HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 282, Issue 37, 27100-27114, September 14, 2007

This Article Abstract Full Text (PDF) Supplemental Data All Versions of this Article: 282/37/27100    most recent M701316200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bao, S. Articles by Turk, J. Search for Related Content PubMed PubMed Citation Articles by Bao, S. Articles by Turk, J. Social Bookmarking                      What's this?

Attenuated Free Cholesterol Loading-induced Apoptosis but Preserved Phospholipid Composition of Peritoneal Macrophages from Mice That Do Not Express Group VIA Phospholipase A₂^*

Shunzhong Bao, Yankun Li, Xiaoyong Lei, Mary Wohltmann, Wu Jin, Alan Bohrer, Clay F. Semenkovich, Sasanka Ramanadham, Ira Tabas, and John Turk¹

From the Division of Endocrinology, Metabolism, and Lipid Research, Washington University School of Medicine, St. Louis, Missouri 63110 and the Departments of Medicine and of Anatomy and Cell Biology, Columbia University, New York, New York 10032

Received for publication, February 15, 2007 , and in revised form, July 10, 2007.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Mouse macrophages undergo ER stress and apoptosis upon free cholesterol loading (FCL). We recently generated iPLA₂-null mice, and here we demonstrate that iPLA₂-null macrophages have reduced sensitivity to FCL-induced apoptosis, although they and wild-type (WT) cells exhibit similar increases in the transcriptional regulator CHOP. iPLA₂-null macrophages are also less sensitive to apoptosis induced by the sarcoplasmic reticulum Ca²⁺-ATPase inhibitor thapsigargin and the scavenger receptor A ligand fucoidan, and restoring iPLA₂expression with recombinant adenovirus increases apoptosis toward WT levels. WT and iPLA₂-null macrophages incorporate [³H]arachidonic acid ([³H]AA]) into glycerophosphocholine lipids equally rapidly and exhibit identical zymosan-induced, cPLA₂-catalyzed [³H]AA release. In contrast, although WT macrophages exhibit robust [³H]AA release upon FCL, this is attenuated in iPLA₂-null macrophages and increases toward WT levels upon restoring iPLA₂ expression. Recent reports indicate that iPLA₂ modulates mitochondrial cytochrome c release, and we find that thapsigargin and fucoidan induce mitochondrial phospholipid loss and cytochrome c release into WT macrophage cytosol and that these events are blunted in iPLA₂-null cells. Immunoblotting studies indicate that iPLA₂ associates with mitochondria in macrophages subjected to ER stress. AA incorporation into glycerophosphocholine lipids is unimpaired in iPLA₂-null macrophages upon electrospray ionization-tandem mass spectrometry analyses, and their complex lipid composition is similar to WT cells. These findings suggest that iPLA₂ participates in ER stress-induced macrophage apoptosis caused by FCL or thapsigargin but that deletion of iPLA₂ does not impair macrophage arachidonate incorporation or phospholipid composition.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Phospholipases A₂ (PLA₂)² catalyze hydrolysis of the sn-2 fatty acid substituent from glycerophospholipid substrates to yield a free fatty acid, e.g. arachidonic acid, and a 2-lysophospholipid (1, 2) that have intrinsic mediator functions (3, 4) and can initiate synthesis of other mediators, such as prostaglandins, leukotrienes, epoxy-eicosatrienoates, and platelet-activating factor (PAF) (5). Mammalian PLA₂s include the PAF-acetylhydrolase PLA₂ family, which exhibits substrate specificity for PAF and oxidized phospholipids, and the secretory PLA₂ (sPLA₂), which are low molecular weight enzymes that require millimolar concentrations of [Ca²⁺] for catalysis and affect inflammation and other processes (1). Of the group IV cytosolic PLA₂ (cPLA₂) family members (1), cPLA₂ was the first identified and prefers substrates with sn-2 arachidonoyl residues, associates with its substrates in membranes when cytosolic [Ca²⁺] rises, and is also regulated by phosphorylation (6). Additional cPLA₂ family members are encoded by separate genes (7–10).

Group VI PLA₂ (iPLA₂) enzymes (11–13) do not require Ca²⁺ for catalysis and are inhibited by a bromoenol lactone (BEL) suicide substrate (14) that does not inhibit sPLA₂ or cPLA₂ at similar concentrations (14–17). Group VIA PLA₂ (iPLA₂) resides in the cytoplasm of resting cells and undergoes subcellular redistribution upon cellular stimulation (2). Group VIB PLA₂ (iPLA₂) contains a peroxisomal targeting sequence and is membrane-associated (18, 19). These enzymes belong to a larger class of serine lipases encoded by several genes (20, 21). The iPLA₂ enzymes are 84–88-kDa proteins that contain a GXSXG lipase consensus sequence and 7 or 8 stretches of a repetitive motif homologous to that of the ankyrin protein-binding domain (11–13).

In murine P388D1 macrophage-like cells iPLA₂ is proposed to generate lysophosphatidylcholine (LPC) acceptors for arachidonic acid incorporation into phosphatidylcholine (PC), based on studies with BEL or an antisense oligonucleotide that reduces iPLA₂ expression (22–25). It has also been proposed that iPLA₂ cooperates with CTP:phosphocholine cytidylyltransferase (26, 27), which catalyzes the rate-limiting step in PC synthesis, to maintain PC homeostasis by degrading excess PC, based on studies with BEL in cells that overexpress CTP:phosphocholine cytidylyltransferase (26, 27).

Many other iPLA₂ functions have been proposed (28–41), including a role for apoptosis in human U937 promonocytes induced by anti-Fas antibody (42). Hydrolysis of arachidonic acid from U937 phospholipids induced by such antibodies is inhibited by BEL (42), and U937 cell apoptosis is associated with cleavage of iPLA₂ by caspase-3 (29), a central protease in executing apoptosis. Overexpressing this iPLA₂ cleavage product amplifies both thapsigargin-induced arachidonate release and cell death (29).

Thapsigargin is a SERCA inhibitor (43) and induces loss of ER Ca²⁺ stores and apoptosis in many cells by ER stress pathways. Thapsigargin-induced apoptosis of pancreatic islet -cells and insulinoma cells requires hydrolysis of arachidonic acid from membrane phospholipids and generation of arachidonate metabolites (44) by a Ca²⁺-independent mechanism that is suppressed by BEL (45). Overexpressing iPLA₂ also amplifies thapsigargin-induced apoptosis of insulinoma cells by a BEL-sensitive mechanism (46), and these observations suggest that iPLA₂ participates in ER stress-induced -cell apoptosis.

Death of cholesterol-laden macrophages in atherosclerotic lesions (47) is thought to contribute to plaque rupture and thrombosis (48), and mouse peritoneal macrophages undergo apoptosis by a mechanism that involves ER stress when loaded with free cholesterol by incubation with acetylated low density lipoprotein (Ac-LDL) and an inhibitor of the cholesterol esterification enzyme ACAT (49–52). Free cholesterol accumulates in macrophage ER membranes, which results in SERCA-2b inhibition (51), and the macrophages subsequently undergo apoptosis, which might be attributable to ER Ca²⁺ loss and induction of ER stress in a manner analogous to events induced by thapsigargin (51, 53).

We generated iPLA₂-null mice by homologous recombination (54), and their peritoneal macrophages exhibit defective transcriptional regulation of the inducible nitric-oxide synthase gene in response to viral infection (36). Because iPLA₂ appears to participate in ER stress-induced apoptosis in U937 promonocytes (29, 42) and -cells (44–46) and because iPLA₂-null mouse macrophages exhibit signaling defects (36), we examined the possibility that iPLA₂ might be involved in free cholesterol loading-induced apoptosis by comparing responses of wild-type and iPLA₂-null macrophages. We also compared the phospholipid composition of wild-type and iPLA₂-null macrophages to examine the proposed housekeeping functions of iPLA₂ in phospholipid homeostasis (22–27).

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Materials—[5,6,8,9,11,12,14,15-³H]Arachidonic acid (217 Ci/mmol) was obtained from Amersham Biosciences; enhanced chemiluminescence (ECL) reagents from were Amersham Biosciences; standard phospholipids were from Avanti%20Polar%20Lipids">Avanti Polar Lipids (Birmingham, AL); SDS-PAGE supplies were from Bio-Rad; organic solvents were from Fisher; Coomassie reagent was from Pierce; ampicillin, kanamycin, zymosan, fucoidan, common reagents, and salts were from Sigma; culture media, penicillin, streptomycin, Hanks' balanced salt solution, L-glutamine, agarose, molecular mass standards, and RT-PCR reagents were from Invitrogen; Pentex bovine serum albumin (BSA, fatty acid-free, fraction V) was from ICN Biomedical (Aurora, OH); thapsigargin was from Calbiochem. Heat-inactivated (1 h, 65 °C) fetal bovine serum was obtained from Hyclone (Logan UT). Krebs-Ringer bicarbonate buffer contained 25 mM HEPES (pH 7.4), 115 mM NaCl, 24 mM NaHCO₃, 5 mM KCl, 1 mM MgCl₂, and 2.5 mM CaCl₂.

ACAT inhibitor 58035 (3-[decyldimethyl-silyl]-N-[2-(4methylphenyl)-1-phenylethyl]propanamide (55) was provided by J. Heider, formerly of Sandoz (East Hanover, NJ); a 10 mg ml^-1 stock solution was prepared in dimethyl sulfoxide (Me₂SO), and final Me₂SO concentration for treated and control cells was 0.05%. Cholesterol (>99% pure) was obtained from Nu Chek Prep. (Elysian, MN). LDL (d, 1.020–1.063 g ml^-1) from fresh human plasma was isolated by preparative ultracentrifugation. Acetyl-LDL was prepared by reaction with acetic anhydride (56). Anti-GADD153 (CHOP) antibody was obtained from Santa Cruz Biotechnology. Horseradish peroxidase-conjugated goat anti-rabbit IgG and goat anti-mouse IgG were from Bio-Rad.

Generating iPLA₂^-/- Knock-out Mice—The Washington University Animal Studies Committee approved all studies described in this study. Preparation of the iPLA₂ knock-out construct, its introduction into 129/SvJ mouse embryonic stem cells, their selection with G418, characterization by Southern blotting, injection into C57BL/6 mouse blastocysts, production of chimeras and then heterozygotes, and mating of heterozygotes to yield wild-type, heterozygous, and iPLA₂-null mice in a Mendelian distribution are described elsewhere, as is their genotyping by Southern blotting of tail genomic DNA (54, 57).

Isolation of Peritoneal Macrophages—As described previously (49–52), peritoneal macrophages from adult female C57BL/6 mice and mutant mice were harvested 3 days after intraperitoneal injection of 40 µg of concanavalin A in PBS (0.2 ml). Cells were incubated in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 20% L-cell-conditioned medium. Medium was replaced every 24 h until macrophages were confluent. On days of experiments, cells were washed three times with warm PBS and incubated as indicated in the figures.

Analyses of iPLA₂ mRNA in Mouse Peritoneal Macrophages and Brain—Northern blots of iPLA₂ mRNA were performed as described (54). For RT-PCR, total RNA was isolated with an RNeasy kit (Qiagen Inc.). SuperScript First Strand Synthesis System (Invitrogen) was used to synthesize cDNA in 20-µl reactions that contained DNase I-treated total RNA (2 µg). The cDNA product was treated (20 min, 37 °C) with RNase H (2 units; Invitrogen) and heat-inactivated (70 °C, 15 min). Reactions without reverse transcriptase were performed to verify the absence of genomic DNA. PCR with the pair of primers 1 and 2 amplifies a fragment that spans the neomycin resistance cassette insertion site. PCR with the pair of primers 3 and 2 amplifies a fragment downstream from that site. The sequence of primer 1 is tgtgacgtggacagcactagc, that of primer 2 is ccccagagaaacgactatgga, and that of primer 3 is tatgcgtggtgtgtacttccg.

Free Cholesterol Loading of Mouse Peritoneal Macrophages, Incubation with Thapsigargin and Fucoidan, Cell Death Assays, Caspase Activation, and Analyses of Internucleosomal DNA Cleavages—Macrophages were loaded with free cholesterol by incubation with 100 µg ml^-1 acetyl-LDL in the presence of 10 µg ml^-1 58035, which inhibits ACAT-mediated cholesterol esterification (49). Alternatively, macrophages were incubated with the SERCA inhibitor thapsigargin (0.5 µM), the scavenger receptor A ligand fucoidan (25 µg/ml), or both agents for 24 h as described (52).

At the end of the incubation, macrophages were assayed for early-to-mid stage apoptosis (i.e. externalization of phosphatidylserine) by staining with Alexa-488-labeled annexin V and for late stage apoptosis (i.e. increased membrane permeability) by staining with propidium iodide (PI) as described (49). Cells were viewed immediately with an Olympus IX-70 inverted fluorescence microscope, and six representative fields (1000 cells) for each condition were counted for the number of annexin-positive cells, PI-positive cells, and total cells. In other experiments, cell or nuclear preparations were subjected to immunoblot analyses, as described below. Activated caspase-3 in macrophages was detected with an EnzCheck caspase-3 assay kit (Invitrogen). DNA laddering kits (Roche Diagnostics) were used to analyze internucleosomal cleavages characteristic of apoptosis as described (46).

Immunoblotting of the Endoplasmic Reticulum Stress Marker CHOP—Immunoblotting of CHOP was performed as described (58, 59) with minor modifications. Briefly, cells were lysed in RIPA buffer to prepare whole-cell lysates, which were resuspended in 2x SDS-PAGE loading buffer and incubated (95 °C, 10 min). After SDS-PAGE analyses, samples were electrotransfered to 0.22-µm nitrocellulose membranes using a Bio-Rad mini-transfer tank and then incubated with primary antibodies. Protein bands were detected with horseradish peroxidase-conjugated secondary antibodies (Bio-Rad) by ECL (Amersham Biosciences). Membranes were also probed with an anti--actin monoclonal antibody to assess loading.

Preparation of Recombinant Adenovirus to Restore iPLA₂ Expression to iPLA₂-Null Cells—An adenovirus that caused expression of iPLA₂ was prepared with a ViraPower adenovirus expression system (Invitrogen) according to the manufacturer's instructions. Briefly, cDNA that encodes the 84-kDa iPLA₂ (13) was subcloned into the pENTR directional TOPO cloning vector. After sequence verification, the iPLA₂ cDNA was transferred into pAd/CMV/V5-DEST vector with the Gateway system using LR clonase (Invitrogen). Positive clones were confirmed by sequencing. The clones were linearized using PacI (New England Biolabs) and then transfected into 293A cells with Lipofectamine 2000 using Opti-MEM medium. Virus was prepared and amplified with the ViraPower adenoviral expression system (Invitrogen), and viral titers were determined by plaque-forming assays with 293A cells. An aliquot of viral suspension was used to infect mouse peritoneal macrophages, and iPLA₂ activity was assayed 3 days after infection. As a control, pAd/CMV/V5-GW/lacZ vector (Invitrogen) was transfected into 293A cells to produce lacZ-bearing adenovirus that did not contain the iPLA₂ coding sequence.

[³H]Arachidonic Acid Incorporation into and Release from Mouse Peritoneal Macrophages—Isolated macrophages were cultured in RPMI 1640 medium containing 10% heat-inactivated fetal bovine serum, 2% glutamine, and 1% nonessential amino acids (w/v). Incorporation studies involved [³H]arachidonic acid addition (final concentration 0.5 µCi/ml, 5 nM) to medium and incubation (10–60 min, 37 °C). Cells were washed three times in Krebs-Ringer bicarbonate buffer containing 5.5 mM glucose and 0.1% BSA to remove unincorporated [³H]arachidonate. Cell viability exceeded 98% by trypan blue exclusion (45). [³H]Arachidonate incorporation into phospholipid extracts was then determined by TLC and liquid scintillation spectrometry (60).

[³H]Arachidonic acid release experiments were performed at a density of 1.2 x 10⁶ cells/ml and initiated by incubation with zymosan or free cholesterol loading at 37 °C. Incubations with zymosan were performed essentially as described (61, 62). Before use, zymosan was boiled in PBS (10 min), collected by centrifugation on a tabletop centrifuge, and resuspended in PBS. The boiling procedure was then repeated twice. One mg of zymosan consisted of about 1.3 x 10⁷ particles, and 20 particles of zymosan per cell were used during 1-h incubations. Free cholesterol loading with Ac-LDL and ACAT inhibitor 58035 was performed as described above for various intervals. At the end of the incubation interval, cells were collected by centrifugation, and supernatant ³H content was determined by liquid scintillation spectrometry and normalized to the amount initially incorporated. The phospholipid content of [³H]arachidonic acid was determined as described above. Cell number was measured with a hemocytometer and protein with Coomassie Blue (Pierce).

Subcellular Fractionation to Prepare Mitochondria and Cytosol, Cytochrome c Release, and iPLA₂ Association with Mitochondria—Macrophages (2 x 10⁶ per 10-cm plate) were incubated (2 h) in culture medium, washed twice in PBS, and then incubated without or with thapsigargin (0.5 µM) and fucoidan (25 µg/ml) for various intervals, as described above. At the end of the incubation, cytosol was separated from mitochondria as described (63) with minor modifications. Briefly, 5 volumes of isolation buffer (20 mmol/liter HEPES-KOH, 100 mmol/liter KCl, 1.5 mmol/liter MgCl₂, 1 mmol/liter EGTA, 250 mmol/liter sucrose plus the protease inhibitors phenylmethylsulfonyl fluoride (1 mmol/liter) and protease inhibitor mixture (50 µl/ml)) were added to the cell pellet and left on ice for 20 min. Cells were then homogenized (Dounce apparatus, 20 strokes), and the homogenate was centrifuged (750 x g, 5 min). The pellet containing any remaining intact cells and nuclei was washed once with isolation buffer and discarded. Pooled supernatant was centrifuged (10⁵ x g, 15 min) to remove mitochondria (pellet), and the supernatant was subjected to ultracentrifugation (10⁶ x g, 1 h). Protein content of the resultant cytosolic supernatant was measured. Alternatively, in some experiments mitochondria were prepared with the Pierce isolation kit (64, 65), and their protein content was determined. Aliquots of mitochondrial and cytosolic protein were analyzed by SDS-PAGE and immunoblotted with antibodies to cytochrome c (Santa Cruz Biotechnology, Santa Cruz, CA), tubulin, iPLA₂ (antibody 509 from Dr. Richard Gross, Washington University), and the mitochondrial marker cytochrome c oxidase complex IV-subunit II (Molecular Probes, Eugene, OR) (64). Densitometric ratios of bands from immunoblots were determined with AlphaEaseFC software.

Incubating Macrophages with Exogenous Arachidonic Acid and Examining Its Incorporation into Phospholipids—Macrophages were cultured as described above in supplemented RPMI 1640 medium. Incorporation studies involved adding arachidonic acid (final concentration 10 µM) to medium and incubating (2–6 h, 37 °C). At the end of the incubation, cells were washed as above, and phospholipids were extracted and analyzed by ESI/MS/MS as described below.

Phospholipid Extraction—Macrophages collected by centrifugation and rinsed twice in PBS were sonicated on ice (20% power, 5 s bursts for 60 s, Vibra Cell probe sonicator, Sonics and Materials, Danbury, CT). Samples were centrifuged (2,800 x g, 5 min) to remove cellular debris and supernatants transferred to silanized 10-ml glass tubes and extracted by adding methanol (1 ml), chloroform (1 ml), and water (1.8 ml). Samples were vortex-mixed and centrifuged (900 x g, 5 min), and supernatants were removed, concentrated, and dissolved in methanol/chloroform (9:1). Lipid phosphorus was measured as described (66).

Positive Ion Electrospray Ionization Mass Spectrometric Analyses of Choline-containing Lipids—PC and LPC were analyzed as Li⁺ adducts by positive ion ESI/MS on a Finnigan (San Jose, CA) TSQ-7000 triple stage quadrupole mass spectrometer with an ESI source controlled by Finnigan ICIS software. Phospholipids were dissolved in methanol/chloroform (2:1, v/v) containing LiOH (10 pmol/µl), infused (1 µl/min) with a Harvard syringe pump, and analyzed as described (67–69). For tandem MS, precursor ions selected in the first quadrupole were accelerated (32–36 eV collision energy) into a chamber containing argon (2.3–2.5 mtorr) to induce collisionally activated dissociation (CAD), and product ions were analyzed in the final quadrupole. Identities of GPC species were determined from their tandem spectra (67–69), and their quantities were determined relative to internal standards 14:0/14:0-GPC and 18:0/22:6-GPC by interpolation from a standard curve (45, 60, 70, 71).

Statistical Methods—Results are presented as mean ± S.E. Data were evaluated by unpaired, two-tailed Student's t test or by analysis of variance with appropriate post hoc tests. Significance levels are described in the figure legends.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Production of iPLA₂-Null Mice and Characterization of iPLA₂ mRNA Expression in Peritoneal Macrophages and Brain—To examine expression of iPLA₂ mRNA, we compared brain, which expresses high levels of iPLA₂ (72), and peritoneal macrophages, which have not to our knowledge previously been demonstrated formally to express iPLA₂ mRNA, from wild-type and iPLA₂-null mice generated by homologous recombination (54). Northern blotting analyses were performed with a probe that recognizes sequence spanning exons 7–12 of the iPLA₂ gene. Brain and peritoneal macrophages from wild-type mice contained mRNA species of the expected size recognized by the iPLA₂ probe, but none of any size was observed in brain or macrophages from iPLA₂-null mice (Fig. 1A).

View larger version (33K): [in this window] [in a new window]   FIGURE 1. Examination of expression of iPLA2 mRNA in peritoneal macrophages and brain of wild-type and iPLA2-null mice. A contains Northern blots of total RNA from wild-type (W) and iPLA2-knock-out (K) mouse peritoneal macrophages and brain. Upper panels reflect iPLA2 mRNA and lower panels 18 S rRNA. B depicts RT-PCR using total RNA from macrophages and brain as template and primers that amplify an iPLA2 mRNA fragment. The leftmost (1st) lane displays molecular weight standards. Other lanes represent wild-type (W) or knock-out (K) mice, as indicated. N lanes are controls without template. In 2nd to 5th lanes, primers that amplify a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA fragment were included as controls.

Induction of Macrophage Apoptosis by Free Cholesterol Loading—Mouse peritoneal macrophages undergo apoptosis when loaded with free cholesterol by incubation with acetylated low density lipoprotein (Ac-LDL) and ACAT inhibitor 58035 (49–52), as illustrated by wild-type macrophage binding of fluorophore-labeled annexin V to phosphatidylserine externalized by cells undergoing apoptosis (Fig. 2A). The fraction of macrophages from iPLA₂-null mice in which apoptosis occurred in response to free cholesterol loading was less than half that for wild-type macrophages (Fig. 2B), and the increase is caspase-3 activity upon free cholesterol loading was higher for macrophages from wild-type mice compared with those from iPLA₂-null mice (Fig. 2C). The extent of apoptosis-associated internucleosomal DNA cleavage was also greater in free cholesterol-loaded peritoneal macrophages from wild-type compared with iPLA₂-null mice (Fig. 3A).

Free cholesterol loading induces apoptosis and ER stress in mouse peritoneal macrophages by a process of accumulating in ER membrane, increasing membrane order, reducing SERCA-2b activity, and depleting ER Ca²⁺ (49–52), and ER stress causes expression of the transcriptional regulator CHOP (73–75). CHOP expression is induced in mouse peritoneal macrophages from wild-type mice by free cholesterol loading (50, 52) or by incubation with thapsigargin and fucoidan (52), as illustrated in Fig. 3, B and C, respectively, and a similar degree and time course of CHOP expression occurs in iPLA₂-null macrophages, although this results in apoptosis less frequently in iPLA₂-null macrophages.

View larger version (70K): [in this window] [in a new window]   FIGURE 2. Apoptosis and caspase-3 activation induced by free cholesterol loading of peritoneal macrophages from wild-type and iPLA2-null mice. A, left column represents control macrophages from wild-type (WT) or iPLA2-knock-out (KO) mice, and the right column represents macrophages subjected to FCL. In the 2nd and 4th rows, externalization of phosphatidylserine was visualized with Alexa-488-labeled annexin V. Total cells were determined from the light micrographs in the 1st and 3rd rows. B, percent of apoptotic cells was determined from annexin-positive and total cells in six fields of 1000 cells each. C displays macrophage caspase-3 activity. B and C, CON denotes control macrophages, and FCL denotes free cholesterol-loaded macrophages. Mean values ± S.E. are displayed (n = 6). Asterisk denotes p < 0.05 for WT versus KO.

Low concentrations of thapsigargin plus fucoidan did induce apoptosis of wild-type mouse macrophages, although neither agent alone strongly induced this response (Fig. 4, upper two rows of panels, and Fig. 5A), confirming earlier reports (52). The response to the combined stimulus was attenuated with iPLA₂-null macrophages (Fig. 4, lower two rows of panels, and Fig. 5A) to a degree similar to that observed after free cholesterol loading (Figs. 2B and 5B). Apoptosis of iPLA₂-null macrophages subjected either to free cholesterol loading (Fig. 5B) or incubation with thapsigargin and fucoidan (not shown) increased toward wild-type levels upon restoring iPLA₂ expression (Fig. 5C) with a recombinant adenovirus vector construct.

Induction of ER stress in macrophages with thapsigargin or free cholesterol loading causes activation of c-Jun NH₂-terminal kinase (JNK) that is required for apoptosis under these conditions (52). We confirmed that JNK is activated in wild-type macrophages by free cholesterol loading, as reflected by JNK phosphorylation visualized by immunoblotting with antibodies to phospho-JNK, but there was no obvious difference between wild-type and iPLA₂-null macrophages (not shown), suggesting that failure to activate JNK does not account for attenuated apoptosis of iPLA₂-null macrophages.

[³H₈]Arachidonic Acid Incorporation into and Release from Mouse Peritoneal Macrophages—The facts that iPLA₂-null macrophages have reduced sensitivity to apoptosis induced by free cholesterol loading or by incubation with thapsigargin and fucoidan suggest that iPLA₂ activation might be involved in the response of wild-type macrophages to these stimuli. To test this possibility, we determined whether free fatty acid products of iPLA₂ action on phospholipids were generated by macrophages in response to free cholesterol loading.

A facile means to examine hydrolytic release of arachidonic acid from membrane phospholipids is to prelabel cellular phospholipids by incubation with [³H₈]arachidonic acid ([³H]AA), remove unincorporated radiolabel by washing with albumin-containing buffers, stimulate the cells, and measure [³H]AA released into the medium (32, 76). Because iPLA₂ has been proposed to generate LPC acceptors for incorporating arachidonic acid into membrane phospholipids in P388D1 macrophage-like cells (24, 25), the ability to achieve phospholipid labeling with [³H]AA in iPLA₂-null macrophages was examined first.

Wild-type and iPLA₂-null mouse peritoneal macrophages incorporated [³H]AA acid into glycerophosphocholine (GPC) lipids at essentially identical rates (Fig. 6A), suggesting that iPLA₂ is not required for this process in these cells. Stimulating the cells with zymosan (an insoluble yeast cell wall carbohydrate) induced a robust release of [³H]AA of similar magnitude from both wild-type and iPLA₂-null macrophages (Fig. 6B). This is consistent with the fact that zymosan strongly stimulates arachidonic acid release from mouse peritoneal macrophages (61) catalyzed by the group IVA cPLA₂ (62). That the response to zymosan is preserved in iPLA₂-null macrophages indicates they retain the ability to activate some phospholipases in response to some stimuli and do not have a general defect in phospholipid hydrolysis.

View larger version (29K): [in this window] [in a new window]   FIGURE 3. Analyses of internucleosomal DNA cleavages and expression of the transcription factor CHOP in peritoneal macrophages from wild-type or iPLA2-null mice incubated under control conditions, loaded with free cholesterol, or incubated with thapsigargin and fucoidan. Wild-type (WT) or iPLA2-knock-out (KO) macrophages were incubated under control conditions (CON) or subjected to FCL. A depicts DNA laddering analyses. Lane M has molecular weight markers. Lanes 1 and 3 represent DNA from untreated control macrophages from WT and KO mice, respectively, and lanes 2 and 4 represent DNA from FCL macrophages from WT and KO mice, respectively. B, immunoblotting for CHOP (upper panel) was performed with lysates from WT and KO macrophages incubated without (CON) or with (FCL) Ac-LDL and ACAT inhibitor 58035. In the lower parts of B and C, immunoblotting with an actin antibody was performed. C, immunoblotting for CHOP was performed with lysates from wild-type (W) or iPLA2-knock-out (K) macrophages incubated without (1st two lanes from left) or with thapsigargin and fucoidan for 4 (3rd and 4th lanes), 8(5th and 6th lanes), 16 (7th and 8th lanes), or 24 h (9th and 10th lanes).

View larger version (100K): [in this window] [in a new window]   FIGURE 4. Fluorescence microscopic images of apoptosis induced by incubating peritoneal macrophages from wild-type and iPLA2-null mice with thapsigargin and fucoidan. The leftmost column (1st) represents control, untreated peritoneal macrophages from wild-type (WT) or iPLA2-knock-out (KO) mice, and the other columns represent macrophages incubated (24 h) with thapsigargin alone (Thap), fucoidan alone (Fuc), or both (Thap + Fuc). In the fluorescence micrographs in the 1st (topmost) and 3rd rows, externalization of phosphatidylserine was visualized with Alexa-488-labeled annexin V. Light micrographs in the 2nd and 4rth rows display total cells.

That cytochrome c release into wild-type macrophage cytosol induced by incubation with thapsigargin and fucoidan is blunted in iPLA₂-null macrophages suggests that an interaction between iPLA₂ and mitochondria might occur during the apoptotic response. Fig. 8 illustrates experiments examining the distribution of iPLA₂ in mitochondrial and cytosolic fractions of disrupted cells using antibodies to iPLA₂ and to the mitochondrial marker protein cytochrome c oxidase-complex IV. Immunoreactive iPLA₂ signal associated with isolated mitochondria relative to that for cytochrome c oxidase-complex IV is significantly greater for macrophages loaded with free cholesterol compared with control cells.

View larger version (18K): [in this window] [in a new window]   FIGURE 5. Apoptosis induced by incubating wild-type and iPLA2-null mouse peritoneal macrophages with thapsigargin and fucoidan and effects of restoring iPLA2 expression to iPLA2-null macrophages with a recombinant adenovirus. A, wild-type (WT) and iPLA2-knock-out (KO) macrophages were incubated without (Control) or with thapsigargin (thap) alone, fucoidan (Fuc) alone, or both (thap + Fuc), and percent apoptotic cells was determined as in Fig. 2. B, WT or KO macrophages were incubated (24 h) without stimuli (lightly cross-hatched bars) or were subjected to FCL (solid black bars) with Ac-LDL and ACAT inhibitor 58035, and percent apoptotic cells was determined. Checkered bar represents experiments in which iPLA2 expression was restored recombinant adenovirus encoding iPLA2 (PLA2). Other cells were infected with control (C) virus without iPLA2 coding sequence. Immunoblots for iPLA2 and tubulin (C) illustrate iPLA2 expression in macrophages infected with virus (V) versus control (C), wild-type (W), or iPLA2-knock-out (K) cells. Mean values ± S.E. are displayed (n = 6). Asterisk denotes p < 0.05 for WT versus KO.

We therefore examined the composition of GPC lipids from wild-type and iPLA₂-null peritoneal macrophages as Li⁺ adducts by ESI/MS (Fig. 9) and by ESI/MS/MS (Fig. 10). Ions representing arachidonate (20:4)-containing GPC lipids are prominent in the spectra in Fig. 9 and include those at m/z 788 (16:0/20:4-GPC) and m/z 816 (18:0/20:4-GPC). The identities of the parent [M + Li]⁺ ions were established from their tandem spectra (Fig. 10). Because arachidonate-containing GPC-Li⁺ species tend to eliminate phosphocholine (183 Da) more readily than do GPC lipid species that contain more saturated fatty acids (67), ESI/MS/MS scanning for constant neutral loss of 183 Da accentuates the prominence of the arachidonate-containing species represented by the ions at m/z 788 and 816 (Fig. 9, C and D).

CAD of m/z 788 yields a spectrum (Fig. 10A) that contains ions reflecting neutral losses of trimethylamine plus either the sn-1 substituent (M + Li⁺ - 315) or the sn-2 substituent (M + Li⁺ - 363) as free fatty acids at m/z 473 and m/z 425, respectively. The former is more abundant than the latter, which conforms to published rules established from reference spectra that palmitate and arachidonate are the sn-1 and sn-2 substituents, respectively (67–69). Analogous ions in Fig. 10B (m/z 473 and 453) from CAD of m/z 816 indicate that stearate and arachidonate are the sn-1 and sn-2 substituents, respectively.

Fig. 10A also shows neutral losses of the sn-1 substituent as a free fatty acid (M + Li⁺ - 256) or as a Li⁺ salt (M + Li⁺ - 262) at m/z 532 and m/z 526, respectively. Ions of the same m/z values are observed in Fig. 10B and represent [MLi⁺ - 284] and [MLi⁺ - 290], respectively. Neutral losses of the sn-2 substituent as a free fatty acid (MLi⁺ - 304) or as a Li⁺ salt (MLi⁺ - 310) are seen at m/z 484 and m/z 478, respectively, in Fig. 10C, and at m/z 512 and m/z 506, respectively, in Fig. 10B. The ion m/z 313 (MLi⁺ - 475) in Fig. 10A reflects net elimination of [LiPO₄(CH₂)₂N(CH₃)₃] and loss of the sn-2 substituent as a ketene (80–82). An analogous m/z 341 ion (MLi⁺ - 475) is seen in the tandem spectrum 18:0/20:4-GPC-Li⁺ (Fig. 10B). Other diagnostic ions in Fig. 10A include those for loss of trimethylamine (m/z 729) or net loss of phosphocholine or its Li⁺ salt from [M + Li]⁺ at m/z 605 and 599, respectively. Analogous ions in Fig. 10B are observed at m/z 757, m/z 633, and m/z 627, respectively.

The two most abundant ions in the mass spectra of GPC lipids from peritoneal macrophages of wild-type or iPLA₂-null mice occur at m/z 740 and m/z 766 (Fig. 9, A and B). The tandem spectra in Fig. 10, C and D, identify these two ions as the Li⁺ adducts of 16:/0/16:0-GPC and 16:0/18:1-GPC, respectively, as described in the rationalization of these spectra in the Supplemental Material. Identities of other GPC lipids represented by ions in Fig. 9, A and B, were similarly determined and include 16:0/16:1-GPC (m/z 738), 18:1/18:1-GPC (m/z 792), and 18:0/22:6-GPC (m/z 840). The tandem spectra of the ions at m/z 726, 752, and 772 indicates that they represent the Li⁺ adducts of the alkyl ether (plasmanylcholine) species 16:0e/16: 0-GPC, 16:0e/18:1-GPC, 16:0e/20:4-GPC, respectively.

Fig. 9B is the ESI/MS spectrum of GPC lipid Li⁺ adducts from iPLA₂-null peritoneal macrophages and is virtually identical to that for wild-type peritoneal macrophages (Fig. 9A). Ions representing the 20:4-containing GPC species at m/z 788 and 816 are no less abundant in the latter spectrum than in the former, and quantitative measurements with internal standards and normalization to lipid phosphorus levels also indicate that 16:0/20:4-GPC and 18:0/20:4-GPC are no less abundant in macrophages from iPLA₂-null mice than in macrophages from wild-type mice, as summarized in supplemental Table S1. This indicates that the absence of iPLA₂ does not result in a deficiency of arachidonate-containing GPC lipids in mouse peritoneal macrophages or in other changes in GPC lipid composition.

View larger version (33K): [in this window] [in a new window]   FIGURE 6. [3H8]Arachidonic acid incorporation into glycerophosphocholine lipids from peritoneal macrophages of wild-type and iPLA2-null mice, [3H]AA release from the cells induced by incubation with zymosan or by free cholesterol loading, and effects of restoring iPLA2 expression to iPLA2-null macrophages with recombinant adenovirus. Wild-type (WT) and iPLA2-knock-out (KO) macrophages were incubated with [3H8]arachidonic acid for various intervals and washed with BSA-containing buffer to remove unincorporated label. A, lipids were extracted after labeling, and their phosphorus content was measured. GPC lipids were then isolated by TLC, and their [3H]AA content was determined by liquid scintillation spectrometry. Values are expressed as dpm/nmol lipid phosphorus. B, [3H]AA-labeled macrophages were incubated (1 h) without (Control) or with zymosan. After incubation, medium [3H]AA content was determined and normalized to that initially incorporated. C, [3H]AA-labeled wild-type (squares) or iPLA2-null (triangles) macrophages were incubated without (control, open symbols) or with Ac-LDL and ACAT inhibitor 58035 to induce free cholesterol loading (closed symbols). After various incubation intervals, medium [3H]AA content was determined and normalized. D, [3H]AA-labeled wild-type (WT) or iPLA2-knock-out (KO) macrophages were incubated (24 h) without (-, gray bars) or with Ac-LDL and ACAT inhibitor 58035 (FCL, solid black bars). At the end of incubations, [3H]AA release was determined and normalized. The checkered bar depicts experiments in which iPLA2 expression was restored by recombinant adenovirus (PLA2). Other cells were infected with control (C) virus without iPLA2 coding sequence. Mean values ± S.E. are displayed (n = 6). Asterisk denotes p < 0.05 for WT versus KO, and double asterisk p < 0.01.

View larger version (36K): [in this window] [in a new window]   FIGURE 7. Cytochrome c release into cytosol of wild-type and iPLA2-null mouse macrophages incubated with thapsigargin and fucoidan. Wild-type (WT) or iPLA2-knock-out (KO) macrophages were incubated without or with thapsigargin and fucoidan (Thap + F) for various intervals. At the end of the incubations, cytosol was prepared, analyzed by SDS-PAGE, electrotransferred to nylon membranes, and probed with cytochrome c and tubulin antibodies, as illustrated in A. B represents densitometric ratios of iPLA2 and tubulin immunoblot signals determined with AlphaEaseFC software. Mean values ± S.E. are displayed (n = 4). Asterisk denotes p < 0.05 for WT versus KO.

View larger version (32K): [in this window] [in a new window]   FIGURE 8. Subcellular redistribution of iPLA2 in macrophages subjected to free cholesterol loading. Wild-type macrophages were incubated (24 h) without (Con) or with (loaded) Ac-LDL and ACAT inhibitor 58035. At the end of incubations, mitochondrial and cytosolic fractions were prepared and analyzed by SDS-PAGE. A shows immunoblots for iPLA2 and the mitochondrial marker cytochrome c oxidase-complex IV subunit II (COX IV). B shows densitometric ratios of iPLA2 immunoblot signal divided by that for cytochrome c oxidase-complex IV in mitochondrial fractions determined by AlphaEaseFC software. Mean values ± S.E. are displayed (n = 4). Asterisk denotes p < 0.05 (WT versus KO).

Composition of Sphingolipids and Anionic Phospholipids in Peritoneal Macrophages from Wild-type and iPLA₂-Null Mice—Accumulation of sphingomyelin and PC are reciprocally regulated by sphingomyelin synthase, which converts PC and ceramide to sphingomyelin and diacylglycerol (86–89). It is thus possible that a cell in which PC metabolism was perturbed might compensate by altering sphingolipid metabolism to preserve an optimal PC content and composition. Sphingomyelin avidly binds cholesterol (90), and the sphingomyelin content of mouse peritoneal macrophages affects their ability to survive cholesterol loading (91). We therefore compared sphingolipid content and composition of wild-type and iPLA₂-null macrophages and observed no major differences between the two genotypes, as illustrated in supplemental Fig. S1 and Table S2.

Arachidonic acid or other polyunsaturated fatty acids initially incorporated into PC can be transferred subsequently to other phospholipid classes in part via a CoA-independent transacylase (60, 92). It is thus possible that a cell in which PC metabolism was perturbed might compensate by altering metabolism of other phospholipid head group classes to preserve an optimal PC content and composition. We therefore compared the content and composition of glycerophosphoethanolamine, glycerophosphoglycerol, glycerophosphoserine, and glycerophosphoinositol lipids in wild-type and iPLA₂-null macrophages and again observed no major differences between the two genotypes, as illustrated in supplemental Figs. S2 and S3 and Table S1.

Mitochondrial Phospholipid Composition of Wild-type and iPLA₂-null Mouse Macrophages—Although the global phospholipid compositions of wild-type and iPLA₂-null mouse macrophages are virtually identical, differences in their mitochondrial membrane composition might confer differential susceptibility to apoptosis, but positive ion ESI/MS analyses of Li⁺ adducts indicate that the GPC lipid and sphingomyelin composition of isolated mitochondria from wild-type and iPLA₂-null macrophages are virtually identical (supplemental Fig. S5 and Table S3).

View larger version (36K): [in this window] [in a new window]   FIGURE 9. Electrospray ionization mass spectrometric analyses of glycerophosphocholine lipids from peritoneal macrophages of wild-type and iPLA2-null mice. Phospholipids from wild-type (A and C) or iPLA2-null (B and D) macrophages were analyzed as Li+ adducts by positive ion ESI/MS, and relative abundances of ion currents plotted versus m/z value. A and B represent total ion current, and C and D represent ESI/MS/MS scans for constant neutral loss of 183.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Fig. 13 is a model for participation of iPLA₂ in free cholesterol loading-induced apoptosis of mouse peritoneal macrophages that incorporates findings reported here into a scheme developed by Tabas and co-workers (52, 53). Free cholesterol loading induced by incubating macrophages with Ac-LDL and ACAT inhibitor 58035 activates multiple signaling pathways (52), all of which are necessary and none of which is sufficient alone to cause apoptosis. One pathway is ER stress that results from free cholesterol accumulation in ER membranes, which increases membrane order and results in SERCA inhibition and ER Ca²⁺ store depletion (51).

Several other events are also required to induce apoptosis, probably because the main goal of ER stress is to activate cell repair mechanisms, and death occurs only when damaging insults are multiple and overwhelming. With ER-stressed macrophages, other events required for apoptosis include CHOP induction (50), TLR4-MyD88 activation, proapoptotic JNK induction (52), engagement of SRA and the pattern recognition receptor TLR4, silencing of the TLR4-TRIF-IRF3-IFN cell-survival pathway (77), and ER stress-induced rises in cytosolic [Ca²⁺] (50, 52, 53).

Our findings suggest that another consequence of ER stress is activation of iPLA₂ and its association with mitochondria. This may facilitate cytochrome c release, which along with the permeability transition (81) does occur when mouse macrophages are loaded with cholesterol (82). Cytochrome c released into cytosol activates the caspase cascade and execution of apoptosis (93–95). This sequence of events could rationalize several previous observations by us (45, 46, 66) and others (39, 44, 78–81, 96–99).

Our findings here indicate that iPLA₂-null mouse macrophages are more resistant than wild-type cells to apoptosis induced either by free cholesterol loading or by combined SERCA inhibition with thapsigargin and SRA engagement with fucoidan, as visualized by phosphatidylserine externalization, caspase-3 activation, and DNA laddering. Free cholesterol loading of wild-type macrophages also induces arachidonic acid hydrolysis from membrane phospholipids, which is consistent with PLA₂ activation, and this is attenuated with iPLA₂-null macrophages.

View larger version (22K): [in this window] [in a new window]   FIGURE 10. Tandem mass spectra of glycerophosphocholine lipids from mouse peritoneal macrophages. GPC lipid-Li+ adducts from wild-type or iPLA2-null macrophage lipid extracts were analyzed by positive ion ESI/MS/MS. Specific ions selected in the first mass-analyzing quadrupole were accelerated into the collision cell to induce CAD. Product ions were analyzed in the final quadrupole. Ions selected in the first quadrupole included m/z 788 (A), 816 (B), 740 (C), and 766 (D).

The SERCA inhibitor thapsigargin induces ER Ca²⁺ loss and apoptosis in many cells by ER stress pathways. In pancreatic islet -cells, thapsigargin induces apoptosis in a manner that does not require a rise in cytosolic [Ca²⁺] but does require arachidonic acid hydrolysis from phospholipids and its metabolism (44). Thapsigargin-induced arachidonic acid hydrolysis from islet phospholipids occurs by a Ca²⁺-independent mechanism that is suppressed by pharmacologic inhibition of iPLA₂ (45). Overexpressing iPLA₂ amplifies thapsigargin-induced apoptosis of INS-1 insulinoma cells, and this is also suppressed by iPLA₂ inhibition (46). The magnitude of thapsigargin-induced INS-1 cell apoptosis correlates with iPLA₂ expression level in various INS-1 cell lines, and apoptosis is associated with iPLA₂ stimulation and subcellular redistribution (46). Pharmacologic and biochemical evidence indicates that ER Ca²⁺ store depletion also results in iPLA₂ activation in vascular smooth muscle cells (30, 34, 97).

Accumulating evidence suggests that a mechanism for iPLA₂ to participate in apoptosis involves its association with mitochondria and facilitation of cytochrome c release (78–81, 96). Isolated mitochondria from cardiomyocytes, brain, and rat liver all contain immunoreactive, catalytically competent iPLA₂ (78–81). Ischemia reperfusion-induced cardiac myocyte death is associated with iPLA₂ subcellular redistribution, mitochondrial phospholipid hydrolysis, and mitochondrial dysfunction (81), and iPLA₂ inhibition reduces mitochondrial phospholipid loss and cell death (81, 100).

Association of BAX and truncated BID with brain mitochondria also induces cytochrome c release that is associated with mitochondrial iPLA₂ activation and attenuated by iPLA₂ inhibition (80). Rat liver mitochondria release cytochrome c and undergo permeability transition in response to Ca²⁺ loading and depolarization, and this is also associated with iPLA₂ activation and reduced by iPLA₂ inhibition (79, 81). All of these findings are consistent with our observations that cytochrome c release into cytosol in response to apoptogenic stimuli is reduced in iPLA₂-null macrophages compared with wild-type cells, that immunoblotting studies indicate that iPLA₂ associates with mitochondria in macrophages subjected to ER stress, and that the ER stress-induced mitochondrial phospholipid loss observed with wild-type macrophages is blunted or absent with iPLA₂-null macrophages.

View larger version (32K): [in this window] [in a new window]   FIGURE 11. Electrospray ionization mass spectrometric analyses of glycerophosphocholine lipid species in wild-type and iPLA2-null mouse peritoneal macrophages incubated with supplemental arachidonic acid for various intervals. Wild-type (WT) (A–C) or iPLA2-null (D) macrophages were incubated with arachidonic acid for 0 h (A), 2 h (B), or 6 h (B and D). Lipids were then extracted, and GPC lipids were analyzed by positive ion ESI/MS/MS as Li+ adducts for constant neutral loss of 183.

View larger version (15K): [in this window] [in a new window]   FIGURE 12. Electrospray ionization mass spectrometric analyses of glycerophosphocholine lipids in wild-type mouse peritoneal macrophages incubated under control conditions or subjected to ER stress with thapsigargin. Macrophages were incubated (24 h) without (A) or with (B) thapsigargin (0.5 µM), and their mitochondria were then isolated. Mitochondrial lipids were extracted, mixed with 14:0/14:0-GPC internal standard, and analyzed by positive ion ESI/MS/MS as Li+ adducts for constant neutral loss of 189.

View larger version (20K): [in this window] [in a new window]   FIGURE 13. Model for involvement of iPLA2 in apoptosis in macrophages induced by free cholesterol loading. The model of Tabas and co-workers (52, 53) is revised to incorporate data in this report. Free cholesterol accumulates in macrophage ER membranes, alters their physical properties, inhibits SERCA, and causes ER Ca2+ loss. This activates UPR-CHOP pathway and causes a rise in cytosolic [Ca2+], which amplifies the TLR4-MyD88-JNK pathway. It also activates iPLA2, which associates with mitochondria to facilitate cytochrome c release. In coordination with signals from SRA and TL4 receptor engagement, the combinatorial convergence of multiple events induces apoptosis (53).

Our ESI/MS findings that the PC content and composition of macrophages from iPLA₂-null and wild-type mice are virtually identical are consistent with the lack of effects of pharmacologic inhibition of iPLA₂ activity (60, 102) or of molecular biologic manipulation of iPLA₂ expression (70, 84) on these parameters in insulinoma cells and islets. Neither stable overexpression (84) nor suppression (70) of iPLA₂ expression in insulinoma cells affects their PC content or composition or rates of arachidonic acid incorporation into PC. Moreover, we observe no differences between wild-type and iPLA₂-null macrophages in the content or composition of sphingolipids or of anionic glycerophospholipids with -ethanolamine, -serine, -inositol, or -glycerol head groups.

Although we find no evidence that iPLA₂ plays housekeeping roles in PC homeostasis (26, 27) and remodeling (24, 25) in mouse peritoneal macrophages, iPLA₂ is widely expressed and might have multiple functions that vary among tissues and cell types. The function of iPLA₂ in a given setting might depend in part on which splice variants (40, 41) and proteolytic processing products (29, 102, 103) of iPLA₂ are expressed in a given cell and on what interacting proteins (98) are present in the cell compartment (84, 101) in which the iPLA₂ isoform resides.

It should be noted that evidence for iPLA₂ participation in arachidonate incorporation into membrane phospholipids is based primarily on studies with P388D1 mouse macrophage-like tumor cells (24, 25) or with other transformed cells of monocyte/macrophage lineage (32). The fact that iPLA₂ does not appear to participate in this process in native mouse macrophages raises the possibility that any such role for iPLA₂ might be confined to transformed, cultured cells.

The findings reported here thus contribute to a growing body of evidence that iPLA₂ plays a role in ER stress-induced apoptosis and indicate that homozygous iPLA₂ gene disruption produces phenotypic abnormalities in several tissues and cells that include mouse peritoneal macrophages in addition to testes (54) and pancreatic islets (57).

	FOOTNOTES

 
^* This work was supported by United States Public Health Service Grants R37-DK34388, P01-HL57278, P41-RR00954, P60-DK20579, RO1–69455, and P30-DK56341. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The on-line version of this article (available at http://www.jbc.org) contains supplemental Materials, Experimental Procedures, Results, Figs. 1–5, Tables 1–4, and additional references.

¹ To whom correspondence should be addressed: Washington University School of Medicine, Box 8127, 660 S. Euclid Ave., St. Louis, MO 63110. Tel.: 314-362-8190; Fax: 314-362-7641; E-mail: jturk{at}wustl.edu.

² The abbreviations used are: PLA₂, phospholipase A₂; BEL, bromoenol lactone suicide substrate; CAD, collisionally activated dissociation; ESI, electrospray ionization; GPC, glycerophosphocholine; iPLA₂, group VIA phospholipase A₂; LPC, lysophosphatidylcholine; MS, mass spectrometry; MS/MS, tandem MS; PAF, platelet-activating factor; PC, phosphatidylcholine; RT, reverse transcriptase; WT, wild type; ER, endoplasmic reticulum; SERCA, sarcoplasmic reticulum Ca²⁺-ATPase; PBS, phosphate-buffered saline; BSA, bovine serum albumin; AA, arachidonic acid; Ac-LDL, acetyl-low density lipoprotein; ACAT, acyl-CoA:cholesterol O-acyltransferase; JNK, c-Jun NH₂-terminal kinase; SRA, scavenger receptor A; sPLA₂, secretory PLA₂; cPLA₂, cytosolic PLA₂; KO, knock out.

	ACKNOWLEDGMENTS

 
We thank Sheng Zhang and Min Tan for their excellent technical assistance and Dr. Richard Gross for supplying iPLA₂ antibody 509.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Six, D. A., and Dennis, E. A. (2000) Biochim. Biophys. Acta 1488, 1-19[Medline] [Order article via Infotrieve]
2. Ma, Z., and Turk, J. (2001) Prog. Nucleic Acids Res. Mol. Biol. 67, 1-33[Medline] [Order article via Infotrieve]
3. Brash, A. R. (2001) J. Clin. Investig. 107, 1339-1345[Medline] [Order article via Infotrieve]
4. Radu, C. G., Yang, L. V., Riedinger, M., Au, M., and Witte, O. N. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 245-250[Abstract/Free Full Text]
5. Murphy, R. C., and Sala, A. (1990) Methods Enzymol. 187, 90-98[Medline] [Order article via Infotrieve]
6. Gijon, M. A., Spencer, D. M., Kaiser, A. L., and Leslie, C. C. (1999) J. Cell Biol. 145, 1219-1232[Abstract/Free Full Text]
7. Underwood, K. W., Song, C., Kriz, R. W., Chang, X. J., Knopf, J. L., and Lin, L.-L. (1998) J. Biol. Chem. 273, 21926-21932[Abstract/Free Full Text]
8. Pickard, R. T., Strifler, B. A., Kramer, R. M., and Sharp, J. D. (1999) J. Biol. Chem. 274, 8823-8831[Abstract/Free Full Text]
9. Song, C., Chang, X. J., Bean, K. M., Proia, M. S., Knopf, J. L., and Kriz, R. W. (1999) J. Biol. Chem. 274, 17063-17067[Abstract/Free Full Text]
10. Ohto, T., Uozumi, N., Hirabayashi, T., and Shimizu, T. (2005) J. Biol. Chem. 280, 24576-24583[Abstract/Free Full Text]
11. Tang, J., Kriz, R. W., Wolfman, N., Shaffer, M., Seehra, J., and Jones, S. S. (1997) J. Biol. Chem. 272, 8567-8575[Abstract/Free Full Text]
12. Balboa, M. A., Balsinde, J., Jones, S. S., and Dennis, E. A. (1997) J. Biol. Chem. 272, 8576-8580[Abstract/Free Full Text]
13. Ma, Z., Ramanadham, S., Kempe, K., Chi, X. S., Ladenson, J., and Turk, J. (1997) J. Biol. Chem. 272, 11118-11127[Abstract/Free Full Text]
14. Hazen, S. L., Zupan, L. A., Weiss, R. H., Getman, D. P., and Gross, R. W. (1991) J. Biol. Chem. 266, 7227-7232[Abstract/Free Full Text]
15. Balsinde, J., and Dennis, E. A. (1997) J. Biol. Chem. 272, 16069-16072[Free Full Text]
16. Ma, Z., Ramanadham, S., Hu, Z., and Turk, J. (1998) Biochim. Biophys. Acta 1391, 384-400[Medline] [Order article via Infotrieve]
17. Balsinde, J., and Dennis, E. A. (1996) J. Biol. Chem. 271, 6758-6765[Abstract/Free Full Text]
18. Mancuso, D. J., Jenkins, C. M., and Gross, R. W. (2000) J. Biol. Chem. 275, 9937-9945[Abstract/Free Full Text]
19. Tanaka, H., Takeya, R., and Sumimoto, H. (2000) Biochem. Biophys. Res. Commun. 272, 320-326[CrossRef][Medline] [Order article via Infotrieve]
20. van Tienhoven, M., Atkins, J., Li, Y., and Glynn, P. (2002) J. Biol. Chem. 277, 20942-20948[Abstract/Free Full Text]
21. Jenkins, C. M., Mancuso, D. J., Yan, W., Sims, H. F., Gibson, B., and Gross, R. W. (2004) J. Biol. Chem. 279, 48968-48975[Abstract/Free Full Text]
22. Balsinde, J. (2002) Biochem. J. 364, 695-702[CrossRef][Medline] [Order article via Infotrieve]
23. Balsinde, J., and Balboa, M. A. (2005) Cell. Signal. 17, 1052-1062[CrossRef][Medline] [Order article via Infotrieve]
24. Balsinde, J., Bianco, I. D., Ackermann, E. J., Conde-Frieboes, K., and Dennis, E. A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 8527-8531[Abstract/Free Full Text]
25. Balsinde, J., Balboa, M. A., and Dennis, E. A. (1997) J. Biol. Chem. 272, 29317-29321[Abstract/Free Full Text]
26. Baburina, I., and Jackowski, S. (1999) J. Biol. Chem. 274, 9400-9408[Abstract/Free Full Text]

27. Barbour, S. E., Kapur, A., and Deal, C. L. (1999) Biochim. Biophys. Acta 1439, 77-88[Medline] [Order article via Infotrieve]
28. Akiba, S., Mizunaga, S., Kume, K., Hayama, M., and Sato, T. (1999) J. Biol. Chem. 274, 19906-19912[Abstract/Free Full Text]
29. Atsumi, G., Murakami, M., Kojima, K., Hadano, A., Tajima, M., and Kudo, I. (2000) J. Biol. Chem. 275, 18248-18258[Abstract/Free Full Text]
30. Jenkins, C. M., Han, X., Mancuso, D. J., and Gross, R. W. (2002) J. Biol. Chem. 277, 32807-32814[Abstract/Free Full Text]
31. Seegers, H. C., Gross, R. W., and Boyle, W. A. (2002) J. Pharmacol. Exp. Ther. 302, 918-923[Abstract/Free Full Text]
32. Perez, R., Melero, R., Balboa, M. A., and Balsinde, J. (2004) J. Biol. Chem. 279, 40385-40391[Abstract/Free Full Text]
33. Yellaturu, C. R., and Rao, G. N. (2003) J. Biol. Chem. 278, 43831-43837[Abstract/Free Full Text]
34. Smani, T., Zakharov, S. I., Csutora, P., Leno, E., Trepakova, E. S., and Bolotina, V. M. (2004) Nat. Cell Biol. 6, 113-120[CrossRef][Medline] [Order article via Infotrieve]
35. Martinson, B. D., Albert, C. J., Corbett, J. A., Wysolmerski, R. B., and Ford, D. A. (2003) J. Lipid Res. 44, 1686-1691[Abstract/Free Full Text]
36. Moran, J. M., Buller, R. M., McHowat, J., Turk, J., Wohltmann, M., Gross, R. W., and Corbett, J. A. (2005) J. Biol. Chem. 280, 28162-28168[Abstract/Free Full Text]
37. Guo, Z., Su, W., Ma, Z., Smith, G. M., and Gong, M. C. (2003) J. Biol. Chem. 278, 1856-1863[Abstract/Free Full Text]
38. Balboa, M. A., Saez, Y., and Balsinde, J. (2003) J. Immunol. 170, 5276-5280[Abstract/Free Full Text]
39. Song, K., Zhang, X., Zhao, C., Ang, N. T., and Ma, Z. A. (2005) Mol. Endocrinol. 19, 504-515[Abstract/Free Full Text]
40. Larsson Forsell, P. K., Kennedy, B. P., and Claesson, H. E. (1999) Eur. J. Biochem. 262, 575-585[Medline] [Order article via Infotrieve]
41. Ma, Z., Wang, X., Nowatzke, W., Ramanadham, S., and Turk, J. (1999) J. Biol. Chem. 274, 9607-9616[Abstract/Free Full Text]
42. Atsumi, G., Tajima, M., Hadano, A., Nakatani, Y., Murakami, M., and Kudo, I. (1998) J. Biol. Chem. 273, 13870-13877[Abstract/Free Full Text]
43. Thastrup, O., Cullen, P. J., Drobak, B. K., Hanley, M. R., and Dawson, A. P. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 2466-2470[Abstract/Free Full Text]
44. Zhou, Y.-P., Teng, D., Dralyuk, F., Ostrega, D., Roe, M. W., Philipson, L., and Polonsky, K. (1998) J. Clin. Investig. 101, 1623-1632[Medline] [Order article via Infotrieve]
45. Nowatzke, W., Ramanadham, S., Ma, Z., Hsu, F.-F., Bohrer, A., and Turk, J. (1998) Endocrinology 139, 4073-4085[Abstract/Free Full Text]
46. Ramanadham, S., Hsu, F. F., Zhang, S., Jin, C., Bohrer, A., Ma, Z., and Turk, J. (2004) Biochemistry 43, 918-930[Medline] [Order article via Infotrieve]
47. Ross, R. (1995) Annu. Rev. Physiol. 57, 791-804[CrossRef][Medline] [Order article via Infotrieve]
48. Ball, R. Y., Stowers, E. D., Burton, J. H., Cary, N. R., Skepper, J. N., and Mitchinson, M. J. (1995) Atherosclerosis 114, 45-54[CrossRef][Medline] [Order article via Infotrieve]
49. Yao, P. M., and Tabas, I. (2000) J. Biol. Chem. 275, 23807-23813[Abstract/Free Full Text]
50. Feng, B., Yao, P. M., Li, Y., Devlin, C. M., Zhang, D., Harding, H. P., Sweeney, M., Rong, J. X., Kuriakose, G., Fisher, E. A., Marks, A. R., Rong, D., and Tabas, I. (2003) Nat. Cell Biol. 5, 781-792[CrossRef][Medline] [Order article via Infotrieve]
51. Li, Y., Ge, M., Ciani, L., Kuriakose, G., Westover, E. J., Dura, M., Covey, D. F., Freed, J. H., Mayfield, F. R., Lytton, J., and Tabas, I. (2004) J. Biol. Chem. 279, 37030-37039[Abstract/Free Full Text]
52. De Vries-Seimon, T., Li, Y., Yao, P. M., Stone, E., Wang, Y., Davis, R. J., Flavell, R., and Tabas, I. (2005) J. Cell Biol. 171, 61-73[Abstract/Free Full Text]
53. Seimon, T. A., Obstfeld, A., Moore, K. J., Golenbock, D. T., and Tabas, I. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 19794-19799[Abstract/Free Full Text]
54. Bao, S., Miller, D. J., Ma, Z., Wohltmann, M., Eng, G., Ramanadham, S., Moley, K., and Turk, J. (2004) J. Biol. Chem. 279, 38194-38200[Abstract/Free Full Text]
55. Ross, A. C., Go, K. J., Heider, J. G., and Rothblat, G. H. (2004) J. Biol. Chem. 259, 815-819
56. Basu, S. K., Goldstein, J. L., Anderson, R. G. W., and Brown, M. S. (1976) Proc. Natl. Acad. Sci. U. S. A. 73, 3178-3182[Abstract/Free Full Text]
57. Bao, S., Song, H., Wohltmann, M., Bohrer, A., and Turk, J. (2006) J. Biol. Chem. 281, 20958-20973[Abstract/Free Full Text]
58. Harding, H. P., Novoa, I., Zhang, Y., Zeng, H., Wek, R., Schapira, M., and Ron, D. (2000) Mol. Cell 6, 1099-1108[CrossRef][Medline] [Order article via Infotrieve]
59. Calfon, M., Zeng, H., Urano, F., Till, J. H., Hubbard, S. R., Harding, H. P., Clark, S. G., and Ron, D. (2002) Nature 415, 92-96[CrossRef][Medline] [Order article via Infotrieve]
60. Ramanadham, S., Hsu, F.-F., Bohrer, A., Ma, Z., and Turk, J. (1999) J. Biol. Chem. 274, 13915-13927[Abstract/Free Full Text]
61. Qiu, Z. H., de Carvalho, M. S., and Leslie, C. C. (1993) J. Biol. Chem. 32, 24506-24513
62. Gijon, M. A., Spener, D. M., Siddiqi, A. R., Bonventre, J. V., and Leslie, C. C. (2000) J. Biol. Chem. 275, 20146-20156[Abstract/Free Full Text]
63. Krippner, A., Matsuno-Yagi, A., Gottlieb, R. A., and Babior, B. M. (1996) J. Biol. Chem. 271, 21629-21636[Abstract/Free Full Text]
64. Sayan, B. S., Sayan, A. E., Knight, R. A., Melino, G., and Cohen, G. M. (2006) J. Biol. Chem. 281, 13566-13573[Abstract/Free Full Text]
65. Barrett, L. E., Van Vockstaele, E. J., Sul, J. Y., Takano, H., Haydan, P. G., and Eberwine, J. H. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 5155-5160[Abstract/Free Full Text]
66. Hallberg, A. (1984) Biochim. Biophys. Acta 796, 328-335[Medline] [Order article via Infotrieve]
67. Hsu, F. F., Bohrer, A., and Turk, J. (1998) J. Am. Soc. Mass. Spectrom. 9, 516-526[CrossRef][Medline] [Order article via Infotrieve]
68. Hsu, F. F., Turk, J., Thukkani, A. K., Messner, M. C., Wildsmith, K. R., and Ford, D. A. (2003) J. Mass Spectrom. 38, 752-763[CrossRef][Medline] [Order article via Infotrieve]
69. Hsu, F. F., and Turk, J. (2003) J. Am. Soc. Mass Spectrom. 14, 352-363[CrossRef][Medline] [Order article via Infotrieve]
70. Bao, S., Bohrer, A., Ramanadham, S., Jin, W., Zhang, S., and Turk, J. (2006) J. Biol. Chem. 281, 187-198[Abstract/Free Full Text]
71. Ramanadham, S., Hsu, F.-F., Zhang, S., Bohrer, A., Ma, Z., and Turk, J. (2000) Biochim. Biophys. Acta 1484, 251-266[Medline] [Order article via Infotrieve]
72. Yang, H. C., Mosior, M., Ni, B., and Dennis, E. A. (1999) J. Neurochem. 73, 1278-1287[CrossRef][Medline] [Order article via Infotrieve]
73. Zinszner, H., Kuroda, M., Wang, Z., Batchvarova, N., Lightfoot, R., Remotti, H., Stevens, J. L., and Ron, D. (1998) Genes Dev. 12, 982-995[Abstract/Free Full Text]
74. Hyoda, K., Hosoi, T., Horie, N., Okuma, Y., Ozawa, K., and Nomura, Y. (2006) Biochem. Biophys. Res. Commun. 340, 286-290[Medline] [Order article via Infotrieve]
75. Li, J., Lee, B., and Lee, A. S. (2006) J. Biol. Chem. 281, 7260-7270[Abstract/Free Full Text]
76. Hsu, F.-F., Ma, Z., Wohltmann, M., Bohrer, M., Nowatzke, W., Ramanadham, S., and Turk, J. (2000) J. Biol. Chem. 275, 16579-16589[Abstract/Free Full Text]
77. Han, X., Yang, K., Yang, J., Fikes, K. N., Cheng, H., and Gross, R. W. (2005) J. Am. Soc. Mass Spectrom. 17, 264-274[CrossRef]
78. Williams, S. D., and Gottlieb, R. A. (2002) Biochem. J. 362, 23-32[CrossRef][Medline] [Order article via Infotrieve]
79. Broekemeier, K. M., Iben, J. R., LeVan, E. G., Crouser, E. D., and Pfeiffer, D. R. (2002) Biochemistry 41, 7771-7780[CrossRef][Medline] [Order article via Infotrieve]
80. Brustovetsky, T., Antonsson, B., Jemmerson, R., Dybinsky, J. M., and Brustovetsky, N. (2005) J. Neurochem. 94, 980-984[CrossRef][Medline] [Order article via Infotrieve]
81. Gadd, M. E., Broekemeier, K. M., Crouser, E. D., Kumar, J., Graff, G., and Pfeiffer, D. R. (2006) J. Biol. Chem. 282, 6931-6939
82. Yao, P. M., and Tabas, I. (2001) J. Biol. Chem. 45, 42468-44247
83. Zhang, D., Tang, W., Yao, P. M., Yang, C., Xie, B., Jackowski, S., and Tabas, I. (2000) J. Biol. Chem. 275, 35368-35376[Abstract/Free Full Text]
84. Ma, Z., Ramanadham, S., Wohltmann, M., Bohrer, A., Hsu, F. F., and Turk, J. (2001) J. Biol. Chem. 276, 13198-13208[Abstract/Free Full Text]
85. Kuwae, T., Schmid, P. C., and Schmid, H. H. O. (1997) Biochim. Biophys. Acta 1344, 74-86[Medline] [Order article via Infotrieve]
86. Luberto, C., and Hannun, Y. A. (1998) J. Biol. Chem. 272, 14550-14559
87. Vivekananda, J., Smith, D., and King, R. J. (2001) Am. J. Physiol. 281, L98-L107
88. Yamaoka, S., Miyaji, M., Kitano, T., Umehara, H., and Okasaki, T. (2004) J. Biol. Chem. 279, 18688-18693[Abstract/Free Full Text]
89. Miyaji, M., Jin, Z.-X., Yamaoka, S., Amakawa, R., Fukuhara, S., Sato, S. B., Kobayashi, T., Domae, N., Mimori, T., Bloom, E. T., Oakzaki, T., and Umehara, H. (2005) J. Exp. Med. 202, 249-259[Abstract/Free Full Text]
90. Slotte, J. P. (1999) Chem. Phys. Lipids 102, 13-17[CrossRef][Medline] [Order article via Infotrieve]
91. Leventhal, A., Chen, W., Tall, A. R., and Tabas, I. (2001) J. Biol. Chem. 276, 44976-44983[Abstract/Free Full Text]
92. Surette, M. E., Winkler, J. D., Fonteh, A. N., and Chilton, F. H. (1996) Biochemistry 35, 9187-9196[CrossRef][Medline] [Order article via Infotrieve]
93. Tewari, M., Quan, L. T., O'Rourke, K., Desnoyers, S., Zeng, Z., Beidler, D. R., Poirier, G. G., Salvesen, G. S., and Dixit, V. M. (1995) Cell 81, 801-809[CrossRef][Medline] [Order article via Infotrieve]
94. Ivana Scovassi, A., and Diederich, M. (2004) Biochem. Pharmacol. 68, 1041-1047[CrossRef][Medline] [Order article via Infotrieve]
95. Wang, Z. B., Liu, Y. Q., and Cui, Y. F. (2005) Cell Biol. Int. 29, 489-496[CrossRef][Medline] [Order article via Infotrieve]
96. Seleznev, K., Zhao, C., Zhang, X. H., Song, K., and Ma, Z. A. (2006) J. Biol. Chem. 281, 22275-22288[Abstract/Free Full Text]
97. Wolf, M. J., Wang, J., Turk, J., and Gross, R. W. (1997) J. Biol. Chem. 272, 1522-1526[Abstract/Free Full Text]
98. Wang, Z., Ramanadham, S., Ma, Z., Bao, S., Mancuso, D. J., Gross, R. W., and Turk, J. (2005) J. Biol. Chem. 280, 6840-6849[Abstract/Free Full Text]
99. Roe, M. W., Worley, J. F., Qian, F., Tamarina, N., Mittal, A. A., Dralyuk, F., Blair, N. T., Mertz, R. J., Philipson, L. H., and Dukes, I. D. (1998) J. Biol. Chem. 273, 10402-10410[Abstract/Free Full Text]
100. Williams, S. D., Hsu, F. F., and Ford, D. A. (2000) J. Lipid Res. 41, 1585-1595[Abstract/Free Full Text]
101. Scott, W. A., Zrike, J. M., Hamill, A. L., Kempe, J., and Cohn, Z. A. (1980) J. Exp. Med. 152, 324-335[Abstract/Free Full Text]
102. Ramanadham, S., Song, H., Hsu, F. F., Zhang, S., Crankshaw, M., Grant, G. A., Newgard, C. B., Bao, S., Ma, Z., and Turk, J. (2003) Biochemistry 42, 13929-13940[CrossRef][Medline] [Order article via Infotrieve]
103. Song, H., Hecimovic, S., Goate, A., Hsu, F. F., Bao, S., Vidavsky, I., Ramanadham, S., and Turk, J. (2004) J. Am. Soc. Mass Spectrom. 15, 1780-1793[CrossRef][Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				J. E. Burke and E. A. Dennis Phospholipase A2 structure/function, mechanism, and signaling J. Lipid Res., April 1, 2009; 50(Supplement): S237 - S242. [Abstract] [Full Text] [PDF]

				S. Bao, D. A. Jacobson, M. Wohltmann, A. Bohrer, W. Jin, L. H. Philipson, and J. Turk Glucose homeostasis, insulin secretion, and islet phospholipids in mice that overexpress iPLA2{beta} in pancreatic {beta}-cells and in iPLA2{beta}-null mice Am J Physiol Endocrinol Metab, February 1, 2008; 294(2): E217 - E229. [Abstract] [Full Text] [PDF]

				V. Poitout Phospholipid hydrolysis and insulin secretion: a step toward solving the Rubik's cube Am J Physiol Endocrinol Metab, February 1, 2008; 294(2): E214 - E216. [Full Text] [PDF]

This Article Abstract Full Text (PDF) Supplemental Data All Versions of this Article: 282/37/27100    most recent M701316200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bao, S. Articles by Turk, J. Search for Related Content PubMed PubMed Citation Articles by Bao, S. Articles by Turk, J. Social Bookmarking                      What's this?