomerase activity and altering telomere length in tumor cells.

In view of the broad involvement of AP-2 in the transcriptional activation of the hTERT promoter, AP-2 is likely to control a large number of cancer-linked genes, notably oncogenic genes. The AP-2 family members AP-2 and AP-2 have been implicated in the progression, vascularization, metastasis, and/or recurrence of tumors, and they constitute good prognostic factors for melanoma and breast and prostate cancers (34-38). Our study has revealed that the effect of AP-2 on the tumor cell-selective activation of the hTERT promoter is not simply a question of expression level but rather is defined by regulation of the binding of AP-2 to the hTERT promoter. Although the functions of AP-2 and AP-2 have been extensively studied, so far, little is known about regulation of AP-2 in telomerase activity and tumor suppression. Because the telomerase enzyme is a novel target for potential anticancer therapy and stem cell expansion, we explored the biologic effects of AP-2 siRNAs by evaluating their effects on telomerase activity and tumor suppression. An important finding of this study is that we observed that the siRNA of AP-2 dramatically inhibited telomerase activity in lung cancer cells, largely suppressed tumor cell growth, and induced apoptosis, suggesting that it is a potential therapeutic drug for cancer treatment. The observed immediate effects of AP-2 siRNAs on tumor growth inhibition and apoptosis induction may be partially interpreted by the fact that AP-2 is also a general transcription activator that controls or regulates multiple biologically important gene activities and that knockdown of AP-2 expression by siRNA may therefore block other cell proliferation-associated genes under the influence of AP-2 in addition to activation of the hTERT promoter. Additional studies are needed to elucidate the role of AP-2 siRNA in tumor suppression in association with other genes and other types of human cancers.

In summary, we discovered and identified the transcription factor AP-2 as a tumor-specific hTERT promoter-binding protein in human lung cancer cells. Our results demonstrate that AP-2 specifically activates hTERT promoter activity and up-regulates hTERT promoter-driven gene expression. Moreover, AP-2 siRNA suppresses telomerase activity and tumor cell growth in lung cancer cells. Because activation of telomerase is tightly regulated at the transcriptional level, these data demonstrate that AP-2 could serve as a molecular marker for tumor detection or as a therapeutic target for anticancer therapy.

	FOOTNOTES

 
^* This work was supported by NCI Specialized Program of Research Excellence Grants CA70970, MMHCC U01CA10535201, and R01CA116322 from the National Institutes of Health (to L. J.); Department of Defense TARGET Lung Cancer Programs Grant DAMD17-02-1-070; NCI Support Core Grant CA16672 from the National Institutes of Health (to the M. D. Anderson Cancer Center); and a grant from the Tobacco Settlement Funds as appropriated by the Texas State Legislature. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ To whom correspondence should be addressed: Dept. of Thoracic and Cardiovascular Surgery, Unit 445, University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Houston, TX 77030. Tel.: 713-563-9143; Fax: 713-794-4901; E-mail: lji{at}mdanderson.org.

² The abbreviations used are: hTERT, human telomerase reverse transcriptase; AP-2, activating enhancer-binding protein-2; RT, reverse transcription; GFP, green fluorescent protein; siRNA, small interfering RNA; NSCLC, non-small cell lung cancer; HBE, human bronchial epithelial; PHBE, primary human bronchial epithelial; CMV, cytomegalovirus; PBS, phosphate-buffered saline; MS, mass spectrometry; ChIP, chromatin immunoprecipitation; TUNEL, terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling; FACS, fluorescence-activated cell sorting; siNSC, nonspecific control small interfering RNA; EMSA, electrophoretic mobility shift assay.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Blackburn, E. H. (1992) Annu. Rev. Biochem. 61, 113-129[CrossRef][Medline] [Order article via Infotrieve]
2. Greider, C. W., and Blackburn, E. H. (1989) Nature 337, 331-337[CrossRef][Medline] [Order article via Infotrieve]
3. Blackburn, E. H. (1991) Nature 350, 569-573[CrossRef][Medline] [Order article via Infotrieve]
4. Weinrich, S. L., Pruzan, R., Ma, L., Ouellette, M., Tesmer, V. M., Holt, S. E., Bodnar, A. G., Lichtsteiner, S., Kim, N. W., Trager, J. B., Taylor, R. D., Carlos, R., Andrews, W. H., Wright, W. E., Shay, J. W., Harley, C. B., and Morin, G. B. (1997) Nat. Genet. 17, 498-502[CrossRef][Medline] [Order article via Infotrieve]
5. Nakamura, T. M., Morin, G. B., Chapman, K. B., Weinrich, S. L., Andrews, W. H., Lingner, J., Harley, C. B., and Cech, T. R. (1997) Science 277, 955-959[Abstract/Free Full Text]
6. Feng, J., Funk, W. D., Wang, S.-S., Weinrich, S. L., Avilion, A. A., Chiu, C.-P., Adams, R. R., Chang, E., Allsopp, R. C., Yu, J., Le, S., West, M. D., Harley, C. B., Andrews, W. H., Greider, C. W., and Villeponteau, B. (1995) Science 269, 1236-1241[Abstract/Free Full Text]
7. Rhyu, M. S. (1995) J. Natl. Cancer Inst. 87, 884-894[Abstract/Free Full Text]
8. Kim, N. W., Piatyszek, M. A., Prowse, K. R., Harley, C. B., West, M. D., Ho, P. L., Coviello, G. M., Wright, W. E., Weinrich, S. L., and Shay, J. W. (1994) Science 266, 2011-2015[Abstract/Free Full Text]
9. Nakano, K., Watney, E., and McDougall, J. K. (1998) Am. J. Pathol. 153, 857-864[Abstract/Free Full Text]
10. Boldrini, L., Faviana, P., Gisfredi, S., Zucconi, Y., Di Quirico, D., Donati, V., Berti, P., Spisni, R., Galleri, D., Materazzi, G., Basolo, F., Miccoli, P., Pingitore, R., and Fontanini, G. (2002) Int. J. Mol. Med. 10, 589-592[Medline] [Order article via Infotrieve]
11. Park, T. W., Riethdorf, S., Riethdorf, L., Loning, T., and Janicke, F. (1999) Int. J. Cancer 84, 426-431[CrossRef][Medline] [Order article via Infotrieve]
12. Kanaya, T., Kyo, S., Takakura, M., Ito, H., Namiki, M., and Inoue, M. (1998) Int. J. Cancer 78, 539-543[CrossRef][Medline] [Order article via Infotrieve]
13. Janknecht, R. (2004) FEBS Lett. 564, 9-13[CrossRef][Medline] [Order article via Infotrieve]
14. Hanahan, D., and Weinberg, R. A. (2000) Cell 100, 57-70[CrossRef][Medline] [Order article via Infotrieve]
15. Ducrest, A. L., Szutorisz, H., Lingner, J., and Nabholz, M. (2002) Oncogene 21, 541-552[CrossRef][Medline] [Order article via Infotrieve]
16. Kirkpatrick, K. L., Clark, G., Ghilchick, M., Newbold, R. F., and Mokbel, K. (2003) Eur. J. Surg. Oncol. 29, 321-326[CrossRef][Medline] [Order article via Infotrieve]
17. Onoda, N., Ogisawa, K., Ishikawa, T., Takenaka, C., Tahara, H., Inaba, M., Takashima, T., and Hirakawa, K. (2004) Surg. Today 34, 389-393[CrossRef][Medline] [Order article via Infotrieve]
18. Kirkpatrick, K. L., Ogunkolade, W., Elkak, A. E., Bustin, S., Jenkins, P., Ghilchick, M., Newbold, R. F., and Mokbel, K. (2003) Breast Cancer Res. Treat. 77, 277-284[CrossRef][Medline] [Order article via Infotrieve]
19. Bilsland, A. E., Stevenson, K., Atkinson, S., Kolch, W., and Keith, W. N. (2006) Cancer Res. 66, 1363-1370[Abstract/Free Full Text]
20. Ma, H., Urquidi, V., Wong, J., Kleeman, J., and Goodison, S. (2003) Mol. Cancer Res. 1, 739-746[Abstract/Free Full Text]
21. Li, H., Xu, D., Toh, B.-H., and Liu, J.-P. (2006) Cell Res. 16, 169-173[CrossRef][Medline] [Order article via Infotrieve]
22. Williams, T., Admon, A., Luscher, B., and Tjian, R. (1988) Genes Dev. 2, 1557-1569[Abstract/Free Full Text]
23. Hilger-Eversheim, K., Moser, M., Schorle, H., and Buettner, R. (2000) Gene (Amst.) 260, 1-12[CrossRef][Medline] [Order article via Infotrieve]
24. Zhao, F., Satoda, M., Licht, J. D., Hayashizaki, Y., and Gelb, B. D. (2001) J. Biol. Chem. 276, 40755-40760[Abstract/Free Full Text]
25. Tummala, R., Romano, R. A., Fuchs, E., and Sinha, S. (2003) Gene (Amst.) 321, 93-102[CrossRef][Medline] [Order article via Infotrieve]
26. Pellikainen, J., Naukkarinen, A., Ropponen, K., Rummukainen, J., Kataja, V., Kellokoski, J., Eskelinen, M., and Kosma, V. M. (2004) Eur. J. Cancer 40, 1485-1495[CrossRef][Medline] [Order article via Infotrieve]
27. Li, H., Goswami, P. C., and Domann, F. E. (2006) Neoplasia 8, 568-577[CrossRef][Medline] [Order article via Infotrieve]
28. Baldi, A., Santini, D., Battista, T., Dragonetti, E., Ferranti, G., Petitti, T., Groeger, A. M., Angelini, A., Rossiello, R., Baldi, F., Natali, P. G., and Paggi, M. G. (2001) J. Cell. Biochem. 83, 364-372[CrossRef][Medline] [Order article via Infotrieve]
29. Wajapeyee, N., Britto, R., Ravishankar, H. M., and Somasundaram, K. (2006) J. Biol. Chem. 281, 16207-16219[Abstract/Free Full Text]
30. Ruiz, M., Pettaway, C., Song, R., Stoeltzing, O., Ellis, L., and Bar-Eli, M. (2004) Cancer Res. 64, 631-638[Abstract/Free Full Text]
31. Jean, D., Gershenwald, J. E., Huang, S., Luca, M., Hudson, M. J., Tainsky, M. A., and Bar-Eli, M. (1998) J. Biol. Chem. 273, 16501-16508[Abstract/Free Full Text]
32. Pellikainen, J., Kataja, V., Ropponen, K., Kellokoski, J., Pietilainen, T., Bohm, J., Eskelinen, M., and Kosma, V. M. (2002) Clin. Cancer Res. 8, 3487-3495[Abstract/Free Full Text]
33. Li, H., Watts, G. S., Oshiro, M. M., Futscher, B. W., and Domann, F. E. (2006) Oncogene 25, 5405-5415[CrossRef][Medline] [Order article via Infotrieve]
34. Gee, J. M., Robertson, J. F., Ellis, I. O., Nicholson, R. I., and Hurst, H. C. (1999) J. Pathol. 189, 514-520[CrossRef][Medline] [Order article via Infotrieve]
35. Bar-Eli, M. (2001) Pigm. Cell Res. 14, 78-85[CrossRef][Medline] [Order article via Infotrieve]
36. Tellez, C., McCarty, M., Ruiz, M., and Bar-Eli, M. (2003) J. Biol. Chem. 278, 46632-46642[Abstract/Free Full Text]
37. Karjalainen, J. M., Kellokoski, J. K., Eskelinen, M. J., Alhava, E. M., and Kosma, V. M. (1998) J. Clin. Oncol. 16, 3584-3591[Abstract]
38. Karjalainen, J. M., Kellokoski, J. K., Mannermaa, A. J., Kujala, H. E., Moisio, K. I., Mitchell, P. J., Eskelinen, M. J., Alhava, E. M., and Kosma, V. M. (2000) Br. J. Cancer 82, 2015-2021[CrossRef][Medline] [Order article via Infotrieve]
39. Deng, W.-G., and Wu, K. K. (2003) J. Immunol. 171, 6581-6588[Abstract/Free Full Text]
40. Deng, W.-G., Tang, S. T., Tseng, H. P., and Wu, K. K. (2006) Blood 108, 518-524[Abstract/Free Full Text]
41. Ueda, K., Kawashima, H., Ohtani, S., Deng, W., Ravoori, M., Bankson, J., Gao, B., Girard, L., Minna, J. D., Roth, J. A., Kundra, V., and Ji, L. (2006) Cancer Res. 66, 9682-9690[Abstract/Free Full Text]
42. Deng, W.-G., Zhu, Y., Montero, A., and Wu, K. K. (2003) Anal. Biochem. 323, 12-18[CrossRef][Medline] [Order article via Infotrieve]
43. Deng, W.-G., Zhu, Y., and Wu, K. K. (2004) Blood 103, 2135-2142[Abstract/Free Full Text]
44. Carpenter, E. L., and Vonderheide, R. H. (2006) Expert Opin. Biol. Ther. 6, 1031-1039[CrossRef][Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				R. H. Kim, R. Kim, W. Chen, S. Hu, K.-H. Shin, N.-H. Park, and M. K. Kang Association of hsp90 to the hTERT promoter is necessary for hTERT expression in human oral cancer cells Carcinogenesis, December 1, 2008; 29(12): 2425 - 2431. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 282/36/26460    most recent M610579200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Deng, W.-G. Articles by Ji, L. Search for Related Content PubMed PubMed Citation Articles by Deng, W.-G. Articles by Ji, L. Social Bookmarking                      What's this?