Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M704059200 on July 16, 2007

J. Biol. Chem., Vol. 282, Issue 37, 26971-26980, September 14, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/37/26971    most recent
M704059200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Longin, S.
Right arrow Articles by Janssens, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Longin, S.
Right arrow Articles by Janssens, V.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Selection of Protein Phosphatase 2A Regulatory Subunits Is Mediated by the C Terminus of the Catalytic Subunit*

Sari Longin{ddagger}, Karen Zwaenepoel{ddagger}, Justin V. Louis{ddagger}, Stephen Dilworth§, Jozef Goris{ddagger}, and Veerle Janssens, A postdoctoral fellow of the Fonds voor Wetenschappelijk Onderzoek-Vlaanderen{ddagger}1

From the {ddagger}Protein Phosphorylation and Proteomics Laboratory, Department of Molecular Cell Biology, Faculty of Medicine, KULeuven, Herestraat 49 bus 901, B-3000 Leuven, Belgium and §Department of Metabolic Medicine, Imperial College Faculty of Medicine, Hammersmith Hospital, London W12 0NN, United Kingdom

Received for publication, May 16, 2007 , and in revised form, July 13, 2007.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Protein phosphatase 2A (PP2A) is a family of multifunctional serine/threonine phosphatases all composed of a catalytic C, a structural A, and a regulatory B subunit. Assembly of the complex with the appropriate B subunit forms the key to the functional specificity and regulation of PP2A. Emerging evidence suggests a crucial role for methylation and phosphorylation of the PP2A C subunit in this process. In this study, we show that PP2A C subunit methylation was not absolutely required for binding the PR61/B' and PR72/B'' subunit families, whereas binding of the PR55/B subunit family was determined by methylation and the nature of the C-terminal amino acid side chain. Moreover mutation of the phosphorylatable Tyr307 or Thr304 residues differentially affected binding of distinct B subunit family members. Down-regulation of the PP2A methyltransferase LCMT1 by RNA interference gradually reduced the cellular amount of methylated C subunit and induced a dynamic redistribution of the remaining methylated PP2AC between different PP2A trimers consistent with their methylation requirements. Persistent knockdown of LCMT1 eventually resulted in specific degradation of the PR55/B subunit and apoptotic cell death. Together these results establish a crucial foundation for understanding PP2A regulatory subunit selection.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Protein phosphatase 2A (PP2A)2 represents a family of heterotrimeric serine/threonine phosphatases implicated in the regulation of a plethora of cellular processes such as apoptosis, transcription, translation, DNA replication, signal transduction, protection against tumorigenesis, and cell division (for reviews, see Refs. 1 and 2). It is estimated that, depending on the cell type, PP2A holoenzymes are responsible for 30–50% of the total cellular serine/threonine dephosphorylating activity, demonstrating the importance of this enzyme system for almost any aspect of life.

The basis of this broad functional importance is formed by the diversity of specific PP2A subunit compositions. Typically the PP2A core enzyme exists as a dimer (PP2AD) consisting of a catalytic subunit (C subunit/PP2AC) and a scaffolding A subunit (PR65/A subunit). Proper functioning and regulation of PP2A is achieved by the association of regulatory B subunits3 with the PP2A core enzyme, resulting in the formation of heterotrimeric PP2A holoenzymes with specific catalytic properties, subcellular locations, and substrate specificities. At present, three multigene families of B-type subunits have been described, PR55/B, PR61/B', and PR72/B'', all with specific cellular functions. Therefore, the assembly of the complex with the appropriate B-type subunit is the key to specificity and regulation of PP2A (2). In this process, the highly conserved C-terminal PP2AC tail seems to play a crucial role (3, 4). Recently a major breakthrough has been achieved by elucidating the crystal structure of a heterotrimeric PP2AT61{gamma} holoenzyme (5, 6). It was shown that the C-terminal PP2AC tail recognizes a surface groove at the interface between the PR65 and PR61{gamma} subunits and is thus clearly in a crucial position to influence the binding of the B subunits. Remarkably this tail can undergo two types of post-translational modifications: phosphorylation and methylation. Phosphorylation of Tyr307 or of an unidentified threonine residue (potentially Thr304) was found to inactivate PP2A (7, 8). Methylation occurs on the carboxyl group of the C-terminal leucine 309 residue of PP2AC (911) and is catalyzed by an S-adenosylmethionine-dependent leucine carboxyl methyltransferase 1 (LCMT1) (12, 13), whereas demethylation is catalyzed by a specific phosphatase methylesterase (PME-1) (1416). Emerging evidence indicates that PP2AC methylation plays a crucial role in recruiting the mammalian PR55/B subunit (1719) or the yeast Cdc55p/B and Rts1p/B' subunits to the PP2A dimer (2024), thereby controlling PP2A holoenzyme assembly.

However, although the role of PP2AC methylation and phosphorylation on PR55/B-PP2AD association is well documented (3, 4), it remains to be determined whether these covalent modifications regulate the association of the other mammalian third B subunit families (PR61/B' and PR72/B'') with PP2AD in a similar manner. Here we show that each B-type subunit family requires distinct modifications or structural features of the PP2AC C-terminal tail for trimeric assembly, and these requirements can even differ between members of the same subunit family. We demonstrate that selectivity for B-type subunits is based on the methylation state of the C subunit and that cells commit to apoptosis if the subunit composition is modified by manipulating methylation states. These findings represent a first step to understand dynamic subunit interchanges that would explain differential trimeric assembly of PP2A.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmids and Antibodies—Plasmids used for the expression of GST- or HA-tagged fusion proteins were made by subcloning the appropriate human cDNAs in the pGMEX-T1,2,3 (Amersham Biosciences) and pMB001 vectors (25). The indicated mutants of PP2AC{alpha} were made according to the QuikChange protocol (Stratagene) with the appropriate primers and templates. All constructs and mutants were verified by DNA sequencing. The following primary antibodies were used in this study: mouse monoclonal anti-PP2AC and anti-PR65 antibodies as described previously (26), mouse monoclonal anti-methyl-PP2AC antibodies (Upstate), monoclonal anti-HA (clone 12CA5), anti-GST and anti-{alpha}-tubulin antibodies (Sigma), rabbit polyclonal anti-poly(ADP-ribose) polymerase antibodies (Cell Signaling Technology), and anti-PR55{alpha} antibodies (Calbiochem for Western blotting, Upstate for immunoprecipitations). The polyclonal rabbit anti-LCMT1 and anti-peptide antibodies against the C terminus of PP2AC (amino acids 299–309), specific for demethylated PP2AC, were described previously (12). The polyclonal rabbit anti-protein PME-1 and anti-PR61{delta} antibodies were described previously (Refs. 16 and 27, respectively). The polyclonal rabbit anti-PR61{alpha} was a kind gift from Dr. Brian Hemmings (Friedrich-Miescher-Institute, Basel, Switzerland). The anti-PR130 antibody will be described elsewhere.4

Cell Culture and DNA Transfection Assays—COS7 and HeLa cells were cultured in Dulbecco's modified Eagle's medium-GlutaMAX (Invitrogen) containing 1 g/liter glucose (Invitrogen) supplemented with 100 units/ml penicillin (Invitrogen), 100 mg/ml streptomycin (Invitrogen), and 10% fetal calf serum (Gentauer). 24 h after seeding, DNA was transfected into the cells with FuGENE 6 (Roche Applied Science) according to the manufacturer's protocol.

Cell Extracts, GST Pulldown Assays, and Western Blotting—48 h after transfection, cells (10-cm plate) were washed with ice-cold phosphate-buffered saline and lysed in 100 µl of ice-cold NET lysis buffer (50 mM Tris/HCl, pH 7.4, 1% Nonidet P-40, 15 mM EDTA, 150 mM NaCl) supplemented with Complete protease inhibitor mixture (Roche Applied Science). This suspension was briefly vortexed, and after 15 min of incubation on ice, it was centrifuged at 16,000 x g for 15 min at 4 °C. The supernatant (the cell extract) was used for GST pulldown assays by adding 40 µl of 50% glutathione-Sepharose beads (Amersham Biosciences) and 500 µl of NENT-100 buffer (20 mM Tris/HCl, pH 7.4, 1 mM EDTA, 0.1% Nonidet P-40, 25% glycerol, 100 mM NaCl) supplemented with 1 mg/ml bovine serum albumin and Complete protease inhibitor mixture (Roche Applied Science). After incubation of the mixture for 1 h on a rotating wheel at 4 °C, the beads were washed three times with NENT-100 buffer without bovine serum albumin. Bound proteins were eluted by addition of 25 µl of SDS sample buffer and boiling. The eluted proteins were analyzed by SDS-PAGE and Western blotting with the indicated primary antibodies and horseradish peroxidase-coupled secondary antibodies (Dako) followed by detection with the ECL Plus Western blotting detection system (Amersham Biosciences).

RNA Interference—Short interfering RNA for LCMT1 was obtained as StealthTM RNAi from Invitrogen. The following siRNA duplexes were used for RNAi-mediated knockdown of LCMT1: LCMT1 duplex a, GGCAUGGAUACCACCUUCUGGAGAU; LCMT1 duplex b, GGACACAUACUGGAUUCAAAGAGAU; and LCMT1 duplex c, CAGUCAGCUUAUAAAGGCAUUUCUA. As a negative control, a scrambled siRNA with the following sequence was used: GGCUAGGACCAUUCCGGUCAUAGAU. HeLa cells were transfected on the day of splitting at a final siRNA concentration of 5 nM using HiPerFect (Qiagen) according to the manufacturer's protocol. Alternatively a more stringent RNAi approach was achieved by transfecting the cells a second time 24 h after the first transfection. Cells were then analyzed at the indicated time.

Methylation of Immunoprecipitated PP2AC—Cell extracts from COS7 cells were made as described above except that the cells were lysed in 100 µl of ice-cold Tris-buffered saline + 0.1% Nonidet P-40 supplemented with Complete protease inhibitor mixture (Roche Applied Science). The HA-tagged fusion proteins were immunoprecipitated from the supernatant with 3 µg of anti-HA antibodies and 40 µl of 50% Protein G-Sepharose beads (Amersham Biosciences). Immunoprecipitates were washed three times with Tris-buffered saline + 0.1% Nonidet P-40 supplemented with Complete protease inhibitor mixture (Roche Applied Science) and once in T/DTT (20 mM Tris/HCl, 5 mM dithiothreitol, pH 7.4). The beads were then incubated at 30 °C with bacterially expressed and purified human GST-tagged LCMT1 (16) and 2.5 µM S-adenosyl[3H]methionine (5–10,000 cpm/pmol) in 50 mM MOPS buffer, pH 7.2, with 5 mM dithiothreitol. Samples were taken after 60 min, and reactions were stopped by addition of SDS sample buffer and boiling and were subjected to SDS-PAGE. After blotting on Hybond-P membrane (Amersham Biosciences), incorporation of radioactive [3H]methyl groups was detected with a Hyperfilm-3H (Amersham Biosciences).

FACS Analysis—FACS analysis was performed as described previously (28). Briefly 2 days after double transfection with siRNA, HeLa cells from 6-cm plates were trypsinized, seeded into 10-cm plates, and allowed to grow for 24 h before FACS analysis. If nocodazole (1 µg/ml, Sigma) was used, it was added 15 h before FACS analysis. Cells were trypsinized, centrifuged, and then incubated with 70% ethanol in phosphate-buffered saline overnight. The samples were analyzed with a Beckman Instruments Coulter Epics XL flow cytometer (Analis), and cell cycle analysis of DNA profiles was performed using Cylchred software.


Figure 1
View larger version (54K):
[in this window]
[in a new window]

 
FIGURE 1.
Differential methylation level of PP2A heterotrimers. A and B, cell extracts from COS7 cells expressing GST-tagged PR55{alpha}, PR55beta1, PR61{alpha}, PR61beta1, PR61{delta}1, PR61{epsilon}, PR72, and PR70 (full-length PR48 (26)) or GST alone were prepared and used for GST pulldown assays. Cell extracts (A) and GST pulldowns (B) were subjected to Western blotting with the indicated antibodies. All lanes were analyzed on the same blot but were originally not adjacent. C, anti-PR55{alpha} and anti-PR61{delta} immunoprecipitates (IP) were prepared from COS7 cells (IP control, no addition of antibodies) and analyzed by Western blotting for the presence of endogenous methylated, demethylated, and total PP2AC.

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Distinct Methylation Levels of PP2AC within Different Heterotrimers: PR61/B' and PR72/B'', but Not PR55/B, Subunits Can Form Trimers with Unmethylated PP2AC—To investigate the PP2AC methylation state in endogenous PP2A trimeric complexes, we were confronted with a lack of specific antibodies suitable for immunoprecipitation of specific trimeric holoenzymes. Therefore, we investigated the in vivo methylation level of different PP2A heterotrimers in recovered GST pulldown complexes of COS7 cells in which different GST-tagged B subunits were ectopically expressed. First we confirmed that overexpression of the different B subunits as such did not significantly alter the intracellular amounts of methylated, demethylated, or total PP2AC in COS7 (Fig. 1A) or HeLa cells (see Fig. 7A). Incubation of the GST pulldown blots with a methylation-independent anti-PP2AC antibody and an anti-PR65 antibody showed that each expressed GST-tagged B subunit bound endogenous catalytic and PR65 subunits (Fig. 1B). Moreover measuring phosphatase activity in the recovered GST pulldown complexes using phosphorylase a as a substrate demonstrated that the assembled PP2A complexes were functionally active (results not shown), suggesting that heterotrimers were formed. Probing of the blots with methylation-sensitive antibodies showed that only trimers encompassing a PR55/B subunit (PP2AT55{alpha},beta1) were nearly fully methylated, whereas trimers with a PR61/B' (PP2AT61{alpha},beta1,{delta}1,{epsilon}) or PR72/B'' (PP2AT72,70) subunit contained a mixture of methylated and demethylated catalytic subunits (Fig. 1B). (Note that the different B subunits differ in their capacity to bind endogenous PP2AC, and therefore the amount of bound demethylated and methylated PP2AC should be compared with each other for the same B subunit.)


Figure 2
View larger version (58K):
[in this window]
[in a new window]

 
FIGURE 2.
Methylation state of various PP2AC C-terminal mutants. A, COS7 cells overexpressing HA alone, HA-tagged wild-type PP2AC, or the mutants L309A, L309V, L309{Delta}, Y307F, Y307D, T304A, or T304D were used to prepare anti-HA immunoprecipitates. An in vitro methylation assay was performed. The blots were subsequently incubated with anti-HA antibodies to detect the amount of immunoprecipitated HA-tagged catalytic subunits. B, HA immunoprecipitates were prepared from COS7 cells overexpressing HA alone, HA-tagged wild-type PP2AC or the mutants L309A, L309V, L309{Delta}, Y307F, Y307D, T304A, T304D, or T304{Delta}. The immunoprecipitates were then analyzed by Western blotting for the presence of endogenous PR65 and expressed HA-tagged PP2AC subunits.

 
To further substantiate our findings and to prove that the GST pulldown assay is reliable and reflective of the endogenous situation, we performed immunoprecipitations of endogenous PR55{alpha} and PR61{delta} subunits. Fig. 1C shows that endogenous PR55 subunits only bound methylated PP2AC, whereas endogenous PR61{delta} subunits bound a mixture of demethylated and methylated PP2AC. Importantly these data confirm our GST pulldown assays (Fig. 1B) and show that the results from the expressed GST-tagged B subunits can be extrapolated to the proteins at the endogenous level, thereby validating our experimental approach to investigate the intrinsic, structural requirements of the PP2AC C-terminal tail for heterotrimeric assembly.

Methylation Potential of Various PP2AC C-terminal Mutants—We generated different point and deletion mutants of PP2AC, all affecting the highly conserved C-terminal 304TPDYFL309 tail, and expressed them as HA-tagged proteins in COS7 cells. To determine whether these mutated HA-PP2AC subunits could still be methylated, we added bacterially expressed and purified GST-tagged LCMT1 and S-adenosyl[3H]methionine to the anti-HA immunoprecipitates. Our results show that, like wild-type PP2AC, the L309A, L309V, T304A, and T304D mutants could still be methylated by LCMT1, whereas methylation of L309{Delta}, Y307D and Y307F could not be detected (Fig. 2A). Therefore, the nature of the C-terminal Leu is not an absolute requirement for methylation, and the C-terminal tail contains additional determinants. Moreover all the different point and deletion mutants of PP2AC were still capable of binding the PR65 subunit when immunoprecipitated from cells (Fig. 2B), suggesting that in contrast to yeast (22) methylation has little influence on PR65 binding.


Figure 3
View larger version (44K):
[in this window]
[in a new window]

 
FIGURE 3.
Impact of PP2AC C-terminal deletions on the formation of different PP2A heterotrimers. COS7 cells were simultaneously transfected with GST-tagged B subunits and HA-tagged wild-type PP2AC (A), L309{Delta} (B), and T304{Delta} (C). 2 days after transfection, total cell extracts were prepared and used for GST pulldown assays. Total extracts and GST pulldowns were subjected to Western blotting with the indicated antibodies. All lanes were analyzed on the same blot but were originally not adjacent (Pd, pulldown; Ex, extract).

 


Figure 4
View larger version (27K):
[in this window]
[in a new window]

 
FIGURE 4.
Mutation of Leu309 into Val, but not Ala, permits T55 formation. COS7 cells were simultaneously transfected with GST-tagged B subunits and HA-tagged L309V PP2AC (A) and L309A (B). 2 days after transfection, total cell extracts were prepared and used for GST pulldown assays. Total extracts and GST pulldowns were subjected to Western blotting with the indicated antibodies. All lanes were analyzed on the same blot but were originally not adjacent (Pd, pulldown; Ex, extract).

 
Differential Impact of the Conserved PP2AC C-terminal Tail on Binding of the Regulatory Subunits—Additional evidence that PP2AT61 and PP2AT72 do not absolutely require methylated PP2AC for holoenzyme assembly came from GST pulldown experiments with these HA-tagged mutant PP2AC subunits. First we determined whether the different GST-tagged B subunits could bind wild-type HA-tagged PP2AC. To this end, one GST-tagged B-type subunit was co-expressed with HA-PP2AC in COS7 cells, and the presence of HA-PP2AC was evaluated in GST pulldowns (Fig. 3A). Detection with anti-PP2AC antibodies showed that, in addition to HA-PP2AC, endogenous PP2AC was also incorporated into the recovered GST-B subunit complexes. This suggests that breakdown of B subunits unable to bind mutated HA-PP2AC will likely be prevented in this experimental setup because these B subunits will still form heterotrimers with endogenous PP2AC (29, 30). In addition analysis of the proportion of endogenous/HA-tagged PP2AC pulled down by the several in vivo formed GST fusion proteins revealed that the proportion was very similar with all B-type subunits tested (Fig. 3A), thereby giving additional credit to the experimental design as a reliable method that closely follows the endogenous situation. The precipitated HA-tagged PP2AC is in the same range although somewhat lower than the endogenous un-tagged PP2AC counterpart.

Subsequently we determined whether HA-tagged PP2AC lacking leucine 309 (L309{Delta}) could still associate with the different B subunits. Our results show that all members of the PR61/B' and PR72/B'' subunit families still strongly bound this mutant, whereas the PR55{alpha} and PR55beta1 subunits hardly could (Fig. 3B). Because this mutant cannot be methylated by LCMT1 (Fig. 2A), these data corroborate our previous results (Fig. 1A), demonstrating that the PR61/B' and PR72/B'' subunits can bind methylation-deficient PP2AC.

Similarly we investigated whether and how deletion of the last six C-terminal residues of PP2AC (T304{Delta}) affected PP2A heterotrimer formation. Surprisingly PR61{delta}1, PR72, and PR70, another member of the PR72/B'' family (26), could still associate with this PP2AC mutant (Fig. 3C), suggesting that these B subunits do not require any contacts with the last six C-terminal residues of PP2AC. On the other hand, the inability of the PR55{alpha},beta1 and PR61{alpha},beta1,{epsilon} subunits to bind this T304{Delta} PP2AC mutant (Fig. 3C) shows that at least something in the last six C-terminal residues of PP2AC is required for the formation of these PP2A heterotrimers.

Other Requirements for PP2AT55 Formation: Role of the Leu309 Side Chain—Whereas mutation of the C-terminal Leu309 residue into Val did not affect the binding of any PP2A B-type subunit (Fig. 4A), the L309A mutant specifically failed to bind the PR55/B family members (Fig. 4B). This is a surprising result because both L309A and L309V mutants could still be methylated (Fig. 2A). Therefore these data suggest that in addition to carboxyl methylation of Leu309, the nature of the C-terminal residue side chain is also important: possibly a bulky and/or hydrophobic side chain (isobutyl as in Leu or isopropyl as in Val) is equally well needed at this position to allow PP2AT55 formation. A shorter methyl side chain, as in alanine, is not sufficient for stable PP2AT55 formation.


Figure 5
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 5.
Role of Tyr307 in PP2A trimer formation. COS7 cells were simultaneously transfected with GST-tagged B subunits and HA-tagged Y307D PP2AC (A) and Y307F (B). 2 days after transfection, total cell extracts were prepared and used for GST pulldown assays. Total extracts and GST pulldowns were subjected to Western blotting with the indicated antibodies. All lanes were analyzed on the same blot but were originally not adjacent (Pd, pulldown; Ex, extract).

 


Figure 6
View larger version (28K):
[in this window]
[in a new window]

 
FIGURE 6.
Mutations mimicking phosphorylation of Thr304 selectively inhibit PP2AT55 formation. COS7 cells were simultaneously transfected with GST-tagged B subunits and HA-tagged T304A PP2AC (A) and T304D (B). 2 days after transfection, total cell extracts were prepared and used for GST pulldown assays. Total extracts and GST pulldowns were subjected to Western blotting with the indicated antibodies. All lanes were analyzed on the same blot but were originally not adjacent (Pd, pulldown; Ex, extract).

 


Figure 7
View larger version (66K):
[in this window]
[in a new window]

 
FIGURE 7.
Down-regulation of LCMT1 causes a decrease in the methylation level of PR61- and PR72-containing heterotrimers. The LCMT1-specific siRNA duplex, LCMT1 duplex a (+), or a control non-silencing (-) siRNA was transfected into HeLa cells. 24 h later, the cells were transfected with plasmids expressing GST-tagged PR55{alpha}, PR61{delta}1, PR61{epsilon}, or PR72 or GST alone. 72 h after transfection with the siRNA duplexes, total cell extracts were prepared and used for GST pulldown assays. Total extracts (A) and GST pulldowns (B) were subjected to Western blotting with the indicated antibodies.

 
Role of Tyr307 in PP2A Trimer Formation—By a similar approach we investigated whether phosphorylation-mimicking mutations of Tyr307 (Y307D) or mutation of Tyr307 into a non-phosphorylatable residue (Y307F) could affect PP2A heterotrimer assembly. Our results show that only PR61{delta}1, PR72, and PR70 subunits could bind these methylation-deficient mutants (Figs. 2A and 5, A and B). As for the T304{Delta} PP2AC mutant (Fig. 3C), the differential binding of the PR61 family members to these mutants was unexpected and again demonstrates that members of the PR61/B' subunit family differ in their contacts with the C-terminal tail of PP2AC: PR61{delta}1 requires no contacts at all, and PR61{alpha},beta1,{epsilon} requires a specific contact with the Tyr307 residue, likely with the hydroxyl substituent on the phenyl ring. Although at first sight the PR55/B members also seem to require these contacts, this could not be unambiguously concluded from this experiment due to the fact that the Y307D and Y307F mutants are not methylated. Given our previous findings that methylation is an absolute requirement for PP2AT55 formation, this could equally well explain the lack of Y307D or Y307F binding.

Mutations Mimicking Phosphorylation of Thr304 Selectively Inhibit PP2AT55 Formation—Whereas mutation of Thr304 into a non-phosphorylatable Ala residue (T304A) allowed formation of all the different PP2A heterotrimers (Fig. 6A), mutation of Thr304 into a phosphorylation-mimicking Asp residue (T304D) specifically prevented binding to the PR55/B subunits (Fig. 6B). Because both T304A and T304D mutants can still be methylated (Fig. 2A) and contain an intact C-terminal Leu residue, these data suggest that a non-phosphorylated threonine residue is necessary for formation of PP2AT55 and that phosphorylation of Thr304 could selectively inhibit PP2AT55 formation.

Down-regulation of LCMT1 Causes a Gradual Decrease in the PP2AC Methylation Level of PP2AT61 and PP2AT72—To better understand how methylation is influencing PP2A heterotrimer formation in vivo, we tried to manipulate the PP2AC methylation state in living cells. Overexpression of PME-1, the PP2AC-demethylating enzyme, resulted in increased PP2AC demethylation but was without any obvious cellular phenotype.5 We also reduced the expression of LCMT1, the enzyme responsible for the methylation of PP2AC, via RNA interference in HeLa cells (Fig. 7A). Although the level of LCMT1 was substantially decreased 72 h after transfection with the siRNA LCMT1 duplex a, there was not an immediate parallel decrease in methylated PP2AC. Furthermore it was confirmed that overexpression of the different B subunits did not significantly alter the intracellular amounts of methylated and total PP2AC (Fig. 7A). However, we did observe a gradual change in the recruitment of the remaining methylated PP2AC into specific PP2A trimers (Fig. 7B). More specifically, there was a reduced association of methylated PP2AC and a concomitant enhanced association of demethylated PP2AC with the PR61{delta}1, PR61{epsilon}, and PR72 subunits, whereas in PP2AT55{alpha} still equal amounts of methylated PP2AC were present. Because methylation is an absolute requirement for PP2AT55 assembly, but not for PP2AT61 or PP2AT72 assembly, it seems that when the amount of methylated PP2AC is reduced in vivo the PR55/B subunits capture the remaining methylated PP2AC at the expense of the PR61/B' and PR72/B'' subunits. The latter subunits apparently exchange methylated PP2AC for demethylated PP2AC when the levels of methylated PP2AC are reduced in vivo (see also "Discussion").


Figure 8
View larger version (43K):
[in this window]
[in a new window]

 
FIGURE 8.
Persistent knockdown of LCMT1 results in a G1 arrest, degradation of the PR55{alpha} subunit, and apoptosis. A, 72 h after transfection with siRNA duplexes directed against LCMT1 a G1 arrest is triggered. HeLa cells, transfected twice with siRNA LCMT1 duplex a, a scrambled control siRNA or buffer (=mock) were incubated with 1 µg/ml nocodazole for 15 h and subsequently prepared for FACS analysis as described under "Experimental Procedures." DNA profiles were analyzed using Cylchred software. The percentages of cells in G1, S, and G2/M are shown (means ± S.E. of three independent experiments). A Student's t test was applied to assess statistical significance of the observed differences with the control condition ("RNAi control"): p = 0.03 for RNAi LCMT1duplex a (2x) in G1 (*) and p = 0.003 for RNAi LCMT1duplex a (2x) in G2/M (**). On the right, a representative example of the DNA profile of these cells is shown. G1 and G2/M phases are shown in red, and S phase is shown in green. The arrow indicates the apoptotic-subG1 fraction of the cells. B, 96 h after RNAi-mediated knockdown of LCMT1 apoptotic cell death is induced (no nocodazole was added). HeLa cells were twice transfected with buffer (=mock), a scrambled control siRNA, or siRNA LCMT1 duplex a. 96 h after the first transfection, cell extracts were prepared and analyzed by Western blotting with the indicated antibodies. C, light microscopic images taken 96 h after transfection of HeLa cells with siRNA LCMT1 duplex a and control siRNA. D, to confirm that the downstream effects of LCMT1 knockdown are specific, two additional siRNA duplexes against LCMT1, LCMT1 duplex b and LCMT1 duplex c, were transfected in HeLa cells. Subsequently cell extracts were prepared and analyzed by Western blotting as described in B. PARP, poly(ADP-ribose) polymerase.

 
Persistent Knockdown of LCMT1 Eventually Results in Degradation of the PR55/B Subunit and Apoptotic Cell Death—To further reduce the amount of methylated PP2AC, we used a more stringent RNA interference approach by transfecting HeLa cells twice with the LCMT1-specific siRNA duplex (LCMT1 duplex a) as described under "Experimental Procedures." As shown in Fig. 8B, by this method the decrease in methylated PP2AC was more pronounced than in Fig. 7A. FACS analysis of the cell cycle profile of HeLa cells 72 h after transfection with the LCMT1 siRNA duplexes showed no apparent cell cycle arrest at first sight (results not shown). However, through the use of nocodazole (a spindle-depolymerizing agent blocking cells in G2/M) specifically in the FACS experiment, it became apparent that a significant population of the cells was in fact arrested in G1 (Fig. 8A). In addition, the DNA profile of these cells also showed a subG1-apoptotic fraction (Fig. 8A, arrow). Therefore it was not surprising that, when the cells were analyzed 96 h after transfection, massive apoptotic cell death was observed (in the absence of nocodazole) as shown by light microscopic images (Fig. 8C) and poly(ADP-ribose) polymerase cleavage (Fig. 8B). Importantly this phenotype coincides with an almost total disappearance of the PR55{alpha} subunit, whereas we could only observe a small decrease in the amount of PP2AC, PR65, PR61{alpha}, PR61{delta}1, and PR130 (Fig. 8B). Because 1) methylation is an absolute requirement for PP2AT55 formation (previous results), 2) at this time point (96 h) the cellular PP2AC methylation level is minimal (Fig. 8, B and D), and 3) it is known that monomeric PR55/B{alpha} is highly unstable (29, 30), these data suggest that the PP2AC methylation levels must have decreased below the threshold required for PP2AT55 holoenzyme assembly, thereby leading to PR55 degradation and sudden apoptotic cell death. These data therefore also suggest that the PR55 subunits play a survival role in HeLa cells.

To confirm that the downstream effects of LCMT1 knockdown (such as decreased methylated PP2AC and apoptosis) are specific, we tested two additional siRNA duplexes (LCMT1 duplexes b and c). As shown in Fig. 8D, both LCMT1-specific siRNA duplexes reduced the expression of LCMT1 and caused a decrease of methylated PP2AC. Importantly knockdown of LCMT1 by each of the three different siRNA duplexes (LCMT1 duplex a, b, or c) resulted in apoptotic cell death as indicated by poly(ADP-ribose) polymerase cleavage (Fig. 8D). These results show that the observed phenotype is a specific effect caused by the reduced expression of the PP2A methyltransferase, LCMT1.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Because PP2A is involved in almost every cellular process, tight regulation of this phosphatase is needed to ensure proper cell functioning. A major way to regulate PP2A is achieved by the controlled association of the various regulatory B subunit families (PR55/B, PR61/B', and PR72/B'') with PP2AD. Although the importance of methylation and phosphorylation of the conserved C-terminal tail of PP2AC on the association of PR55/B with PP2AD has been recognized (3, 4, 1719), it remained to be determined whether these covalent modifications might also affect the association of the other mammalian B subunit families, PR61/B' and PR72/B''.

One of the truly unexpected results of this study is the observation that methylation of PP2AC was not essential for formation of PP2A trimers with the PR61/B' and PR72/B'' subunit families, thereby demonstrating that selectivity for B-class subunits can be based on the methylation state of PP2AC. Five independent lines of evidence support these findings. First, we showed that PP2AT61 and PP2AT72 heterotrimers bound a mixture of demethylated and methylated PP2AC, whereas in PP2AT55 trimers exclusively methylated PP2AC was found. Second, deletion of Leu309 abolished PP2AT55 but not PP2AT61 and PP2AT72 formation. Third, knocking down LCMT1 caused a gradual increase in the demethylation level of PP2AT61 and PP2AT72, whereas the PR55{alpha} subunit still recruited only methylated PP2AC. Fourth, persistent knockdown of LCMT1 resulted in an almost total disappearance of the PR55{alpha} subunit and consequently apoptosis, whereas only a small decrease was observed in the amount of PP2AC, PR65, PR61{alpha}, PR61{delta}1, and PR130 subunits. Finally loss of PP2AC methylation by mutation of Tyr307 or deletion of the last six C-terminal residues (T304{Delta}) still allowed binding of PR61{delta}1, PR72, and PR70.

Methylation Competence of Various PP2AC C-terminal Mutants Correlates with the Structure of LCMT1—Our results regarding the methylation competence of different PP2AC C-terminal mutants fit very well with LCMT1 structural data (13) where it was suggested that a funnel-shaped cavity represents the PP2AC binding site with the methyl donor group of S-adenosylmethionine at the bottom of it. The minimal length to reach the bottom is six residues, explaining why L309{Delta} cannot be methylated. It was also suggested that the PP2AC binding cavity might be too narrow to harbor a phosphorylated tyrosine residue, which fits with the methylation deficiency of Y307D. The methylation deficiency of Y307F was rather unexpected but suggests an essential role for the hydroxyl group of Tyr307. There are conflicting data about this mutant: two reports showed that Y307F can be methylated and associate with the PR55/B subunit (3, 19); another group (and we) showed that this mutant cannot associate with the PR55/B subunit (4). Phosphorylation of Thr304 seems not to be a determining factor in PP2AC methylation because T304A and T304D can still both be methylated. The fact that LCMT1 can also methylate the C-terminal mutants L309A and L309V suggests that LCMT1 has an equal preference for methylating amino acids with non-polar side chains (as in Leu, Ala, or Val) at this position.

Requirements for PP2AT55 Formation—The results of the current study both confirm and extend earlier results showing that methylation and probably phosphorylation regulate PP2AT55 formation (3, 4, 1723). Indeed we confirmed that methylated PP2AC is absolutely required for assembly of PP2AT55 complexes. Surprisingly, however, methylation alone is not sufficient. Indeed whereas mutation of the C-terminal leucine residue into a valine did not affect the binding of the PR55/B subunits, substitution with an alanine did abolish PR55/B binding. Similar results were obtained in Saccharomyces cerevisiae where PP2A composition is less complex: there are single representatives of only two families of B-type subunits, the PR55/B family encoded by CDC55 and the PR61/B' family encoded by RTS1. It was shown that mutation of the C-terminal Leu into Ala inhibits Cdc55p binding, causing, among other defects, a spindle checkpoint defect (20, 22), whereas mutation of Leu into Ile could reverse this spindle checkpoint defect (20). Because our data show that both L309A and L309V can still be methylated, this suggests that, in addition to carboxyl methylation, the nature of the C-terminal amino acid side chain is also important for PP2AT55 formation. This would fit with recently obtained structural data (5, 6, 31) where it was suggested that methylation presumably facilitates B subunit recruitment by neutralizing repulsive negative charges. A short methyl side chain, as in alanine, can probably contribute insufficiently to such a charge neutralization.

From our data we could not unequivocally conclude whether Tyr307 and its phosphorylation have a role in mediating contacts with the PR55/B subunits because both mutants, Y307D and Y307F, could not be methylated anymore, possibly explaining the deficiency in PR55/B subunit binding. On the contrary, Thr304 seems to be important because PR55/B subunits were not able to bind specifically the phosphorylation-mimicking mutant, T304D. Because both T304A and T304D mutants can still be methylated, these data seem to suggest that an uncharged side chain at this position is required for mediating contacts with the PR55/B subunit family. Phosphorylation of Thr304, potentially by an autophosphorylation-activated protein kinase (8), could be a way to selectively inhibit PP2AT55 formation.

PP2AT61{alpha},beta1,{epsilon} Formation Does Not Require Methylated PP2AC but May Be Inhibited by Phosphorylation of Tyr307—Although PP2AC methylation is not required for PP2AT61 formation, some of these family members do need stabilizing contacts with the C-terminal tail of PP2AC. This was shown by the inability of the PR61{alpha},beta1,{epsilon} subunits to bind the T304{Delta}, Y307F, and Y307D PP2AC mutants, suggesting that the hydroxyl group on the phenyl ring of Tyr307 is important for PP2AT61{alpha},beta1,{epsilon} formation. Phosphorylation of Tyr307 by several tyrosine-specific kinases has been reported (7) and could as such selectively inhibit PP2AT61{alpha},beta1,{epsilon} formation. In contrast, none of the PR61/B' family members were hindered to associate with the T304D and T304A mutants, suggesting that Thr304 is not involved in mediating contacts with the PR61/B' subunit family. Importantly our data seem to fit with experiments performed in yeast where it was shown that substantial trimer formation with Rts1p/B' can occur in the absence of methylation (20, 22, 23). Moreover phosphorylation-mimicking mutations of tyrosine and threonine inhibit the formation of PP2A trimers with Cdc55p/B more severely than with Rts1p/B' (20, 22, 23). Although the PR61{gamma}1 subunit was initially not included in this study, we determined that PR61{gamma}1 could bind the L309{Delta} PP2AC mutant but could not associate with the Y307F mutant (results not shown), suggesting that this subunit behaves like PR61{alpha},beta1,{epsilon} and consequently does not need PP2AC methylation for heterotrimer formation. This is corroborated by crystallographic data showing that the hydroxyl group of Tyr307 is involved in mediating contacts with the PR61{gamma}1 subunit (5), providing a structural explanation for the binding deficiency of T304{Delta}, Y307D, and Y307F.

PP2AT61{delta}1,72,70 Formation Does Not Require Methylated PP2AC nor an Intact C-terminal PP2AC Tail—More surprising were the findings that neither methylation nor even the last six C-terminal residues of PP2AC were required for trimer formation with the PR61{delta}1, PR72, and PR70 subunits. These subunits bound a mixture of demethylated and methylated PP2AC and could associate with the methylation-deficient PP2AC mutants L309{Delta}, T304{Delta}, Y307D, and Y307F and the methylation-competent T304D and T304A mutants. Overall this indicates that the C-terminal PP2AC tail is probably not involved in mediating contacts with PR61{delta}1 and the PR72/B'' subunit family. Furthermore the differential binding of the PR61/B' family members suggests that there exist distinct contacts between the C subunit and the different PR61/B' family members and that PR61{delta}1, the largest member of the family, may have a different structural organization.

Role for Methylation and PP2AT55 in Cell Survival—Although PP2A has several apoptotic promoting activities (3234), our results and previous studies (30, 35, 36) show that PP2A also has survival promoting activities. More specifically, we now investigated the consequence of a general decrease of PP2AC methylation by RNAi-mediated knockdown of the methyltransferase. We showed that when the amount of PP2AC methylation was reduced below the threshold required for PP2AT55 holoenzyme assembly, this resulted in an almost complete breakdown of PR55{alpha} subunits accompanied by apoptotic cell death, whereas PR61 and PR72 subunits remained basically intact (Fig. 8B). We now have an explanation for this observation. Because apparently methylation of PP2AC seems only important for PP2AT55 formation and indifferent for formation of the other trimers, knockdown of LCMT leads only to degradation of PR55 subunits because only these "third" subunits will become monomeric and therefore targeted for degradation (29, 30). The PR61 and PR72 families remain stable because they remain in trimeric complexes. As a consequence, it looks like a "reshuffling" of methylated PP2AC took place and that the cell is protecting the PP2A trimer with PR55/B as long as possible, possibly by recruiting the methylated C subunit from other trimers. This might happen via an intermediary step of an unmethylated dimer because demethylation of trimers seems to be much more difficult at least in vitro (18). A precedent for such reshuffling was demonstrated by the same authors among a methylated AB'C trimer and a methylated AC dimer. Once a minimum threshold of methylation is reached, the cell prevents other catastrophes such as failure of proper chromosome disjunction (3739) by inducing apoptosis. This would fit with the conclusions of Strack et al. (30) that members of all three third subunit families in trimeric holoenzymes containing the PR65/A subunit are necessary for mammalian cell viability. Once one trimer family is missing, cells undergo apoptosis.

When the overall methylation state of PP2A was influenced by overexpression of PME-1, no phenotype could be observed.5 This result can now be understood. The formation of most trimers is not influenced, and the remaining methylated PP2AC might be sufficient to maintain a critical PP2AT55 level. In addition, demethylation of PP2AT55 might be hindered (18).

How PP2A subunit selection is regulated is an important question because major diseases (Alzheimer disease and cancer) are linked with the composition of PP2A. In Alzheimer disease, brain LCMT1 expression and PP2AC methylation are decreased (40), concomitant with a significant loss of PR55/B{alpha} subunit expression (41), leading to tau hyperphosphorylation and neurodegeneration. Our results provide an explanation why decreased PP2AC methylation selectively affects PP2AT55 trimer formation and hence PR55/B stability under these conditions.

In summary, the mammalian regulatory B subunits can be divided into three distinct groups: 1) PR55/B, 2) PR61/B'{alpha},beta1,{gamma},{epsilon}, and 3) PR61/B'{delta}1 and PR72/B'', each with specific intrinsic requirements or constraints for trimer formation (see Table 1). Our study contributes to the understanding of how methylation of Leu309 and phosphorylation of Tyr307 and/or Thr304 can provide a mechanism for modulating the distribution of the C subunit among the holoenzymes.


View this table:
[in this window]
[in a new window]

 
TABLE 1
Summary of the differential impact of residues within the conserved C-terminal PP2AC tail on methylation and binding of the mammalian A and regulatory B subunits

 
Note Added in Proof—When this work was finished and submitted for review, we became aware of the work by E. Sontag and co-workers (42). The authors basically came to the same conclusions that C-terminal methylation of PP2AC and phosphorylation of Tyr307 and Thr304 are differentially important for formation of the different holoenzyme forms. There are some apparent discrepancies, though, that might be explained by the different experimental approaches. Whereas in our study the pulldowns of the individual GST fusions with the "third" subunits would reveal rather the intrinsic affinity of a specific subunit for the mutant forms of PP2AC, the use of an IP approach with the mutant catalytic subunits would largely reflect the presence of the relative amounts and affinities of the different subunits in the cellular conditions used. As discussed, we cannot explain the conflicting data of the methylation deficiency of Y307F in our work and in Ref. 4 as opposed to the results in Ref. 3 and 19, and now also 42, which might originate from the use of one and the same construct in the latter studies.


    FOOTNOTES
 
* This work was supported by grants from the "Geconcerteerde Onderzoeks-Acties" (Flemish government), IUAP "Interuniversity Attraction Poles" (Belgian Science Policy), and F.W.O.-Vlaanderen. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

5 Longin, S., Zwaenepoel, K., Martens, E., Louis, J. V., Rondelez, E., Goris, J., and Janssens, V. (2007) Exp. Cell Res., in press. Back

1 To whom correspondence should be addressed: Afdeling Biochemie, Campus Gasthuisberg O&N1, Herestraat 49 bus 901, B-3000 Leuven, Belgium. Tel.: 32-16-330245; Fax: 32-16-345995; E-mail: Veerle.Janssens{at}med.kuleuven.be.

2 The abbreviations used are: PP2A, protein phosphatase 2A; LCMT1, leucine carboxyl methyltransferase 1;PP2AC, catalytic subunit of PP2A;PP2AD, core dimer of PP2A; PP2ATx, trimeric form of PP2A where x indicates the type of third regulatory B subunit; HA, hemagglutinin; GST, glutathione S-transferase; RNAi, RNA interference; siRNA, short interfering RNA; MOPS, 4-morpholinepropanesulfonic acid; FACS, fluorescence-activated cell sorting; PME-1, phosphatase methylesterase-1. Back

3 To indicate the whole group of third regulatory B subunits (PR55/B, PR61/B', and PR72/B'') we use the term B; to indicate the individual families we use the PR55/B, PR61/B', and PR72/B'' terminology. Back

4 V. Janssens, K. Zwaenepoel, C. Rosse, M. Petit, J. Goris, and P. Parker, manuscript in preparation. Back


    ACKNOWLEDGMENTS
 
We highly appreciate the technical assistance of M. Veeckmans, R. Verbiest, and E. Verhoeven.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Janssens, V., and Goris, J. (2001) Biochem. J. 353, 417-439[CrossRef][Medline] [Order article via Infotrieve]
  2. Janssens, V., Goris, J., and Van Hoof, C. (2005) Curr. Opin. Genet. Dev. 15, 34-41[CrossRef][Medline] [Order article via Infotrieve]
  3. Ogris, E., Gibson, D. M., and Pallas, D. C. (1997) Oncogene 15, 911-917[CrossRef][Medline] [Order article via Infotrieve]
  4. Chung, H., Nairn, A. C., Murata, K., and Brautigan, D. L. (1999) Biochemistry 38, 10371-10376[CrossRef][Medline] [Order article via Infotrieve]
  5. Cho, U. S., and Xu, W. (2006) Nature 445, 53-57
  6. Xu, Y., Xing, Y., Chen, Y., Chao, Y., Lin, Z., Fan, E., Yu, J. W., Strack, S., Jeffrey, P. D., and Shi, Y. (2006) Cell 127, 1239-1251[CrossRef][Medline] [Order article via Infotrieve]
  7. Chen, J., Martin, B. L., and Brautigan, D. L. (1992) Science 257, 1261-1264[Abstract/Free Full Text]
  8. Guo, H., and Damuni, Z. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2500-2504[Abstract/Free Full Text]
  9. Xie, H., and Clarke, S. (1993) J. Biol. Chem. 268, 13364-13371[Abstract/Free Full Text]
  10. Lee, J., and Stock, J. (1993) J. Biol. Chem. 268, 19192-19195[Abstract/Free Full Text]
  11. Favre, B., Zolnierowicz, S., Turowski, P., and Hemmings, B. A. (1994) J. Biol. Chem. 269, 16311-16317[Abstract/Free Full Text]
  12. De Baere, I., Derua, R., Janssens, V., Van Hoof, C., Waelkens, E., Merlevede, W., and Goris, J. (1999) Biochemistry 38, 16539-16547[CrossRef][Medline] [Order article via Infotrieve]
  13. Leulliot, N., Quevillon-Cheruel, S., Sorel, I., de La Sierra-Gallay, I. L., Collinet, B., Graille, M., Blondeau, K., Bettache, N., Poupon, A., Janin, J., and van Tilbeurgh, H. (2004) J. Biol. Chem. 279, 8351-8358[Abstract/Free Full Text]
  14. Lee, J., Chen, Y., Tolstykh, T., and Stock, J. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 6043-6047[Abstract/Free Full Text]
  15. Ogris, E., Du, X., Nelson, K. C., Mak, E. K., Yu, X. X., Lane, W. S., and Pallas, D. C. (1999) J. Biol. Chem. 274, 14382-14391[Abstract/Free Full Text]
  16. Longin, S., Jordens, J., Martens, E., Stevens, I., Janssens, V., Rondelez, E., De Baere, I., Derua, R., Waelkens, E., Goris, J., and Van Hoof, C. (2004) Biochem. J. 380, 111-119[CrossRef][Medline] [Order article via Infotrieve]
  17. Bryant, J. C., Westphal, R. S., and Wadzinski, B. E. (1999) Biochem. J. 339, 241-246[CrossRef][Medline] [Order article via Infotrieve]
  18. Tolstykh, T., Lee, J., Vafai, S., and Stock, J. B. (2000) EMBO J. 19, 5682-5691[CrossRef][Medline] [Order article via Infotrieve]
  19. Yu, X. X., Du, X., Moreno, C. S., Green, R. E., Ogris, E., Feng, Q., Chou, L., McQuoid, M. J., and Pallas, D. C. (2001) Mol. Biol. Cell 12, 185-199[Abstract/Free Full Text]
  20. Evans, D. R., and Hemmings, B. A. (2000) Mol. Gen. Genet. 264, 425-432[CrossRef][Medline] [Order article via Infotrieve]
  21. Wu, J., Tolstykh, T., Lee, J., Boyd, K., Stock, J. B., and Broach, J. R. (2000) EMBO J. 19, 5672-5681[CrossRef][Medline] [Order article via Infotrieve]
  22. Wei, H., Ashby, D. G., Moreno, C. S., Ogris, E., Yeong, F. M., Corbett, A. H., and Pallas, D. C. (2001) J. Biol. Chem. 276, 1570-1577[Abstract/Free Full Text]
  23. Gentry, M. S., Li, Y., Wei, H., Syed, F. F., Patel, S. H., Hallberg, R. L., and Pallas, D. C. (2005) Eukaryot. Cell 4, 1029-1040[Abstract/Free Full Text]
  24. Longin, S., and Goris, J. (2006) in The Enzymes, Protein Methyltransferase (Clarke, S. G., and Tamanoi, F., eds) Vol. 24, pp 303-324, Elsevier/Academic Press, Oxford
  25. Gijsbers, R., Ceulemans, H., Stalmans, W., and Bollen, M. (2001) J. Biol. Chem. 276, 1361-1368[Abstract/Free Full Text]
  26. Stevens, I., Janssens, V., Martens, E., Dilworth, S., Goris, J., and Van Hoof, C. (2003) Eur. J. Biochem. 270, 376-387[Medline] [Order article via Infotrieve]
  27. Martens, E., Stevens, I., Janssens, V., Vermeesch, J., Gotz, J., Goris, J., and Van Hoof, C. (2004) J. Mol. Biol. 336, 971-986[CrossRef][Medline] [Order article via Infotrieve]
  28. Janssens, V., Jordens, J., Stevens, I., Van Hoof, C., Martens, E., De Smedt, H., Engelborghs, Y., Waelkens, E., and Goris, J. (2003) J. Biol. Chem. 278, 10697-10706[Abstract/Free Full Text]
  29. Strack, S., Ruediger, R., Walter, G., Dagda, R. K., Barwacz, C. A., and Cribbs, J. T. (2002) J. Biol. Chem. 277, 20750-20755[Abstract/Free Full Text]
  30. Strack, S., Cribbs, J. T., and Gomez, L. (2004) J. Biol. Chem. 279, 47732-47739[Abstract/Free Full Text]
  31. Xing, Y., Xu, Y., Chen, Y., Jeffrey, P. D., Chao, Y., Lin, Z., Li, Z., Strack, S., Stock, J. B., and Shi, Y. (2006) Cell 127, 341-353[CrossRef][Medline] [Order article via Infotrieve]
  32. Dagda, R. K., Zaucha, J. A., Wadzinski, B. E., and Strack, S. (2003) J. Biol. Chem. 278, 24976-24985[Abstract/Free Full Text]
  33. Van Hoof, C., and Goris, J. (2003) Biochim. Biophys. Acta 1640, 97-104[Medline] [Order article via Infotrieve]
  34. Xin, M., and Deng, X. (2006) J. Biol. Chem. 281, 18859-18867[Abstract/Free Full Text]
  35. Silverstein, A. M., Barrow, C. A., Davis, A. J., and Mumby, M. C. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 4221-4226[Abstract/Free Full Text]
  36. Li, X., Scuderi, A., Letsou, A., and Virshup, D. M. (2002) Mol. Cell. Biol. 22, 3674-3684[Abstract/Free Full Text]
  37. Mayer-Jaekel, R. E., Ohkura, H., Gomes, R., Sunkel, C. E., Baumgartner, S., Hemmings, B. A., and Glover, D. M. (1993) Cell 72, 621-633[CrossRef][Medline] [Order article via Infotrieve]
  38. Gil-Bernabe, A. M., Romero, F., Limon-Mortes, M. C., and Tortolero, M. (2006) Mol. Cell. Biol. 26, 4017-4027[Abstract/Free Full Text]
  39. Queralt, E., Lehane, C., Novak, B., and Uhlmann, F. (2006) Cell 125, 719-732[CrossRef][Medline] [Order article via Infotrieve]
  40. Sontag, E., Hladik, C., Montgomery, L., Luangpirom, A., Mudrak, I., Ogris, E., and White, C. L., III (2004) J. Neuropathol. Exp. Neurol. 63, 1080-1091[Medline] [Order article via Infotrieve]
  41. Sontag, E., Luangpirom, A., Hladik, C., Mudrak, I., Ogris, E., Speciale, S., and White, C. L., III (2004) J. Neuropathol. Exp. Neurol. 63, 287-301[Medline] [Order article via Infotrieve]
  42. Nunbhakdi-Craig, V., Schuechner, S., Sontag, J. M., Montgomery, L., Pallas, D. C., Juno, C., Mudrak, I., Ogris, E., and Sontag, E. (2007) J. Neurochem. 101, 959-971[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Neurosci.Home page
J.-M. Sontag, V. Nunbhakdi-Craig, L. Montgomery, E. Arning, T. Bottiglieri, and E. Sontag
Folate Deficiency Induces In Vitro and Mouse Brain Region-Specific Downregulation of Leucine Carboxyl Methyltransferase-1 and Protein Phosphatase 2A B{alpha} Subunit Expression That Correlate with Enhanced Tau Phosphorylation
J. Neurosci., November 5, 2008; 28(45): 11477 - 11487.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. R. Junttila, S.-P. Li, and J. Westermarck
Phosphatase-mediated crosstalk between MAPK signaling pathways in the regulation of cell survival
FASEB J, April 1, 2008; 22(4): 954 - 965.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Ricotta, J. Hansen, C. Preiss, D. Teichert, and S. Honing
Characterization of a Protein Phosphatase 2A Holoenzyme That Dephosphorylates the Clathrin Adaptors AP-1 and AP-2
J. Biol. Chem., February 29, 2008; 283(9): 5510 - 5517.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/37/26971    most recent
M704059200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Longin, S.
Right arrow Articles by Janssens, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Longin, S.
Right arrow Articles by Janssens, V.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement