|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 282, Issue 37, 27327-27333, September 14, 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Luminal Chloride-dependent Activation of Endosome Calcium Channels
PATCH CLAMP STUDY OF ENLARGED ENDOSOMES*
From the Department of Cell Biology and Physiology, Washington University, St. Louis, Missouri 63110
Received for publication, March 26, 2007 , and in revised form, May 18, 2007.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Although Ca2+ release from early endosomes (EE) is important for the fusion of primary endosomes, the presence of an ion channel responsible for releasing calcium from the EE has not been shown. A recent proteomics study has identified the TRPV2 channel protein in EE, suggesting that transient receptor potential-like Ca2+ channels may be in endosomes. The submicron size of endosomes has made it difficult to study their ion channels in the past. We have overcome this problem by generating enlarged EE with the help of a hydrolysis-deficient SKD1/VPS4B mutant in HEK293 cells. Here we report the first patch clamp recording of a novel endosome calcium channel (ECC) in these enlarged EE. The ECC shows a similar pharmacology to that of the TRPV2 channel. In addition, the ECC has a unique chloride-dependent regulation; it is inhibited by the endosome luminal chloride with a K50 of 82 mM.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
A number of TRP2 type calcium channels have been localized to intracellular vesicles; however, their physiological roles in situ have remained largely uncharacterized. The recent identification of the TRPV2 channel protein in an early endosomal fraction (1) has raised the possibility of characterizing the physiological roles of the TRP-like channel in the native environment of the endosome membrane. To achieve this goal, it would be necessary to apply the patch clamp technique directly to endosome membranes. Past attempts at such studies have been unsuccessful, mainly because of the submicron size of endosomes. We have been able to increase the size of the endosome membrane by introducing a hydrolysis-deficient mutant of SKD1/VPS4B (E235Q) into HEK293 cells. Overexpression of SKD1/VPS4B (E235Q), which disrupts endosome trafficking (2), leads to the formation of large endosomes (3-6 µmin diameter) in HEK293 cells. Using these enlarged EE, we have made the first patch clamp recordings of a novel endosome calcium channel (ECC). This ECC was sensitive to >500 µM La3+ inhibition as reported in other TRP family channels, but was activated by 100 µM La3+ and by 200 µM 2-aminoethoxydiphenyl borate (2-APB), whereas being insensitive to TRPV1 activator capsaicin. Surprisingly ECC activity was affected by the endosome luminal chloride ion concentration ([Cl-]lum). [Cl-]lum inhibited ECC with a K50 of 82 mM.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
HEK293 cells stably expressing the tetracycline-inducible SKD1/VPS4B (E235Q) gene (3) were treated with tetracycline 4-6 h prior to the experiments. GFP-tagged SKD1/VPS4B (E235Q)-expressing cells were used to demonstrate co-localization of GFP-SKD1/VPS4B (E235Q) with endocytosed rhodamine sulfate. c-myc-SKD1/VPS4B (E235Q)-expressing cells were used to show Lysotracker Green negative staining in the rhodamine sulfate containing enlarged endosomes and were also used in patch clamp experiments.
Enlarged endosomes of sizes from 3-6 µm were visually identified and dissected manually with a glass electrode. Under the phase contrast microscope, enlarged endosomes were viewed as phase-bright (see Fig. 1C, circled). To facilitate slicing of the plasma membrane with an electrode, cells with enlarged endosomes, closer to the edge of cells, were used because cell thickness increased toward the center. The electrode was pressed against the cell vertically and then was quickly pulled away from the cell to slice the cell membrane. Plating the cells on poly-L-lysine-treated cover glass prevented the cells from detaching from the cover glass. Multiple attempts (2-3 times) were required to free the enlarged endosomes from the cell. When successful, enlarged endosomes were seen as phase-dark spheres. Isolation was successful for 20-30% of attempts. Compared with cell membrane blebs, the surface of isolated enlarged endosomes looked slightly rough as if the surrounding structures such as actin filaments were still connected. The cell membrane blebs were usually bigger than enlarged endosomes, and their surface looked smooth.
The patch pipette resistance was 5-6 megOhms. Following giga seal (>5 Gohm) formation, ion channel activities were examined in inside-out configurations. The whole endosome capacitance was 298.06 ± 149.03 femtofarad (n = 4), which corresponds to an EE diameter of 3-6 µm, if the lipid unit membrane capacitance is assumed to be 1 microfarad/cm2.An Ag/AgCl agar bridge was used as a ground electrode. The Ag/AgCl agar bridge eliminated a junction potential caused by varying Cl- in the bath solution. The solutions used were (in mM) a pipette solution (KCl 30, K2SO4 60, MgCl2 0.1, EGTA 0.5, HEPES 10, pH 7.20); a Na+-based solution (NaCl 145, KCl 5, CaCl2 1.8, MgCl2 1, HEPES 10, pH 7.2); a K+-based solution (KCl 150, MgCl2 0.1, HEPES 10, pH 7.2); and a K+-based low Cl- solution (KCl 30, K2SO4 60, MgCl2 0.1, HEPES 10, pH 7.2). For the chloride effects, [Cl-] was varied by mixing KCl 150 and K2SO4 75 in different ratios. Patch clamp data were analyzed with the Clampfit program (Axon Instruments), OriginPro 7 (OriginLab), and Sigmaplot 9.0 (Systat Software Inc.). The data were filtered with a low pass filter at 1 kHz for analysis and at 200 Hz for display. Single channel data were analyzed by plotting all point histograms. When multiple channel activities were observed, the mean of the channel amplitudes was plotted against the applied voltages. RT-PCR was carried out using HEK293 total RNA. The RNAs were reverse-transcribed using oligo(dT). The PCR reaction was done using a sense primer (TGCTGACGGGCCACATCCTTATCC) and nested antisense primers (First, AAGCCCAGTTCACCTCCTCCAC; second, GCCCCGTTGCCCTCGTCCTC). The hTRPV2 cDNA was used as a positive control. The PCR result was analyzed using 1% agarose gel, and the DNAs were visualized with ethidium.
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Using artificial bilayer reconstitution, the biophysical and pharmacological properties of intracellular TRP channels from the endoplasmic reticulum membrane (4, 5) and the lysosomal membrane (6) have been examined. TRPV5 and TRPV6 localization has been seen in rab11 positive recycling endosomes (7). However, little is known about their functional properties in native endosomal membranes. Recently the TRPV2 channel protein was identified in rab5 positive early endosomes in IL4/PGE2-treated J774 cells.
Newly endocytosed primary endosomes undergo Ca2+-dependent fusion to become early endosomes (EE) (8, 9). Various reports suggest that the EE itself function as the Ca2+ source (10-12). Although Ca2+ release through ion channels in EE has not been shown, the presence of TRPV2 protein in EE (1) and in intracellular vesicles (13, 14) suggests that the ECC could be a TRP-like channel.
Newly formed EE membranes are exposed to two distinct environments. One environment is the EE lumen, which contains an endocytosed extracellular high Cl- and high Ca2+ solution, and the other is the cytosolic environment, which contains low Cl- and low Ca2+. The difference in ionic compositions between the two leads to a time-dependent release of Cl- and Ca2+ ions from the EE (15, 16). ClC type Cl- channels (i.e. ClC-5) are reported to regulate the Cl- movement. They are localized in the EE, and a disruption of the ClC-5 gene causes a dramatic slowing of endocytosis and reduced endosome acidification (17, 18). On the other hand, no study has been reported describing the existence and/or the characteristics of an endosome Ca2+ channel.
To explore such a possibility, a patch clamp study of the native EE membrane is essential; however, the submicron size of and thus lack of direct access to the EE membrane have previously prevented such an approach. We have overcome this difficulty by generating enlarged EE (
3-6 µm in diameter) with the help of a hydrolysis-deficient SKD1/VPS4B (E235Q) (2) in HEK293 cells (3). The SKD1/VPS4B AAA + ATPase regulates membrane trafficking at the early endosome junction between lysosomes and recycling endosomes (2, 3, 19). HEK293 cells expressing SKD1/VPS4B (E235Q) formed enlarged EE vacuoles, which were visible under a phase contrast microscope (Fig. 1C). When the cells were incubated with media containing rhodamine sulfate (Rhod), these enlarged EE accumulated the Rhod (Fig. 1A). This suggests that newly formed primary endosomes continue to fuse to the enlarged EE even after expression of SKD1/VPS4B (E235Q). These Rhod containing enlarged EE were not stained by the acidotrophic dye, Lysotracker Green, even after 40 min of incubation with the Rhod containing solution (Fig. 1B). Some Rhod containing endosomes escaped the SKD1/VPS4B (E235Q) effect and matured to become lysosomes (stained by Lysotracker Green, Fig. 1B, circled). This suggests that SKD1/VPS4B (E235Q) inhibits the maturation of enlarged EE, and thus the enlarged EE do not acquire lysosome-like acidity.
From these results we concluded that these visible large vacuoles represent EE. We then developed a procedure to manually isolate the Rhod containing enlarged EE using a glass pipette (see Fig. 1C). This allowed us to use them for patch clamp studies.
Endosome Cation Channel—The enlarged EE were electrically quiet in the on-endosome and inside-out excised patch clamp configuration. Reports describing changes in the EE luminal Cl- and Ca2+ concentrations show that i) within 60 s of EE formation, luminal Cl- is released to the cytosol (15); and ii) a slow loss of luminal Ca2+ to the cytosol follows (16). For that reason, we explored whether a reduction in [Cl-]lum might affect ECC activity. By reducing chloride concentrations in the bath from 150 to 30 mM, a physiological change in [Cl-]lum was simulated using inside-out EE patches that exposed their luminal surface to bath solution. As we predicted, reducing the bath [Cl-] to 30 mM induced the activation of the ECC (Fig. 2, A and B; 7 out of 8 patches). This Cl--dependent current was inhibited by a common TRP channel blocker, La3+ (n = 6; 0.5-1 mM La3+ inhibited the current to 22 ± 13.3%; Fig. 2, A and B; see also Fig. 3, A and B). To determine the ion selectivity of this channel, ion substitution experiments were carried out. Replacing luminal Na+ with K+ did not shift the reversal potential (Erev); however, replacing K+ with an impermeant cation, NMDG+, resulted in a leftward shift of the Erev, suggesting that this endosome channel was a non-selective cation channel (Fig. 2, C and D). In symmetrical K+ (150 mM) solutions, this channel had a conductance of 50-60 picosiemens (n = 8).
|
illSlope].Chloride Regulation of ECC Activity—To further determine the endosome channel chloride dependence, channel activities were examined in response to varied chloride concentrations (from 150 to 30 mM in 30 mM intervals) (Fig. 2, E and F). The results were subjected to a Hill Plot analysis (Fig. 2G). The K50 for ECC chloride dependence was found to be 82 mM.
The Early Endosome Cation Channel Is Ca2+ Permeable—To demonstrate whether this endosome channel was a Ca2+ channel, Ca2+ permeability was examined. The Erev shifted from 0 mV (150 mM symmetrical K+; n = 8) to -10 + 2 mV, when K+ was replaced with Ca2+ in the bath solution (150 mM K+ pipette/150 mM Ca2+ bath; n = 3). A Ca2+ carrying inward current was clearly seen and was reversibly inhibited by 1.5 mM La3+ (Fig. 3, A and B). From the difference in Erev, the relative calcium permeability (PCa) was determined to be PCa/PK = 1.9 (20) (see Equation 1).
 |
where PK, K+ permeability; F, Faraday constant; T, temperature, Ko; R, gas constants.
|
Acidic pH Activates the Early Endosome Cation Channel—It has previously been shown that the lysosomal cation channel, MCOLN1, (6) and another intracellular cation channel, PKD2, are both inhibited by acidic pH (4, 5). In contrast, as shown in Fig. 3, C and D, ECC activity was enhanced 2-3-fold (n = 3) when the luminal surface of EE excised patch membranes was exposed to pH 5.4 and 6 (the intact EE pH is reported to be 6.2 (8, 9, 15, 21)). Having demonstrated that ECC activity is regulated by both Cl- concentration and pH separately, we next examined how the two together would affect ECC single channel currents (Fig. 3, E and F). Under control conditions (150 mM KCl, neutral pH), ECC activity was rarely seen (open probability, Po = 0.06). Following a change to low Cl- and pH 6 conditions, the single channel current was activated and Po increased to 0.49. Changing the solution to restore Cl- concentration, whereas keeping the pH low, resulted in reduced ECC activity (Po = 0.33). This confirmed that ECC could be activated by lower pH independently of activation by Cl- reduction. Finally, upon returning to neutral pH conditions, the ECC channel current was further inhibited (Po = 0.19).
|
ECC and TRP Channel Pharmacology—Because TRP family channels (22), i.e. growth factor regulated calcium channel (TRPV-2) (13), PKD2 (4, 5), and MCOLN1 (6) are found in intracellular membranes, known TRP inhibitors such as ruthenium red (RuR), amiloride, and La3+ were tested for their ability to affect ECC activity. Inhibition of ECC by 0.5-1 mM La3+ are shown in Figs. 2A and 3A (n = 6). Amiloride (
1 mM) reversibly inhibited ECC activity (50-80% maximum inhibition; Fig. 4, A-C). RuR also reversibly inhibited ECC (70% inhibition with 40 µM) (Fig. 4, D and E). We noticed that the ECC current was potentiated upon application of a low concentration of La3+. Because addition of 100 µM La3+ has previously been shown to potentiate the TRPC5 current (23), the possibility that 100 µM La3+ could act as an ECC activator was examined (Fig. 4, F and G). Before the addition of La3+, ECC activities were relatively quiet and were only induced at negative voltages (Fig. 4F, left). The addition of 100 µM La3+ resulted in the induction of ECC currents. The effect was clearly evident at positive voltages (n = 3; Fig. 4, F (right) and H). Macroscopic ECC currents were also potentiated by 1.5-fold with 100 µM La3+ (3 out of 5 experiments).
To pharmacologically evaluate the identity of ECC, the effect of 2-APB, a specific activator of TRPV1-3 channels (24), was examined. Addition of 200 µM 2-APB further potentiated, by more than 2-fold, ECC currents that had been previously activated by 100 µM La3+ (n = 2; Fig. 4, H and I). The TRPV1-specific activator capsaicin had no effect in concentrations, as high as 5 µM (n = 3) on ECC currents, which still could be activated by 100 µM La3+ (not shown).
TRPV2 Presence in HEK293 Cells—Because the pharmacological characteristics of ECC are closer to those of TRPV2, than those of other known TRP channels (see discussion below), we wanted to know whether TRPV2 was expressed in HEK293 cells. This was examined by RT-PCR of HEK293 total RNA. Primers specific to hTRPV2 detected a signal from transcribed HEK293 total RNA that was identical in size to the control product made from hTRPV2 cDNA (Fig. 4J).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Importance of ECC in Endocytosis—Within 60 s of endocytosis the EE [Cl-]lum is reduced to
20 mM (15). This reduction in the EE [Cl-]lum is likely to be a consequence of the activation of voltage-dependent Cl- channels (25) in the EE membranes (i.e. ClC-5). Negatively charged membrane proteins, which have no effect on a large volume in the extracellular space, can readily affect charge distributions in small primary endosomes (15). These negative charges, which create a Donnan potential in the endosome lumen (15, 21), not only become a driving force for Cl- to exit the endosomes but also affect the direction of the voltage gradient through the membrane. The plasma membrane separates extracellular space (0 mV) from cytosolic space (negative resting membrane potential). After endocytosis, this plasma membrane becomes an endosome membrane and separates the more negatively charged endosomal luminal space from the cytosol (see above and also Fig. 5I). Consequently the charge gradient through the membrane reverses during the endocytosis. Cl- channels in the endosome membrane sense this reversed voltage gradient as an activation stimulus. Masking these negative charges with acidic pH or poly-L-lysine treatment prevented [Cl-]lum reduction (15), suggesting that the Donnan potential could be the cause of chloride channel activation prior to [Cl-]lum reduction. This charge-masking treatment also inhibited acidification of endosomes (15). Significantly reduced endosome acidification and a dramatic slowing of endocytosis were also observed when the ClC-5 endosome chloride channel gene was disrupted (17, 18). Gerasimenko et al. (16) have reported that the luminal-free [Ca2+] falls in acidifying endosomes. Low extracellular Ca2+ (200 µM) significantly inhibited the acidification of endosomes without affecting endocytosis (16), which suggests that acidification of endosomes is also dependent on the efflux of Ca2+ from endosomes. Thus it appears that without a reduction (or efflux) of luminal Cl- and Ca2+, the endosomes do not acidify. Acidification, vesicle fusion, and endosome maturation are closely related (8, 9). Because primary endosomes fuse to early endosomes in a Ca2+-dependent manner, if one assumes that this Ca2+ efflux from the primary endosomes is responsible for the endosome fusion, then the role of the low Cl- and pH-activated ECC in mediating Ca2+ release becomes significant (Fig. 5). One interpretation of this data is that local Ca2+ release through ECC controls endosome fusion and maturation. Reports describing the importance of EE luminal calcium (10-12) and intravesicular calcium release (26) in EE fusion support this notion.
Is ECC the TRPV2 Channel?—TRPV2 was so far the only cation channel protein that was detected in the proteomics study of the rab5 positive early endosomal fraction suggesting its relative abundance in early endosomes. Our RT-PCR experiment detected TRPV2 message in HEK293 cells (Fig. 4J); therefore it is possible that TRPV2 may be responsible for the ECC current. ECC was inhibited by 500 µM to 1 mM La3+, RuR, and amiloride (as are other TRP channels) and was potentiated by acidic pH, 100 µM La3+, and 200 µM 2-APB. TRPV2 was shown to form a heteromultimer with TRPV1 and/or TRPV3 (14). All three TRPV1-3 are potentiated by 2-APB (24). The insensitivity of ECC to capsaicin, a specific TRPV1 activator, eliminates the possibility of TRPV1 involvement in the ECC current. The concentration used for 2-APB was higher than the reported EC50 for both TRPV2 and TRPV3; thus we cannot rule out the involvement of TRPV3. However, the reported biophysical properties of TRPV3 (22) are very different from those of TRPV2. The conductance of TRPV3 (170 picosiemens) is approximately twice as high as that of ECC (50-60 picosiemens), and the Ca2+ selectivity of TRPV3 (PNa/PCa =10) is far larger than that of ECC (PCa/PK = 1.9). Approximately TRPV4-6 are not likely to be the ECC because they are insenitive to 2-APB (24). TRPM6 is another TRP channel that is activated by 2-APB in the µM range (27). However, it is not likely that TRPV2 will form a heteromultimeric channel complex with the structurally distant TRPVM6.
There are no reports of potentiation of TRPV channels by 100 µM La3+, but it has been seen in TRPC4 and TRPC5 (24). Similar to ECC, 100 µM La3+ potentiates TRPC4 and TRPC5, but millimolar concentration of La3+ inhibits them.
Finally the relative Ca2+ permeability of the ECC to K+ or Na+ (PCa/PK = 1.9) was slightly smaller but comparable with that of TRPV2 (PCa/PNa = 2.94) (28). The pharmacological similarity between the ECC and the TRPV2, together with the proteomics study (1), suggests that the ECC is likely a product of the TRPV2 channel or a closely related TRP gene family channel.
In conclusion, the successful patch clamp analysis of genetically enlarged endosomes revealed a novel endosome calcium channel. This approach allows us to examine ion channels in the native membrane environment leading to a better understanding of their physiological role in whole endosome function.
|
FOOTNOTES |
|---|
* This work was supported in part by a grant from the National Institutes of Health (to P. S.) and by the American Cancer Society (to M. S.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 To whom correspondence should be addressed: Dept. of Cell Biology and Physiology, Washington University, 660 S. Euclid Ave., St. Louis, MO 63110; Tel.: 314-362-8702; Fax: 314-362-7463; E-mail: msaito{at}cellbiology.wustl.edu.
2 The abbreviations used are: TRP, transient receptor potential; EE, early endosomes; ECC, endosome calcium channel; 2-APB, 2-aminoethoxydiphenyl borate; [Cl-]lum, endosome luminal chloride ion concentration; RuR, ruthenium red; GFP, green fluorescent protein; RT, reverse transcription; Rhod, rhodamine; I-V, current-voltage.
|
ACKNOWLEDGMENTS |
|---|
We thank Drs. C. Lingle, W. Pearson, L. Salkoff, and A. Wei for helpful discussions and Ms. A. Butler and S. Saito for editing the manuscript.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
- Wainszelbaum, M. J., Proctor, B. M., Pountow, S. E., Stahl, P. D., and Barbieri, A. (2006) Exp. Cell Res. 312, 2238-2251[CrossRef][Medline] [Order article via Infotrieve]
- Fujita, H., Yamanaka, M., Imamura, K., Tanaka, Y., Nara, A., Yoshimori, T., Yokota, S., and Himeno, M. (2003) J. Cell Sci. 116, 401-414
[Abstract/Free Full Text] - Lin, Y., Kimpler, L. A., Naismith, T. V., Lauer, J. M., and Hanson, P. I. (2005) J. Biol. Chem. 280, 12799-12809
[Abstract/Free Full Text] - Gonzalez-Perrett, S., Kim, K., Ibarra, C., Damiano, A. E., Zotta, E., Batelli, M., Harris, P. C., Reisin, I. L., Arnaout, M. A., and Cantiello, H. F. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 1182-1187
[Abstract/Free Full Text] - Gonzalez-Perrett, S., Batelli, M., Kim, K., Essafi, M., Timpanaro, G., Moltabetti, N., Reisin, I. L., Arnaout, M. A., and Horacio, F. (2002) J. Biol. Chem. 277, 24959-24966
[Abstract/Free Full Text] - Raychowdhury. M. K., González-Perrett, S., Montalbetti, N., Timpanaro, G. A., Chasan, B., Goldmann, W. H., Stahl, S., Cooney, A., Goldin, E., and Cantiello, H. F. (2004) Hum. Mol. Genet. 13, 617-627
[Abstract/Free Full Text] - van de Graaf, S. F. J., Chang, Q., Mensenkamp, A. R., Hoenderop, J. G. J., and Bindels, R. J. M. (2006) Mol. Cell. Biol. 26, 303-312
[Abstract/Free Full Text] - Gruenberg, J. (2001) Nat. Rev. Mol. Cell Biol. 2, 721-730[CrossRef][Medline] [Order article via Infotrieve]
- Maxfield. F. R., and McGraw, T. E. (2004) Nat. Rev. Mol. Cell Biol. 5, 121-132[CrossRef][Medline] [Order article via Infotrieve]
- Colombo, M. I., Beron. W., and Stahl, P. D. (1997) J. Biol. Chem. 272, 7707-7712
[Abstract/Free Full Text] - Yan, Q., Sun, W., McNew, J. A., Vida, T. A., and Bean, A. J. (2004) J. Biol. Chem. 279, 18270-18276
[Abstract/Free Full Text] - Holroyd, C., Kistner, U., Annaert, W., and Jahn, R. (1999) Mol. Biol. Cell 10, 3035-3044
[Abstract/Free Full Text] - Kanzaki, M., Zhang, Y. Q., Mashima, H., Shibata, H., and Kojima, I. (1999) Nat. Cell Biol. 1, 165-170[CrossRef][Medline] [Order article via Infotrieve]
- Hellwig, N., Albrecht, N., Harteneck, C., Schultz, G., and Schaefer, M. (2004) J. Cell Sci. 118, 917-928[CrossRef]
- Sonawane, N. D., and Verkman, A. S. (2003) J. Cell Biol. 160, 1129-1138
[Abstract/Free Full Text] - Gerasimenko, J. V., Tepikin, A. V., Petersen, O. H., and Gerasimenko, O. V. (1998) Curr. Biol. 8, 1335-1338[CrossRef][Medline] [Order article via Infotrieve]
- Piwon, N., Gunther, W., Schwake, M., Bosl, M. R., and Jentsch, T. J. (2000) Nature 408, 369-373[CrossRef][Medline] [Order article via Infotrieve]
- Jentsch, T. J., Maritzen, T., and Zdebik, A. A. (2005) J. Clin. Investig. 115, 2039-2046[CrossRef][Medline] [Order article via Infotrieve]
- Babst, M. A. (2005) Traffic 6, 2-9[CrossRef][Medline] [Order article via Infotrieve]
- Fat, P., and Ginsborg, B. L. (1958) J. Physiol. (Lond.) 142, 516-543
[Free Full Text] - Grabe, M., and Oster, G. (2001) J. Gen. Physiol. 117, 329-343
[Abstract/Free Full Text] - Clapham, D. E., Julius, D., Montell, C., and Schultz, G. (2005) Pharmacol. Rev. 57, 427-450
[Free Full Text] - Jung, S., Muhle, A., Schaefer, M., Strotmann, R., Schultz, G., and Plant, T. D. (2003) J. Biol. Chem. 278, 3562-3571
[Abstract/Free Full Text] - Hu, H. Z., Gu, Q., Wang, C., Colton, C. K., Jisen, T., Kinoshita-Kawada, M., Lee, L. Y., Wood, J. D., and Zhu, M. X. (2004) J. Biol. Chem. 279, 35741-35748
[Abstract/Free Full Text] - Steinmeyer, K., Schwappach, B., Bens, M., Vandewalle, A., and Jentsch, T. J. (1995) J. Bio. Chem. 270, 31172-31177
[Abstract/Free Full Text] - Mills, I. G., Urbé, S., and Clague, M. J. (2001) J. Cell Sci. 114, 1959-1965[Abstract]
- Li, M., Jiang, J., and Yue, L. (2006) J. Gen. Physiol. 127, 525-537
[Abstract/Free Full Text] - Caterina, M. J., Rosen, T. A., Tominaga, M., Brake, A. J., and Julius, D. (1999) Nature 398, 436-441[CrossRef][Medline] [Order article via Infotrieve]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Barriere, M. Bagdany, F. Bossard, T. Okiyoneda, G. Wojewodka, D. Gruenert, D. Radzioch, and G. L. Lukacs Revisiting the Role of Cystic Fibrosis Transmembrane Conductance Regulator and Counterion Permeability in the pH Regulation of Endocytic Organelles Mol. Biol. Cell, July 1, 2009; 20(13): 3125 - 3141. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Iwata, Y. Katanosaka, Y. Arai, M. Shigekawa, and S. Wakabayashi Dominant-negative inhibition of Ca2+ influx via TRPV2 ameliorates muscular dystrophy in animal models Hum. Mol. Genet., March 1, 2009; 18(5): 824 - 834. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A.-L. Mahul-Mellier, F. Strappazzon, A. Petiot, C. Chatellard-Causse, S. Torch, B. Blot, K. Freeman, L. Kuhn, J. Garin, J.-M. Verna, et al. Alix and ALG-2 Are Involved in Tumor Necrosis Factor Receptor 1-induced Cell Death J. Biol. Chem., December 12, 2008; 283(50): 34954 - 34965. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Arias-Moreno, A. Velazquez-Campoy, J. C. Rodriguez, M. Pocovi, and J. Sancho Mechanism of Low Density Lipoprotein (LDL) Release in the Endosome: IMPLICATIONS OF THE STABILITY AND Ca2+ AFFINITY OF THE FIFTH BINDING MODULE OF THE LDL RECEPTOR J. Biol. Chem., August 15, 2008; 283(33): 22670 - 22679. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |