JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M700691200 on July 13, 2007

J. Biol. Chem., Vol. 282, Issue 37, 27171-27180, September 14, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/37/27171    most recent
M700691200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bai, S.
Right arrow Articles by Ghoshal, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bai, S.
Right arrow Articles by Ghoshal, K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Treatment of PC12 Cells with Nerve Growth Factor Induces Proteasomal Degradation of T-cadherin That Requires Tyrosine Phosphorylation of Its Cadherin Domain*

Shoumei Bai{ddagger}1, Jharna Datta{ddagger}, Samson T. Jacob{ddagger}§2, and Kalpana Ghoshal{ddagger}

From the {ddagger}Department of Molecular and Cellular Biochemistry, College of Medicine, and the §Comprehensive Cancer Center, Ohio State University, Columbus, Ohio 43210

Received for publication, January 24, 2007 , and in revised form, June 14, 2007.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
T-cadherin (T-Cad), a unique member of the cadherin family of proteins, plays an important role in cell adhesion and cell signaling. Recently, we demonstrated that T-Cad is transcriptionally repressed by DNA methyltransferase 3b during nerve growth factor (NGF)-induced neuronal differentiation of PC12 cells. Here, we show that T-Cad expression is also regulated at the post-translational level by the proteasomal pathway in these cells, which is facilitated upon NGF treatment. Pulse-chase experiments demonstrated that NGF treatment significantly reduced the half-life of T-Cad. Degradation of T-Cad was blocked upon treatment of PC12 cells with the proteasomal inhibitor ZLLL or lactacystin. Ectopic expression of Cdh1 (CDC20 homolog 1), one of the substrate recognition components of anaphase promoting complex (E3 ligase), stimulated T-Cad degradation. Deletion of CD1, one of the five extracellular cadherin domains (CD), promoted degradation of T-Cad, especially in the presence of NGF. On the contrary, deletion of CD2 stabilized this protein maximally. Ubiquitination of different deletion mutants indicates that T-Cad harbors multiple ubiquitination signals. Furthermore, genistein, a protein-tyrosine kinase inhibitor, impeded T-Cad degradation in PC12 cells, implicating requirement of tyrosine phosphorylation in this process. Mutation at tyrosine 327 (Y327F) markedly increased the half-life of T-Cad, suggesting that phosphorylation of this tyrosine residue located within CD2 is critical for this process. These results show that T-cadherin is subject to dual regulation during NGF-induced differentiation of PC12 cells, namely transcriptional repression mediated by Dnmt3b and post-translational degradation through the proteasomal pathway. These data, together with the inhibitory role of T-Cad in neurite outgrowth of PC12 cells upon NGF treatment, underscore the significance of its stringent regulation during this differentiation process.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
T-cadherin (truncated cadherin, T-Cad)3 is a unique member of cadherin family linked to the membrane through a glycosylphosphatidylinositol anchor (1). Unlike most of the cadherin family of proteins, it lacks the cytoplasmic domain. The exact cellular function of this protein has not been completely elucidated. It is postulated that T-Cad may function as a signaling molecule, which is consistent with the relatively weak cell-cell adhesion mediated by T-Cad (1). In smooth muscle cells and human umbilical vein endothelial cells T-Cad can negatively regulate cell adhesion, increase cell motility (2), and co-segregate with signaling molecules such as G-protein and SRC family kinase, which implicates its role as an intracellular signaling molecule (3). T-Cad also functions as a negative regulator of axon growth, as evident from T-Cad-mediated inhibition of neurite outgrowth during NGF-induced PC12 cell differentiation (4) and reduction in neurite extension of spinal motor neurons both as a substratum and as a soluble recombinant protein (5).

T-Cad is differentially expressed in different neuronal populations and is regulated in a temporally and spatially restricted pattern during motor axon growth (6). It is discretely distributed in the region devoid of growth cone, which suggests a potential role of T-Cad in the regulation of specific neurite outgrowth. T-Cad level is also elevated in cardiac and vascular tissues where aryl hydrocarbon receptor ligands repress its expression (7). Interestingly, T-Cad can also function as a receptor for low-density lipoprotein and adiponection/Acrp30 (8). Hormones and growth factors can also modulate T-Cad expression (9).

T-Cad gene is silenced by promoter hypermethylation in a variety of cancers (10, 11), and is associated with poor prognosis of cervical cancer. We have recently identified T-Cad as a novel target of DNA methyltransferase 3b (Dnmt3b) in PC12 cells (4). Dnmt3b represses T-Cad expression that requires histone deacetylation but is independent of de novo DNA methylation (4). Furthermore, ectopic expression of T-Cad inhibits NGF-induced neurite outgrowth, which emphasizes the negative role of T-Cad in this differentiation process.

Ubiquitin-proteasome system is a key player that regulates cellular protein level (for review, see Refs. 12 and 13). It requires multiple steps of enzyme catalysis involving E1, E2, and E3. In this ATP-dependent process involving a series of reactions, ubiquitin is transferred to a lysine residue of the target polypeptide to form a polyubiquitinated protein, which is degraded by the 26 S proteasome. This sequential action of enzymes allows different layers of regulation and precise co-operation among components of the protein complex. The substrate specificity of the proteasomal degradation resides in the E3 ligase that recognizes and catalyzes the addition of ubiquitin moiety to the substrate. One of the E3 ligase complexes, the anaphase promoting complex/cyclosome (APC/C) is coupled to cell cycle progression by targeting different cyclins and cell cycle-regulated proteins to degradation. The activity and substrate specificity of this complex was determined during cell cycle phase transition by interaction of APC/C with Cdc20 in early mitosis and Cdh1 (CDC20 homolog 1) in anaphase and G1. Its substrates include cyclins (e.g. cyclin B) and other cell cycle regulators (for review, see Refs. 12 and 13) as well as cell cycle-regulated proteins such as Dnmt1 (14). The SCF (Skp-Culin-F box protein) complexes contain a core ubiquitin ligase composed of Cul1/Cdc53, Skp1, the Ring finger protein Rbx1/Roc1/Hrt1, and a member of the F-box family of proteins (for review, see Ref. 15). The SCF ubiquitin ligase also has wide spectrum of substrates including Ikbeta, Sic1, G1 cyclins, and other cell cycle-related proteins (16). The Cbl family composes single protein Ring finger E3 ligases. These family of proteins are coupled to tyrosine kinase signaling especially in the immune system (17). Ubiqitin E3 ligases exhibit substrate specificity, which bestow the cells different layers of regulation of gene expression upon distinct stimuli.

Here we show that T-Cad is also regulated at the post-translational level by degradation through the ubiquitin-proteasome system, which requires tyrosine phosphorylation and APC/Ccdh1 (E3) ligase. These results suggest that T-Cad is regulated at both RNA and protein levels, which is probably essential for NGF-induced neurite outgrowth in PC12 cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
ZLLL (MG132), chloroquine, cycloheximide, genistein, and anti-FLAG M2 antibody were purchased from Sigma and lactacystin was obtained from Toronto Research Chemicals, Inc. T-Cadherin antibodies (sc-7940) were from Santa Cruz Biotechnology. P(Tyr) antibodies (py20 and py99) were from Santa Cruz, and 4610 was from upstate Biotechnology. Ku-70(N3H10) antibody was from Neomarker.

Generation of T-Cad Deletion and Point Mutants
T-Cad{Delta}CD1—The cadherin domain 1 was eliminated by digestion of T-Cadflag-(45) with BstEII and EcoRV. The BstEII site was blunt-ended and ligated to the EcoRV site, resulting in in-frame deletion mutation.

Nsp-{Delta}CD1—The EcoRV fragment from T-Cadflag bearing the N-terminal signal peptide was inserted in-frame with T-cad{Delta}CA1.

T-Cad{Delta}CD2–5—Cadherin domains 2–5 were eliminated by digestion of T-Cadflag with BstEII and BamHI, blunt-ended with Klenow, and religated.

Nsp-{Delta}CD3–5—Cadherin domains 3–5 were eliminated by digestion of T-Cadflag with BglII followed by religation resulting in in-frame deletion mutation.

T-CadY327F—Site-directed mutagenesis was performed by PCR with the following set of primers where the mutant bases are underlined: primer set 1: TGTATGTGGAAACCACGGATGC (UP-F) and TTCGATGATCAGTTCAAACTTGGGGTTTTC (UP-R); set 2: GAAAACCCCAAGTTTGAACTGATCATCGAA (Down-F) and CGGGATCCCAGACCTGACAATAAGCTGA (Down-R). PCR products of sets 1 and 2 were mixed at equal molar ratios and amplified with primers UP-F and Down-R to generate full-length T-Cad cDNA harboring the Y327F mutation. The PCR product was digested with BstEII and BamHI and cloned into the same site of T-Cadflag replacing the wild type sequence (4). Growing of PC12 cells and transfection assays were performed as described (4).

Western Blot Analysis
Whole cell extracts were subjected to Western blot analysis as described earlier (4). Quantitative analysis of the protein levels in Western blots was done using ImageQuant (GE Healthcare) software. The value of net intensity was used after background correction. The results are mean of three independent experiments.

Immunoprecipitation and Identification of Tyrosine Phosphorylation
T-Cadflag expressing cells either untreated or treated with NGF for 2 days were lysed in RIPA buffer and immunoprecipitated with anti-FLAG antibody. The precipitated proteins were resolved on SDS-PAGE, transferred to nitrocellulose membrane, and subjected to Western blot analysis with anti-phosphotyrosine antibody as described (4). The membrane was reprobed with anti-FLAG M2 antibody (Sigma).

Labeling of PC12 Cells with [32P]Orthophosphate
In vivo labeling was done as described earlier (14). T-Cadflag expressing PC12 cells untreated or treated with NGF for 2 days were washed in serum- and phosphate-free medium and incubated in the same medium for 1 h, followed by incubation with [32P]orthophosphate (0.5 mCi/ml) (MP Biochemicals) in phosphate-free medium containing dialyzed serum (fetal bovine serum or horse serum) for 4 h. The cells were washed with Tris-buffered saline, lysed in RIPA buffer, and subjected to immunoprecipitation with anti-FLAG antibody. The proteins pulled down were separated by SDS-PAGE, transferred to nitrocellulose membrane, and subjected to autoradiography using PhosphorImager analysis and Western blot analysis with anti-FLAG antibody. 32P-Signal was quantified using ImageQuant software (GE Healthcare).

Pulse-Chase Experiment
This experiment was done as described earlier (14). T-Cadflag expressing PC12 cells either untreated or treated with NGF for 48 h were labeled with [35S]methionine (1 mCi/ml) (MP Biochemicals) for 1 h in methionine-free medium were washed with phosphate-buffered saline followed by incubation in the complete RPMI medium containing 2 mM methionine. The cells were harvested at 0, 2, 4, and 6 h and equal amounts of protein (250 µg) extracted in RIPA buffer from each group was immunoprecipitated with anti-FLAG antibody. More proteins (500 µg of NGF-treated) were used from NGF-treated cells to make a comparable 0-h T-Cad level. The precipitated proteins were separated by SDS-PAGE, transferred to a nitrocellulose membrane, and subjected to PhosphorImager analysis. The blot was also subjected to Western blot analysis with the same antibody. 35S-Signal was quantified using ImageQuant software.

Ubiqutination in Vivo followed by Co-immunoprecipitation
Whole cell extracts from T-Cad expressing cells or vector-transfected PC12 cells were immunoprecipitated with anti-FLAG or anti-ubiquitin antibody (Santa Cruz) as described (14). The immune complex eluted in SDS-loading buffer was divided into two equal parts, separated in parallel, transferred to nitrocellulose membrane, and subjected to Western blot analysis with anti-FLAG or anti-ubiquitin antibody.

Subcellular Fractionation
T-Cadflag-expressing cells treated with NGF in the presence or absence of ZLLL were homogenized in buffer containing Tris-buffered saline (10 mM Tris-HCl, pH 7.4, 140 mM NaCl, 5 mM EDTA), 2 mM dithiothreitol, protease inhibitor mixture (Sigma), and centrifuged at 2,000 x g for 5 min to remove intact cells and nuclei. The supernatant was centrifuged at 100,000 x g for 90 min. The pellet (membrane) and supernatant (cytosol) fractions were then subjected to SDS-PAGE and Western blot analysis. Cells that are not treated with NGF were used as controls. Indirect immunofluorescence assay was performed as described (4, 18).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
NGF-induced Differentiation of PC12 Cells Causes Rapid Decline in T-Cad Protein Level—We have previously shown that ectopic expression of T-Cad impedes NGF-induced neurite outgrowth in PC12 cells (4). To study the potential relationship between T-Cad levels and NGF-mediated neuronal differentiation, we studied the expression profile of T-Cad during this process. Real-time reverse transcriptase-PCR analysis showed that NGF exposure had no significant effect on T-Cad mRNA level after 24 h, which was reduced by only ~40% after 48 h (Fig. 1A). In contrast, T-Cad protein levels rapidly decreased by ~70% within the first 24 h and nearly 90% by 36 h (Fig. 1, B and C). These data suggested to us that T-Cad expression is regulated post-transcriptionally at the early stage of neurite outgrowth. Like the endogenous T-Cad protein, ectopic T-Cadflag also rapidly decreased with time (by ~55 and 85% at 36 and 48 h, respectively) in PC12 cells in response to NGF treatment (Fig. 1, B and C). The relatively slow rate of depletion of the recombinant protein was probably due to its higher level compared with the endogenous protein. Transcription of ectopic T-Cadflag from the cytomegalovirus promoter was not suppressed by NGF (data not shown). Therefore, decreased levels of T-Cadflag upon NGF treatment further supports the notion that T-Cad is regulated at the protein level in the initial stages of NGF response.

To confirm that the recombinant T-Cadflag was authentic T-Cad, we pulled down the ectopic protein expressed in PC12 cells with anti-FLAG antibody followed by Western blot analysis with T-Cad antibody. The result showed that ectopic T-Cad immunoprecipitated by anti-FLAG antibody was indeed T-Cad (Fig. 1D). Lack of T-Cad precipitation in vector-transfected cells showed the specificity of the anti-FLAG antibody. Anti-FLAG antibody showed specificity in precipitating and detecting ectopic T-Cad, whereas T-Cad antibody could not efficiently immunoprecipitate T-Cad. We, therefore, used anti-FLAG antibody in subsequent experiments to analyze T-Cad expression PC12 cells.


Figure 1
View larger version (27K):
[in this window]
[in a new window]

 
FIGURE 1.
T-Cad protein is rapidly degraded upon NGF treatment. A, total RNA isolated from cells untreated or treated with NGF for 12 to 48 h were used for real-time quantitative reverse transcriptase-PCR analysis with T-Cad and 18 S rRNA primers. The ratio of T-Cad mRNA to 18 S rRNA in the absence of NGF treatment was assigned the value of 100. B, parental PC12 cells or cells expressing ectopic T-Cadflag were treated with NGF for 12 to 48 h. Whole cell extracts were subjected to Western blot analysis with anti-T-Cad or anti-FLAG antibody and the signal was detected by ECLTM after incubation with horse-radish peroxidase-conjugated anti-mouse secondary antibodies. Ku-70 or the nonspecific protein band (NS) was used as loading control. NS was used for normalization because the amount of proteins loaded in cells expressing T-Cadflag (30 µg) was too low to detect housekeeping genes. C, quantitative representation of the T-Cad level at different time points after NGF treatment. T-Cad signal in Western blot analysis was quantified using ImageQuant software. T-Cad level before NGF treatment was assigned a value of 100. The results are mean of three independent experiments ± S.E. D, extracts (500 µg of protein) from vector-transfected or T-Cad expressing cells were used for immunoprecipitation analysis with anti-FLAG antibody followed by Western blot analysis with anti-T-Cad antibody to demonstrate that the identity of the recombinant protein is T-Cad.

 
NGF Treatment Facilitates Proteasomal Degradation of T-Cad in PC12 Cells—To determine whether NGF-induced down-regulation of T-Cad is a translational or post-translational event, we determined its half-life using a pulse-chase experiment. T-Cad expressing PC12 cells in the presence or absence of NGF were incubated with [35S]methionine for 1 h to label the newly synthesized proteins followed by chase with excess unlabeled methionine for different time periods. As expected, 35S-signal in T-Cad pulled down by anti-FLAG antibody decreased with time during the chase period indicating that T-Cad turned over rapidly in NGF-treated cells (Fig. 2, A, top panel, lanes 4–8, and B). In contrast, 35S-signal in control cells was more stable during the chase period indicating a longer half-life (Fig. 2A, top panel, lanes 1–4). The half-life of T-Cad was ~2 h in NGF-treated cells (Fig. 2B). Western blot analysis showed that the total T-Cad level increased slightly with time especially in the 4- and 6-h cells during chase periods, in both groups (Fig. 2A, middle panel, compare lanes 3, 4, and 7, 8 with 1 and 5, respectively). This is perhaps due to its rapid synthesis in cells growing in the complete medium fortified with regular sera instead of dialyzed sera used for in vivo labeling with [35S]methionine. These results altogether demonstrate that NGF induces rapid degradation of T-Cad.

We next monitored the effect of NGF on the level of endogenous T-Cad in PC12 cells. Because the antibody that detects T-Cad in immunoblot analysis could not immunoprecipitate it, we used cycloheximide (CHX) to study the degradation of presynthesized T-Cad degradation. CHX (10 µg/ml) abolished protein biosynthesis in PC12 cells (data not shown). Like T-Cadflag, endogenous T-Cad also degraded at a faster rate in differentiated PC12 cells (Fig. 2, C and D). T-Cad was almost completely degraded within 4 h of CHX treatment of cells exposed to NGF (Fig. 2, C and D), whereas the level of T-Cad remained in control cells were not significantly altered during this time period. This data shows that like T-Cadflag, endogenous T-Cad is rapidly degraded in the presence of NGF.

To identify the proteolytic pathway involved in the rapid turnover of T-Cad, we treated the cells with lactacystin, a specific proteasomal inhibitor, in the presence or absence of NGF. T-Cad protein level was significantly elevated in both untreated (-NGF) and NGF treated (+NGF) cells after treatment with lactacystin for 24 h (Fig. 3, A and B). The recovery of T-Cad protein was, however, higher (~2.7-fold) in NGF-treated cells compared with the control cells (1.8-fold). Treatment of cells with chloroquine, a lysosomal protease inhibitor, did not affect T-Cad level (Fig. 3, C and D). To confirm further that T-Cad is indeed degraded through the proteasomal pathway, the cells were treated with another potent proteasomal inhibitor, ZLLL. Pretreatment with ZLLL not only blocked T-Cad depletion but also elevated its level compared with control cells that are not exposed to NGF (Fig. 3E, compare lanes 5, 7 and 9 with lane 1). In fact, T-Cad accumulated linearly with time when protein degradation was blocked by ZLLL (Fig. 3, E and F, y = 7x + 79.53, RSQ = 0.98). These data, taken together, suggest that T-Cad is degraded by the proteasomal pathway, which is further enhanced by NGF treatment.


Figure 2
View larger version (33K):
[in this window]
[in a new window]

 
FIGURE 2.
Degradation of T-Cad is facilitated upon NGF treatment. A, half-life of T-Cadflag is reduced upon NGF treatment. T-Cad expressing PC12 cells untreated or treated with NGF for 48 h were labeled with [35S]methionine for 1 h in methionine-free medium, washed, and then chased in medium containing unlabeled methionine. The cells harvested at 0, 2, 4, and 6 h were immunoprecipitated with anti-FLAG antibody. The precipitated proteins were subjected to Western blot analysis with anti-FLAG antibody and PhosphorImager analysis. B, quantitative analysis of T-Cad level in A. The signal of 35S-labeled T-Cadflag was quantified using ImageQuant software. The signal in 0 h was assigned the value of 100. C, NGF treatment reduced half-life of endogenous T-Cad. Control and NGF-treated cells were treated with cycloheximide (CHX, 10 µg/ml) for the time period as indicated in the figure. Cell extracts were used for Western blot analysis with anti-T-Cad or anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody. D, quantification of the T-Cad level in C, which was taken as 100 in the control cells.

 
T-Cad Is Ubiquitinated in PC12 Cells—Ubiqutination marks proteins for proteasomal degradation. It also serves as a signal for the endocytosis of membrane-bound proteins (19). To determine whether T-Cad is ubiquitinated in vivo, cell extracts were prepared in buffer containing 1% SDS followed by heat inactivation of deubiquitinating enzymes. The cell extract was diluted and immunoprecipitated with anti-FLAG (for FLAG-tagged T-Cad) or anti-ubiquitin antibody followed by Western blot analysis of the pulled down proteins with each antibody (see Fig. 4A for schematic representation). Anti-FLAG antibody pulled-down T-Cad that was further enriched in cells treated with ZLLL (Fig. 4B, lanes 5 and 6). Ubiquitinated T-Cad was detected as the higher molecular weight ladder in cells treated with ZLLL (Fig. 4B, lane 6). Similarly, anti-FLAG antibody also detected proteins immunoprecipitated by anti-ubiquitin antibody in cells expressing T-Cad (Fig. 4B, lanes 9 and 10). As expected, the ubiquitinated ladder of T-Cad was robust in cells incubated with ZLLL compared with the untreated cells. Similarly, ubiquitinated T-Cad pulled by anti-FLAG antibody can only be detected by anti-ubiquitin antibody in cells treated with ZLLL (Fig. 4B, lane 16). The inability to detect ubiquitinated T-Cad in ZLLL-untreated cells supports the notion that ubiquitinated T-Cad is rapidly degraded to a level that is too low to be detected (Fig. 4B, lanes 5, 9, and 15). The enrichment of the polyubiquitinated T-Cad in cells treated with ZLLL further confirmed the involvement of proteasome in the turnover of T-Cad under normal physiological conditions. As expected, ubiquitin antibody also pulled down many other ubiquitinated proteins (Fig. 4B, lanes 17–20). T-Cad was not detected in the vector-transfected cells after immunoprecipitation with either anti-FLAG (Fig. 4B, lanes 3, 4, 13, and 14) or anti-ubiquitin (Fig. 4B, lanes 7 and 8) antibody, which confirmed the specificity of immunoprecipitation analysis.


Figure 3
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 3.
Treatment of PC12 cells with proteasomal inhibitors impede degradation of T-Cad. T-Cad expressing PC12 cells treated with NGF for 4 days were treated with (A) lactacystin (LactaC) (10 µM) or (C) chloroquine (CLQ, 10 µM) for 4 h. Whole cell extracts were subjected to Western blot analysis with anti-FLAG antibody. B and D are quantitative analysis of T-Cad protein in A and B, respectively. The level of T-Cad in the control was taken as 100. E, T-Cad expressing cells were treated with ZLLL (10 µM) at different time points of NGF treatment. Whole cell extract was subjected to immunoblot blot analysis with anti-FLAG antibody. NS denotes nonspecific band showing comparable protein in each lane. F, quantitative representation of T-Cad level in E using ImageQuant software. T-Cad level in the control was assigned as 100. The results are mean of three independent experiments ± S.E.

 


Figure 4
View larger version (54K):
[in this window]
[in a new window]

 
FIGURE 4.
T-Cad is ubiquitinated in vivo. A, schematic representation of the co-immunoprecipitation (IP)/Western blot (WB) analysis. B, PC12 cells were transfected with pc-Flag3 (vector) or T-Cadflag. Extracts from these cells either untreated or treated with ZLLL were used for co-immunoprecipitation analysis with anti-FLAG or anti-ubiquitin antibody, followed by Western blot analysis with these antibodies. V and T stand for empty vector and T-Cad expression vector, respectively. C, ubiquitination of T-Cad is evident in membrane fractions of cells treated with ZLLL and NGF. Cell extracts were fractionated into membrane and cytosolic fractions and subjected to SDS-PAGE and Western blot analysis. The results are mean of three independent experiments.

 
Ubiquitinated T-Cad Accumulates on the Plasma Membrane of PC12 Cells When Its Degradation Is Blocked by ZLLL—T-Cad is linked to the plasma membrane through the glycosylphosphatidylinositol anchor. To determine whether membrane-bound T-Cad is ubiquitinated or it needs to be internalized to the cytosol for ubiquitination and subsequent degradation, S-100 extracts from T-Cad expressing cells either untreated or treated with +ZLLL were fractionated to membrane and cytosol fractions. T-Cad was detected only in the membrane fractions, which was elevated markedly in ZLLL-treated cells (Fig. 4C, lanes 1, 3 and 5, 7). High molecular weight polyubiqutinated T-Cad was detected only in the membrane fraction of PC12 cells upon inhibition of proteasomal degradation especially after NGF treatment. These results suggest that the membrane-bound T-Cad is preferentially polyubiquitinated.


Figure 5
View larger version (50K):
[in this window]
[in a new window]

 
FIGURE 5.
Cdh1 enhances proteasomal degradation of T-Cad. A, T-Cad was co-transfected with the vector or substrate recognition component of different E3 ligases such as Cbl family of proteins (Cbl-b or Cbl-c), APC/cyclosome ligase components (Cdh1-HA or Cdc20-HA), or SCF-E3 ligase complex protein (Cullin1) into PC12 cells. Whole cell extracts from these cells 48 h post-transfection were used for Western blot analysis with anti-FLAG (to detect T-Cad) or anti-beta-tubulin antibody. B, quantitative representation of the T-Cad level in A. The level of T-Cad in vector-transfected cells was taken as 100. C, T-Cadflag was co-transfected with 1 to 3 µg of the vector, Cdh1, Cdc20, or Cullin1, respectively, into PC12 cells. Whole cell extracts from these cells were subjected to immunoblot analysis with anti-FLAG (to detected T-Cad) or anti-beta-tubulin. Anti-hemagglutinin (HA) antibody was used to demonstrate the expression of Cdh1, Cdc20, or Cbl. D, quantitative analysis of T-Cad protein level in C normalized to that of beta-tubulin. The level of T-Cad transfected with 1 µg of each plasmid was taken as 100. The results are mean of three independent experiments.

 
APC/CCDH1, the E3 Ligase, Is Required for Proteasomal Degradation of T-Cad—Degradation of proteins by the ubiquitin-proteasome system involves multiple steps of enzyme catalysis (for review, see Refs. 12, 13, and 20). The substrate specificity of the proteasomal degradation resides in the E3 ligase, which recognizes the protein substrate and catalyzes the addition of ubiquitin to specific lysine moieties (21). To identify the E3 ligase that mediates proteasomal turnover of T-Cad we initially focused on the Cbl family of proteins (Cbl-b or Cbl-c) (22), SCF E3 ligase complex (23), APC/Ccdh1, and APC/Ccdc20 E3 ligase complexes (24) that can utilize membrane-associated protein substrates (2527). For this purpose, T-Cad was co-transfected with expression vectors for Cbl variants (22), or Cdh1, Cdc20 (28), or Cul1 (29), the polypeptides involved in substrate recognition by these E3 ligase complexes. Western blot analysis showed that relative to the vector-transfected cells, the T-Cad level decreased by ~73% in cells transfected with Cdh1 (Fig. 5, A and B), whereas co-expression of Ccd20, another component of APC/C ligase, did not exhibit any effect. Surprisingly, overexpression of two of the Cbl family members, Cbl-b and Cbl-c, involved in ubiquitination of the membrane-bound proteins did not affect T-Cad level (Fig. 5, A and B). Similarly, ectopic expression of Cullin 1 (Cul1), the component of SCF complex had no effect on T-Cad level (Fig. 5, A and B). Furthermore, degradation of T-Cad was proportional to the amount of Cdh1 transfected, whereas transfection of Cul1 or Cdc20 had no effect (Fig. 5, C and D). This result reinforces the notion that APC/Ccdh1 ligase specifically recognizes T-Cad in PC12 cells and induces its proteasomal degradation.

Deletion of Cadherin Extracellular Domain 1 (CD1) Destabilizes T-Cad—To study the molecular signals that are required for proteasomal degradation of T-Cad, we generated different cadherin domain (CD) deletion mutants (Fig. 6A) and determined if these deletions affected the stability of T-Cad. All deletion mutants, except {Delta}CD1, harbor the N-terminal signal peptide. The level of the wild type T-Cad was reduced with time after CHX exposure in control cells, which was more pronounced in NGF-treated cells (Fig. 6B, upper and lower panels, lanes 1–3, and C). Interestingly, deletion of CD1 (NSP-{Delta}CD1) destabilized T-Cad in PC12 cells and NGF treatment augmented the process further (Fig. 6B, lanes 7–9). Approximately 25% of the truncated protein was retained after 2 h of CHX treatment of control cells compared with only 4% retention after NGF treatment (Fig. 6, B, lanes 7 and 8, and C). Additional deletion of the N-terminal region preceding cadherin domains of NSP-{Delta}CD1 ({Delta}CD1), which encompasses the signal peptide, significantly increased susceptibility of T-Cad to degradation irrespective of NGF treatment (Fig. 6, B, lanes 13–15, and C). This enhanced degradation is probably due to the inability to localize the truncated protein to the membrane and rapid degradation of the misfolded protein. In contrast, deletion of cadherin domains 2–5, leaving the signal peptide intact ({Delta}CD2–5), significantly stabilized T-Cad (Fig. 6, B, compare lanes 4–6 to lanes 1–3, and C). No marked changes in the degradation of this mutant were observed before and after NGF treatment (Fig. 6, B and C). Interestingly, deletion of CD3–5 (entire CD3 and CD4 and part of CD5) also facilitated degradation of T-Cad, which was more pronounced after NGF treatment (Fig. 6, B, lanes 10–12, and C). These results suggest that CD2 of T-Cad and the association of T-Cad with the membrane are essential for its NGF-mediated degradation.

To investigate whether different CD deletion mutants of T-Cad are targeted to the membrane, the immunofluorescence assay was performed to identify T-Cadflag. As observed earlier (4), wild type T-Cad localized on the membrane (Fig. 6D, panels I–III). Interestingly, the T-Cad mutant ({Delta}CD-2–5) that lacks the C-terminal region and glycosylphosphatidylinositol anchoring site was also targeted to the membrane (Fig. 6D, panels IV–VI). This observation corroborated an earlier finding that the glycosylphosphatidylinositol anchor is not essential for membrane targeting of T-Cad (30), whereas the N-terminal region is required for its proper localization to the membrane. Consistent with this result, the mutant lacking the signal peptide was retained in the cytoplasm (Fig. 6D, panels VII–IX). As expected, all other mutants with intact N and C termini were also confined to the membrane (data not shown).

Next, we identified the domain of T-Cad that is ubiquitinated in vivo. For this purpose we treated cells ectopically expressing different mutants with NGF followed by ZLLL, the proteasomal inhibitor, to allow accumulation of polyubiquitinated proteins. The result showed that the high molecular weight proteins indeed accumulated in cells expressing all the mutants upon treatment with ZLLL (Fig. 6E). These polyubiquitinated forms of the highly unstable mutants were markedly elevated (Fig. 6E, {Delta}CD1, Nsp-{Delta}CD1, and {Delta}CD3–5), whereas that of {Delta}CD2–5 was not apparent (Fig. 6E, {Delta}CD2–5). Some ladders were visible in ZLLL-treated {Delta}CD2–5 only when a much higher amount of protein was loaded (data not shown). Interestingly, the levels of the polyubiquitinated form of different proteins ({Delta}CD1 > Nsp-{Delta}CD1 > and >{Delta}CD3–5 > WT >{Delta}CD 2–5, Fig. 6E, right panel) correlated inversely with their stability ({Delta}CD1 < Nsp-{Delta}CD1 < and <{Delta}CD3–5 < WT <{Delta}CD2–5, Fig. 6C). These results show that multiple lysines in different cadherin domains of T-Cad can be ubiquitinated in vivo.


Figure 6
View larger version (53K):
[in this window]
[in a new window]

 
FIGURE 6.
Different cadherin domains differentially modulate stability of T-Cad. A, schematic diagram of T-Cad mutants used in this study. B, each T-Cad mutant was transfected into PC12 cells in duplicate. After 24 h of NGF treatment cells were further treated with CHX and collected at 0, 2, and 4 h. Whole cell extracts were subjected to Western blot analysis with anti-FLAG antibody. Asterisks denote T-Cad variants. NS, nonspecific band was used to demonstrate equal loading. C, quantitative analysis of data in B. The level of T-Cad variants (the wild type or mutants) at 0 h was assigned a value of 100. D, T-Cad (wild type or mutants) was transfected into PC12 cells. The cells were fixed 24 h later and subjected to indirect immunofluorescence analysis with anti-FLAG antibody. 4',6-Diamidino-2-phenylindole was used to stain the nuclei. E, in vivo ubiquitination of T-Cad in NGF-treated cells. T-Cad wild type and mutants described in B were transfected into PC12 cells. After 16 h cells were split into two plates. Cells were treated with NGF post-6 h plating. Another 36 h later one plate was treated with ZLLL for 16 h before harvest and whole cell extracts were subjected to Western blot analysis with anti-FLAG antibody. The level of ubiquitinated wild type T-Cad was assigned a value of 100. The results are mean of three independent experiments ± S.E.

 
Tyrosine Phosphorylation Is Essential for T-Cad Degradation—It is known that post-translational modifications of proteins such as phosphorylation act as signatures for their degradation (3133). Analysis of the T-Cad primary structure revealed several potential tyrosine phosphorylation sites. To determine whether phosphorylation of T-Cad plays a role in its degradation we treated PC12 cells with the general tyrosine kinase inhibitor genistein followed by Western blot analysis with anti-FLAG antibody. The result showed that pretreatment with genistein significantly stabilized T-Cad in NGF-treated cells compared with the control cells (Fig. 7A). This result suggests that tyrosine phosphorylation could, at least in part, trigger the degradation of T-Cad in response to NGF.


Figure 7
View larger version (39K):
[in this window]
[in a new window]

 
FIGURE 7.
Tyrosine phosphorylation of T-Cad in CD2 domains triggers its degradation in response to NGF. A, NGF-mediated degradation of T-Cad is blocked by genistein, a tyrosine kinase inhibitor. T-Cadflag expressing cells (upper panel) or vector-transfected PC12 cells (lower panel) either untreated or treated with NGF for 24 h were incubated with genistein (10 µM) for an additional 12 h. Whole cell extract was used for Western blot analysis with anti-FLAG, anti-T-Cad, or anti-glyceraldehyde-3-phosphate dehydrogenase antibody. NS, nonspecific polypeptide. The level of T-Cad in the control was assigned the value of 100. B, T-Cad expressing PC12 cells either untreated or treated with NGF were labeled with [32P]orthophosphate, followed by immunoprecipitation with anti-FLAG antibody. Immunoprecipitated proteins were separated by SDS-polyacrylamide gel electrophoresis, transferred to nitrocellulose membrane, and subjected to autoradiography, PhosphorImager analysis followed by Western blot analysis. The level of 32P-signal in T-Cad was quantified using ImageQuant software. The signal in the control was taken as 100. C, immunoprecipitation (IP) analysis was performed with the extracts from T-Cad expressing cells untreated or treated with NGF followed by Western blot analysis with p-tyrosine antibody. The blot was reprobed with anti-FLAG antibody to detect total T-Cad level. For quantitative analysis, the phosphotyrosine (p-tyr) T-Cad signal in the control was taken as 100. D, PC12 cells were transfected in duplicate plates with wild type (WT) or Y327F mutant of T-Cad. One plate was treated with NGF after 24 h. Cells were treated with CHX 48 h post-transfection and collected at 0, 2, and 4 h. Whole cell extracts were subjected to Western blot analysis with anti-FLAG antibody. The level of each T-Cad variant at 0 h was assigned the value of 100. E, in vivo polyubiquitination of the wild type and Y327F mutant of T-Cad in the presence of NGF. This was carried out following the protocol described in Fig. 6E. The results are mean of three independent experiments.

 
The obvious question was whether the phosphorylation status of T-Cad in PC12 cells was altered in response to NGF treatment. To address this issue, the cells were labeled with [32P]orthophosphate followed by immunoprecipitation with anti-FLAG antibody and autoradiography. A dramatic increase (~65-fold) in the level of phosphorylated T-Cad after NGF treatment (Fig. 7B) suggested its potential role in the degradation process. Because treatment of cells with genistein blocked degradation of T-Cad especially after NGF treatment (Fig. 7A) we next tested the possibility that tyrosine phosphorylation of T-Cad attributes to its increased phosphorylation after NGF treatment. Western blot analysis of immunoprecipitated T-Cad with phosphotyrosine-specific antibody showed that T-Cad was tyrosine phosphorylated (pY-T-Cadflag) in control PC12 cells, which was significantly increased (~9-fold) upon NGF treatment (Fig. 7C). This data showed that increased tyrosine phosphorylation of T-Cad probably causes its faster degradation upon NGF treatment.

We reasoned that tyrosine phosphorylation at the CD2 domain may initiate T-Cad degradation because its deletion stabilized the protein (Fig. 6, B and C). It was, therefore, imperative to identify signature tyrosine residue(s) in this domain that may be required for its degradation. We focused on tyrosine 327 in this domain that had the potential to be a phosphorylation target by Netphos2.0 program (www.cbs.dtu.dk/services/NetPhos), and are predicted to be a potential target of TRK, SRC, and FYN/Yes tyrosine kinases by the group-based phosphorylation scoring method. Accordingly, we mutated tyrosine 327 to phenylalanine and showed that this mutant (Y327F) was significantly resistant to proteasomal degradation (Fig. 7D). This observation suggests that tyrosine phosphorylation of T-Cad at this site acts as a signal to induce its degradation especially after NGF treatment. As expected, significantly reduced polyubiquitinated forms were detected in Y327F mutant relative to the wild type protein (Fig. 7E).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In an earlier study we demonstrated that NGF-induced differentiation of PC12 cells causes up-regulation of DNA methyltransferase 3b and down-regulation of DNA methyltransferase 1 and 3a (18). Depletion of Dnmt3b by small interfering RNA retarded the differentiation process. This observation suggested an important role for Dnmt3b and some of its target genes in the differentiation of PC12 cells to neuronal phenotype. Subsequently, we identified T-Cad as a target of Dnmt3b (4). An interesting finding was the suppression of T-Cad promoter by Dnmt3b independent of its catalytic activity (4). The present study demonstrated that T-Cad is also subjected to proteasomal degradation and that NGF enhances this process to maintain a differentiated phenotype. The rapid turnover of proteins by the ubiquitin-proteasome system provides a tool for the regulation of their function in various cellular processes. Tightly controlled regulation at transcriptional and post-translational levels is likely to be essential for the proper function of T-Cad in NGF-induced PC12 cell differentiation. It correlates well with the function of T-Cad as a negative regulator of axon guidance because its overexpression inhibits neurite outgrowth in PC12 cells (4).

NGF-induced degradation of T-Cad suggests an inverse relationship between T-Cad level and differentiation state of PC12 cells. NGF-mediated neuronal differentiation is known to propagate signaling cascades initiated by NGF-receptor tyrosine phosphorylation. At least three observations support a critical role of tyrosine phosphorylation, induced by NGF treatment in the turnover of T-Cad. First, treatment of cells with tyrosine kinase inhibitor genistein abrogates the degradation process. Second, T-Cad is phosphorylated in PC12 cells and the level of Tyr(P) species increased upon NGF exposure. Third, mutation of tyrosine residue at cadherin domain 2 renders this protein significantly resistant to degradation. There are at least six other potential tyrosine phosphorylation sites in T-Cad. It is conceivable that phosphorylation at one or more of these sites can also trigger its degradation. Genistein is a broad-spectrum inhibitor of tyrosine kinases, many of which have been shown to alter protein turnover by a variety of mechanisms. Hence, we cannot rule out the potential role of other modifications in addition to tyrosine phosphorylation in the turnover of T-Cad. Indeed, it is known that T-Cad is subjected to other post-translational modifications such as ADP-ribosylation (34).

The factors involved in the proteasomal degradation of T-Cad deserve comment. E3 ligases exhibit substrate specificity, which bestow the cells different layers of regulation of gene expression in response to distinct stimuli. APC/CCDH1 specifically induced degradation of T-Cad, as co-transfection of Cdh1 and T-Cad facilitates its turnover, and the degradation of T-Cad is dependent on the amount of co-transfected Cdh1. It is known that APC/CCDH1 is coupled to cell cycle and is required for cell cycle progression by targeting cell cycle controlling protein (21). This E3 complex is also highly expressed in the post-mitotic neuron and could play a potential role in the regulation of axonal growth and patterning (35). Its role in neuronal cell development and function has not been explored. The present study showed that APC/CCDH1 controls the T-Cad protein level by targeting its degradation during NGF-induced PC12 cell differentiation to neuronal phenotype. This post-translational regulation of T-Cad coupled with the inhibitory role of T-Cad in neurite outgrowth indicates that this E3 ligase complex plays a key role in neuronal differentiation. Extension of this finding to neuronal differentiation of primary neuronal cells would be of great interest.

APC/C ligase substrates usually harbor KEN box, dead box, and/or A box (24, 32). We have not identified such conserved motifs in T-Cad. T-Cad contains 5 cadherin domains all of which share conserved amino acids that are characteristic of this domain (Fig. 5) (36, 37). It is known that CD1 plays an important role in cell adhesion (38). An interesting aspect of the present findings is the opposing roles of CD1 and CD2 on T-Cad stability; whereas CD1 stabilizes T-Cad, CD2 enhances its degradation (Fig. 6). Strikingly, the stability of different deletion mutants correlates very well with their ability to be polyubiqutinated in vivo. Unstable T-Cad mutants were significantly more polyubiquitinated than the stable ones. Ubiquitination of different deletion mutants of T-Cad, albeit at different levels, suggests that T-Cad harbors multiple lysines that can be ubiquitinated in vivo (Figs. 6 and 7). The question remains whether the accessibility of different lysine residues by proteasomal machinery accounts for the stability of these different mutants.

Finally, the membrane-associated proteins can be internalized by both clathrin-dependent and clathrin-independent pathways (39). It would be of interest to elucidate the mechanism by which T-Cad is internalized and determine whether it is regulated by NGF.


    FOOTNOTES
 
* This work was supported in part by National Institutes of Health Grants CA86978 and CA10195. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Present address: Howard Hughes Medical Institute and Department of Biological Chemistry, University of Michigan, Ann Arbor, MI. Back

2 To whom correspondence should be addressed. Tel.: 614-688-5494; Fax: 614-688-5600; E-mail: jacob.42{at}osu.edu.

3 The abbreviations used are: T-Cad, T-cadherin; CHX, cycloheximide; Cdh1, CDC20 homolog 1; CD, cadherin domain; APC/C, anaphase promoting complex/cyclosome; NGF, nerve growth factor; Dnmt, DNA methyltransferase; SCF, Skp-Culin-F box protein; E1, ubiquitin-activating enzyme; E2, ubiquitin carrier protein; E3,ubiquitin-protein isopeptide ligase. Back


    ACKNOWLEDGMENTS
 
We thank Drs. Stanley Lipkowitz, Kristian Helin, and Zhen-Qiang Pan for Cbl, Cdc20/Cdh1, and Cullin 1 expression vectors, respectively, Drs. Sarmila Majumder and Tasneem Motiwala for critically reading the manuscript.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Ranscht, B., and Dours-Zimmermann, M. T. (1991) Neuron 7, 391-402[CrossRef][Medline] [Order article via Infotrieve]
  2. Ivanov, D., Philippova, M., Tkachuk, V., Erne, P., and Resink, T. (2004) Exp. Cell Res. 293, 207-218[CrossRef][Medline] [Order article via Infotrieve]
  3. Philippova, M. P., Bochkov, V. N., Stambolsky, D. V., Tkachuk, V. A., and Resink, T. J. (1998) FEBS Lett. 429, 207-210[CrossRef][Medline] [Order article via Infotrieve]
  4. Bai, S., Ghoshal, K., and Jacob, S. T. (2006) J. Biol. Chem. 281, 13604-13611[Abstract/Free Full Text]
  5. Fredette, B. J., Miller, J., and Ranscht, B. (1996) Development 122, 3163-3171[Abstract]
  6. Fredette, B. J., and Ranscht, B. (1994) J. Neurosci. 14, 7331-7346[Abstract]
  7. Niermann, T., Schmutz, S., Erne, P., and Resink, T. (2003) Biochem. Biophys. Res. Commun. 300, 943-949[CrossRef][Medline] [Order article via Infotrieve]
  8. Hug, C., Wang, J., Ahmad, N. S., Bogan, J. S., Tsao, T. S., and Lodish, H. F. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 10308-10313[Abstract/Free Full Text]
  9. Bromhead, C., Miller, J. H., and McDonald, F. J. (2006) Gene (Amst.) 374, 58-67[CrossRef][Medline] [Order article via Infotrieve]
  10. Toyooka, S., Toyooka, K. O., Harada, K., Miyajima, K., Makarla, P., Sathyanarayana, U. G., Yin, J., Sato, F., Shivapurkar, N., Meltzer, S. J., and Gazdar, A. F. (2002) Cancer Res. 62, 3382-3386[Abstract/Free Full Text]
  11. Roman-Gomez, J., Castillejo, J. A., Jimenez, A., Cervantes, F., Boque, C., Hermosin, L., Leon, A., Granena, A., Colomer, D., Heiniger, A., and Torres, A. (2003) J. Clin. Oncol. 21, 1472-1479[Abstract/Free Full Text]
  12. Hershko, A. (2005) Cell Death Differ. 12, 1191-1197[CrossRef][Medline] [Order article via Infotrieve]
  13. Nakayama, K. I., and Nakayama, K. (2006) Nat. Rev. Cancer 6, 369-381[CrossRef][Medline] [Order article via Infotrieve]
  14. Ghoshal, K., Datta, J., Majumder, S., Bai, S., Kutay, H., Motiwala, T., and Jacob, S. T. (2005) Mol. Cell. Biol. 25, 4727-4741[Abstract/Free Full Text]
  15. Ang, X. L., and Wade Harper, J. (2005) Oncogene 24, 2860-2870[CrossRef][Medline] [Order article via Infotrieve]
  16. Jackson, P. K., and Eldridge, A. G. (2002) Mol. Cell 9, 923-925[CrossRef][Medline] [Order article via Infotrieve]
  17. Rao, N., Miyake, S., Reddi, A. L., Douillard, P., Ghosh, A. K., Dodge, I. L., Zhou, P., Fernandes, N. D., and Band, H. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 3794-3799[Abstract/Free Full Text]
  18. Bai, S., Ghoshal, K., Datta, J., Majumder, S., Yoon, S. O., and Jacob, S. T. (2005) Mol. Cell. Biol. 25, 751-766[Abstract/Free Full Text]
  19. d'Azzo, A., Bongiovanni, A., and Nastasi, T. (2005) Traffic 6, 429-441[CrossRef][Medline] [Order article via Infotrieve]
  20. Bloom, J., and Pagano, M. (2004) Cell Cycle 3, 138-140[Medline] [Order article via Infotrieve]
  21. Buschhorn, B. A., and Peters, J. M. (2006) Nat. Cell. Biol. 8, 209-211[CrossRef][Medline] [Order article via Infotrieve]
  22. Ettenberg, S. A., Keane, M. M., Nau, M. M., Frankel, M., Wang, L. M., Pierce, J. H., and Lipkowitz, S. (1999) Oncogene 18, 1855-1866[CrossRef][Medline] [Order article via Infotrieve]
  23. Nakayama, K. I., and Nakayama, K. (2005) Semin. Cell Dev. Biol. 16, 323-333[CrossRef][Medline] [Order article via Infotrieve]
  24. Bashir, T., Dorrello, N. V., Amador, V., Guardavaccaro, D., and Pagano, M. (2004) Nature 428, 190-193[CrossRef][Medline] [Order article via Infotrieve]
  25. Kumar, K. G., Tang, W., Ravindranath, A. K., Clark, W. A., Croze, E., and Fuchs, S. Y. (2003) EMBO J. 22, 5480-5490[CrossRef][Medline] [Order article via Infotrieve]
  26. Davies, G. C., Ettenberg, S. A., Coats, A. O., Mussante, M., Ravichandran, S., Collins, J., Nau, M. M., and Lipkowitz, S. (2004) Oncogene 23, 7104-7115[CrossRef][Medline] [Order article via Infotrieve]
  27. Sadot, E., Simcha, I., Iwai, K., Ciechanover, A., Geiger, B., and Ben-Ze'ev, A. (2000) Oncogene 19, 1992-2001[CrossRef][Medline] [Order article via Infotrieve]
  28. Petersen, B. O., Wagener, C., Marinoni, F., Kramer, E. R., Melixetian, M., Lazzerini Denchi, E., Gieffers, C., Matteucci, C., Peters, J. M., and Helin, K. (2000) Genes Dev. 14, 2330-2343[Abstract/Free Full Text]
  29. Pan, Z. Q., Kentsis, A., Dias, D. C., Yamoah, K., and Wu, K. (2004) Oncogene 23, 1985-1997[CrossRef][Medline] [Order article via Infotrieve]
  30. Goubaeva, F., Giardina, S., Yiu, K., Parfyonova, Y., Tkachuk, V. A., and Yang, J. (2005) Biochem. Biophys. Res. Commun. 329, 624-631[CrossRef][Medline] [Order article via Infotrieve]
  31. Karin, M., and Ben-Neriah, Y. (2000) Annu. Rev. Immunol. 18, 621-663[CrossRef][Medline] [Order article via Infotrieve]
  32. Littlepage, L. E., and Ruderman, J. V. (2002) Genes Dev. 16, 2274-2285[Abstract/Free Full Text]
  33. Vogt, P. K., Jiang, H., and Aoki, M. (2005) Cell Cycle 4, 908-913[Medline] [Order article via Infotrieve]
  34. Doyle, D. D., Goings, G. E., Upshaw-Earley, J., Page, E., Ranscht, B., and Palfrey, H. C. (1998) J. Biol. Chem. 273, 6937-6943[Abstract/Free Full Text]
  35. Stegmuller, J., and Bonni, A. (2005) Trends Neurosci. 28, 596-601[CrossRef][Medline] [Order article via Infotrieve]
  36. Tepass, U., Truong, K., Godt, D., Ikura, M., and Peifer, M. (2000) Nat. Rev. Mol. Cell. Biol. 1, 91-100[CrossRef][Medline] [Order article via Infotrieve]
  37. Angst, B. D., Marcozzi, C., and Magee, A. I. (2001) J. Cell Sci. 114, 629-641[Abstract]
  38. Patel, S. D., Ciatto, C., Chen, C. P., Bahna, F., Rajebhosale, M., Arkus, N., Schieren, I., Jessell, T. M., Honig, B., Price, S. R., and Shapiro, L. (2006) Cell 124, 1255-1268[CrossRef][Medline] [Order article via Infotrieve]
  39. Aguilar, R. C., and Wendland, B. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 2679-2680[Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Pharmacol. Rev.Home page
D. D. Mruk, B. Silvestrini, and C. Y. Cheng
Anchoring Junctions As Drug Targets: Role in Contraceptive Development
Pharmacol. Rev., June 1, 2008; 60(2): 146 - 180.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/37/27171    most recent
M700691200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow