Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M704235200 on July 18, 2007

J. Biol. Chem., Vol. 282, Issue 38, 27825-27840, September 21, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/38/27825    most recent
M704235200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gutternigg, M.
Right arrow Articles by Wilson, I. B. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gutternigg, M.
Right arrow Articles by Wilson, I. B. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Biosynthesis of Truncated N-Linked Oligosaccharides Results from Non-orthologous Hexosaminidase-mediated Mechanisms in Nematodes, Plants, and Insects*Formula

Martin Gutternigg{ddagger}, Dorothea Kretschmer-Lubich{ddagger}, Katharina Paschinger{ddagger}, Dubravko Rendic{ddagger}, Josef Hader{ddagger}, Petra Geier{ddagger}, Ramona Ranftl{ddagger}, Verena Jantsch§, Günter Lochnit, and Iain B. H. Wilson{ddagger}1

From the {ddagger}Department für Chemie, Universität für Bodenkultur, Muthgasse 18, Wien A-1190, Austria, the §Abteilung für Chromosomenbiologie, Vienna Biocenter II, Wien A-1030, Austria, and the Institut für Biochemie, Justus-Liebig-Universität, Giessen D-35292, Germany

Received for publication, May 23, 2007 , and in revised form, July 18, 2007.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 REFERENCES
 
In many invertebrates and plants, the N-glycosylation profile is dominated by truncated paucimannosidic N-glycans, i.e. glycans consisting of a simple trimannosylchitobiosyl core often modified by core fucose residues. Even though they lack antennal N-acetylglucosamine residues, the biosynthesis of these glycans requires the sequential action of GlcNAc transferase I, Golgi mannosidase II, and, finally, beta-N-acetylglucosaminidases. In Drosophila, the recently characterized enzyme encoded by the fused lobes (fdl) gene specifically removes the non-reducing N-acetylglucosamine residue from the {alpha}1,3-antenna of N-glycans. In the present study, we examined the products of five beta-N-acetylhexosaminidase genes from Caenorhabditis elegans (hex-1 to hex-5, corresponding to reading frames T14F9.3, C14C11.3, Y39A1C.4, Y51F10.5, and Y70D2A.2) in addition to three from Arabidopsis thaliana (AtHEX1, AtHEX2, and AtHEX3, corresponding to reading frames At1g65590, At3g55260, and At1g05590). Based on homology, the Caenorhabditis HEX-1 and all three Arabidopsis enzymes are members of the same sub-family as the aforementioned Drosophila fused lobes enzyme but either act as chitotriosidases or non-specifically remove N-acetylglucosamine from both N-glycan antennae. The other four Caenorhabditis enzymes are members of a distinct sub-family; nevertheless, two of these enzymes displayed the same {alpha}1,3-antennal specificity as the fused lobes enzyme. Furthermore, a deletion of part of the Caenorhabditis hex-2 gene drastically reduces the native N-glycan-specific hexosaminidase activity in mutant worm extracts and results in a shift in the N-glycan profile, which is a demonstration of its in vivo enzymatic relevance. Based on these data, it is hypothesized that the genetic origin of paucimannosidic glycans in nematodes, plants, and insects involves highly divergent members of the same hexosaminidase gene family.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 REFERENCES
 
The N-linked oligosaccharides of invertebrates and plants display a number of features not observed in those of vertebrates (1); the presence of immunogenic moieties such as core {alpha}1,3-fucose and beta1,2-xylose is widespread in "lower" multicellular organisms, as is the tendency for core modified N-glycans to have mannose residues at the non-reducing termini. These oligosaccharides based on a trimannosyl core (see, e.g. the so-called MM, MMF6, or MMXF3 structures shown in Scheme 1)2 have been named "paucimannosidic" or "truncated" to distinguish them from oligomannosidic, hybrid, and complex N-glycans; particularly the latter are seen as a hallmark of mammals and other vertebrates.

The reactions resulting in the biosynthesis of complex N-glycans in mammals have been well characterized (2) and begin with the transfer of Glc3Man9GlcNAc2 by oligosaccharyltransferase, followed by both removal and addition of glycan residues. As summarized in Scheme 2, key events in mammalian N-glycan biosynthesis are the sequential actions of N-acetylglucosaminyltransferase I (GlcNAc-TI; EC 2.4.1.14 [EC] 3) and Golgi mannosidase II (EC 3.2.1.114 [EC] ), whereby the N-acetylglucosamine residue transferred to the {alpha}1,3-antenna by GlcNAc-TI is retained in the finally processed glycan.

A simplistic explanation of the origin of paucimannosidic glycans in invertebrates and plants would be that truncated glycans, as in some protozoans (3), are transferred by oligosaccharyltransferase. However, it has been shown that plants and insects synthesize the full Glc3Man9GlcNAc2 structure (4, 5). Furthermore, various knock-outs show that normal glycan processing in these species is, as in mammals, dependent on the action of GlcNAc-TI (68). Enzymes dependent on Glc-NAc-TI include Golgi mannosidase II from plants, insects, and nematodes (911), core {alpha}1,3-fucosyltransferases from plants and insects (12, 13), beta1,2-xylosyltransferases from plants, snails, and trematodes (1416), and core {alpha}1,6-fucosyltransferases from invertebrates in general (17). Also, genes encoding GlcNAc-TI and GlcNAc-TII are known to be present in plants, insects, and nematodes (6, 8, 1820). Thus, to explain the "paradox" that the residue transferred by GlcNAc-TI is absent in many of the N-glycans isolated from invertebrates and plants, whereas, e.g. core fucose, is present, the concept of a "processing" hexosaminidase in these lower eukaryotes must be invoked.


Figure 1
View larger version (30K):
[in this window]
[in a new window]

 
SCHEME 1.
Structures of selected glycans referred to in this study. The order of the letters M (mannose), Gn (GlcNAc), and GN (GalNAc) indicates the antenna (the "upper" 1,6 or the "lower" 1,3) on which this sugar is the terminal residue; for modifications of the core F3 indicates a core {alpha}1,3-fucose, F6 a core {alpha}1,6-fucose, F6Gal a galactosylated core {alpha}1,6-linked fucose and, on plant-type glycans, X a beta1,2-linked xylose. GnGn and GnGnF6 represent simple complex biantennary N-glycans, whereas structures with boxed names are referred to as paucimannosidic.

 
Some years ago, a membrane-bound hexosaminidase was enriched from a microsomal fraction of insect cells (21). This enzyme specifically removed the GlcNAc transferred by Glc-NAc-TI; recently, a member of the glycoside hydrolase family 20, encoded by the Drosophila melanogaster fused lobes (fdl) gene was verified to possess such an enzymatic activity and be localized within the secretory pathway (22). A similar activity was also found in Caenorhabditis elegans microsomes (23); on the other hand, plants are assumed to have nonspecific vacuolar hexosaminidases, which trim any terminal GlcNAc residue (24). However, unlike in insects, this trimming does not take place in the Golgi or secretory pathway, and, therefore, secreted plant glycoproteins such as lac-case contain extended structures with "Lewis a" epitopes (25). The genetic origin of the nematode and plant hexosaminidase activities has remained unknown.

To investigate the hexosaminidases of both nematodes and plants (specifically Caenorhabditis elegans and Arabidopsis thaliana) in more detail, we set out to examine their family 20 glycoside hydrolases. A total of five nematode and three plant hexosaminidase cDNAs was engineered for expression of soluble forms of the corresponding proteins in the yeast Pichia pastoris. Whereas two A. thaliana hexosaminidases possessed the expected plant-type "random" specificity for terminal GlcNAc residues, it was found that two members of the novel nematode hexosaminidase subfamily removed specifically the {alpha}1,3-antennal GlcNAc residue from N-glycans. Thus, it appears that non-orthologous members of glycosidase family 20 are responsible for the appearance of paucimannosidic or truncated N-glycans in insects, plants, and nematodes.


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
SCHEME 2.
Putative pathways toward paucimannosidic glycans in nematodes, plants, and insects. Only the major pathways are shown for mammals (which lack paucimannosidic glycans but have especially biantennary complex glycans), nematodes, insects, and plants, as well as pathways that are revealed in strains lacking either Golgi mannosidase II from mammals (mannosidase II/IIx double mutant emybros), nematodes (aman-2), and plants (hgl) and hexosaminidase mutants from nematodes (hex-2; this study) and insects (fdl). Whereas both fucosylated and non-fucosylated paucimannosidic structures naturally dominate in nematodes and insects (especially MM and MMF6), truncated N-glycans in plants carry xylose and fucose residues. The hexosaminidases from nematodes and insects only remove the GlcNAc attached to the {alpha}1,3-antenna, whereas those from plants display no distinct arm preference. On the other hand, core {alpha}1,6-fucosyltransferases from nematodes and insects, core {alpha}1,3-fucosyltransferases from plants and insects, and beta1,2-xylosyltransferases from plants cannot transfer to MM (in some cases, transfer to MGn or Man5Gn has been proven in vitro), whereas the nematode core {alpha}1,3-fucosyltransferase can transfer, at least in vitro, to MM (but not MGn). The action of the hexosaminidases in nematodes, plants, and insects is therefore necessary to explain the range of N-glycan structures observed. No glycans from an insect Golgi mannosidase II mutant or a plant hexosaminidase mutant have yet been analyzed; thus, the in vivo effect of such defects is still unknown.

 

    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 REFERENCES
 
Cloning and Expression of Hexosaminidase Homologues—Total RNA was prepared from a mixed population of C. elegans (wild-type N2) with TRIzol (Invitrogen) reagent and subjected to reverse transcription using Superscript III (Invitrogen) with T18 as primer. Partial reading frames of hexosaminidase cDNAs suitable for soluble expression in P. pastoris were generated by PCR using Expand polymerase with C. elegans cDNA and the primers: CeHex1/1/PstI (aaactgcaggcagagacgacccgga) with CeHex1/2/KpnI (ggggtaccttaaagctctgtcttcgttg), CeHex2/1/PstI (aaactgcaggacatatgacctcatcatacccg) with CeHex2/2/SacII (tccccgcggtcatttcttgattgggaaatgc), CeHex3/1/PstI (aactgcagagttcaaatcgacgacaact) with CeHex3/2/KpnI (gggtacctatgtacaagttttttcgctt), CeHex4/1/PstI (aactgcagccaatgatcgatccagttat) with CeHex4/2/KpnI (gggtacctcaattagtaatctctgttc), and CeHex5/1/PstI (aactgcaggacaaaggtctatagttcattttg) with CeHex5/2/KpnI (ggggtacctcacctccggaaccacg).

For isolation of the full open reading frames, the forward primers CeHex1/5 (atgcgacttttaattcccatac), CeHex2/5 (atgttcccgatgcggtgta), CeHex3/5 (atgcttcgaggttttttcgg), CeHex4/5 (atgcataaaatgtcgaaactc), and CeHex5/5 (atgtgcaacatttttcagattg) were used in conjunction with the aforementioned reverse primers, and the fragments were subcloned into the pGEM-T vector (Promega, Madison, USA) and sequenced.

In the case of the A. thaliana hexosaminidases, partial cDNAs were cloned after reverse transcription-PCR of TRIzol-extracted RNA from the Columbia ecotype with the primers AtHex1/1/EcoRI (cggaattcatagagaggttgaggatt) with AtHex1/2/XbaI (gctctagatcactgagcgagacaagaac), AtHex2/1/EcoRI (cggaattctcgccggctgattctcct) with AtHex2/2/XbaI (gctctagatcactgagcatagcaagagc), and AtHex3/1/EcoRI (cggaattcaacatttggccaaagccg) with AtHex3/2/XbaI (gctctagattattgatcttgaagagcacc).

The cDNA fragments were purified from the PCR reactions using the GFX DNA purification kit (GE Healthcare). Both fragment and vector were digested with the relevant restriction enzymes prior to ligation of the fragments into pPICZ{alpha}B or -C, either in the form purchased from the supplier (Invitrogen) or in a form in which the vector was modified by inverse PCR to include a region encoding a FLAG tag just upstream of the multiple cloning site but downstream of the region encoding the Ste13 signal cleavage site. Ligation products were transformed into Escherichia coli TOP10F' prior to selection on zeocin, plasmid preparation, and sequencing. The expression vectors were linearized and transformed into P. pastoris (GS115 strain), colonies were selected on Zeocin, and expression was performed with methanol induction at 16 or 30 °C as previously described (26). N-terminally FLAG-tagged forms of the C. elegans hexosaminidases HEX-1, HEX-3, and HEX-4 were detectable after Western blotting using the anti-FLAG M2 monoclonal antibody (1:10,000) and alkaline phosphatase-conjugated anti-mouse IgG (1:10,000).

In Silico Analysis—The in silico analysis of protein sequences was performed using the DIALIGN alignment program at the BibiServ server of the Universität Bielefeld (27) using default parameters.

Hexosaminidase Assays—Total nematode extracts were prepared as previously described from wild-type or mutant C. elegans (28), whereas the microsomal preparation resulted from a low percentage Triton wash of wild-type nematode membranes followed by high speed centrifugation (23). Crude supernatants of P. pastoris expressing recombinant C. elegans and A. thaliana hexosaminidases, as well as ammonium sulfate fractions (between 50 and 90% saturation) of these supernatants, were also assayed using a range of enzymatic assays. The majority of the recombinant enzymes were stable for several months at either 4 °C or -80 °C but not at -20 °C. A supernatant of Pichia expressing C. elegans Golgi mannosidase II was prepared during a previous study (10).

For the standard assay with p-nitrophenylglycosides, 5 µl of sample was incubated in a microtiter well with 25 µl of McIl-vaine citrate-phosphate buffer (pH 3.5–8.0), 2.5 µl of 100 mM p-nitrophenylglycoside in Me2SO, and 17.5 µl of water for 1 h at 37 °C; in some cases, diluted enzyme was used to attain linear substrate turnover over a period of up to 2 h. The reaction was stopped by addition of 250 µl of 0.4 M glycine-NaOH, pH 10.4, and the A405 was read using an enzyme-linked immunosorbent assay plate reader. Three hexosaminidase inhibitors were employed in this study: N-acetylcastanospermine (6-acetamido-6-deoxycastanospermine, Industrial Research Ltd., New Zealand), 2-acetamido-1,2-dideoxynojirimycin (2-acetamido-1,2,5-trideoxy-1,5-imino-D-glucitol, the kind gift of Dr. Arnold Stütz), and O-(2-acetamido-2-deoxy-D-glucopyranosylidene)amino N-phenylcarbamate (PUGNAc,3 Toronto Research Chemicals, Canada). For oligosaccharide substrates, dabsylglycopeptides (0.25 nmol) or pyridylaminooligosaccharides (0.1 nmol) were used. The incubation mixture was then subject to either MALDI-TOF MS (dabsyl) or RP-HPLC (pyridylamino) as previously described (10). The dabsyl-betaGNbetaGN substrate was prepared using a dabsylated fibrin glycopeptide remodeled sequentially with sialidase, galactosidase, and finally bovine milk beta1,4-galactosyltransferase, using UDP-GalNAc as donor (29). For an explanation of the abbreviations for the glycan substrates, see Scheme 1.

Analyses of Wild-type and Mutant GlycansN-Glycans were prepared by peptide:N-glycosidase A-mediated release from peptic peptides, and a portion of each preparation was subject to pyridylamination, RP-HPLC, and MALDI-TOF MS (28, 30). Pyridylaminated glycans of the tm2350 mutant were also subject to single or double enzymatic digestions with recombinant Streptococcus beta-hexosaminidase (Sigma, 50 milliunits, using the manufacturer's reaction buffer), bovine kidney {alpha}-fucosidase (Sigma, 15 milliunits, in 50 mM ammonium acetate, pH 5), or Aspergillus beta1,4-galactosidase (27 milliunits, in 50 mM sodium citrate, pH 4.6) further purified from a cruder commercial preparation (31), prior to re-analysis by RP-HPLC. Glycans were analyzed by MALDI-TOF MS (Ultraflex Tof/Tof, Bruker-Daltonics, Bremen, Germeny) using a 6-aza-2-thiothymine matrix (5 mg/ml 6-aza-2-thiothymine in H2O) either in the MS or MS/MS mode. Normally 100–500 shots were summed. For external calibration, a peptide standard mixture (Bruker) was used.

Tissue-specific Promoter Analysis—The 2000 bp upstream of the ATG start codon of each C. elegans hex gene was isolated by PCR from genomic DNA using Expand polymerase and the following primer pairs: CeHex1/prom3/BamHI (cgggatcctaatcataataaggcttcgaac) with CeHex1/prom4/BamHI (cgggatccatcaccttaacttcatagatg), CeHex2/prom5/BamHI (cgggatccggcaattttatgatctatggta) with CeHex2/prom6/BamHI (cgggatccatttttttacatttgaggctaa), CeHex3/prom1/BamHI (cgggatccgagtatcacttcccgtcc) with CeHex3/prom2/BamHI (cgggatccatggcgacgtttattgca), CeHex4/prom11/BamHI (cgggatccggtttgccgttaacgttt) with CeHex4/prom8/BamHI (cgggatccattattgtatttgtattgtacaa), and CeHex5/prom9/BamHI (cgggatcctggaatttccatagcctg) with CeHex5/prom10/BamHI (cgggatccataatcataatcaaaaaagattaaa).

The reporter plasmid used was a modified form of the pPD95.67 (L2459) promoterless gfp vector modified, as previously described (10), by insertion of a HindIII/XbaI fragment carrying the unc-119 gene into its multiple cloning site to generate pPD95.67/unc-119. PCR fragments and the vector were digested with BamHI and ligated. Selected clones were sequenced and verified to contain the expected upstream regions in the correct orientation and were used to transform unc-119 (ed3) mutants with a particle gun (Bio-Rad). Individuals from integrated lines were examined by confocal laser scanning microscopy (Leica TCS SP2) with argon laser excitation at 488 nm and emission 500–540 nm using an HC Plans 10x/25 occular and HC PL Fluotar 63x/0.30 objective.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 REFERENCES
 
Identification of Hexosaminidase Homologues in C. elegans and A. thaliana—Examination of the genome of C. elegans allows prediction of five putative hexosaminidases (T14F9.3, C14C11.3, Y39A1C.4, Y51F10.5, and Y70D2A.2), which we define as HEX-1, HEX-2, HEX-3, HEX-4, and HEX-5, respectively. These proteins have been defined in the CAZy data base (32) as being members of glycoside hydrolase family 20; based on actual cloning of the cDNAs, they are predicted to be of Mr 55,000–70,000 and contain potential N-glycosylation sites. Indeed, HEX-1 was proven in a large survey of glycoproteins to be glycosylated at positions 351 and 460, whereas HEX-5 is glycosylated in vivo at position 218 (33, 34). HEX-2, HEX-3, and HEX-5 also have dibasic motifs just N-terminal of the single hydrophobic domain, suggestive of a Golgi localization or, at least, export from the endoplasmic reticulum (35), whereas HEX-1 has a C-terminal KTEL sequence, which could, of course, be a variant of the typical endoplasmic reticulum (KDEL) retrieval sequence.

The three A. thaliana hexosaminidase sequences identified in this study were previously included in the CAZy data base (36); we hereby define them as AtHEX1 (At1g65590), AtHEX2 (At3g55260), and AtHEX3 (At1g05590). All three genes encode proteins of Mr ~ 60,000 with five predicted, generally non-conserved, N-glycosylation sites and N-terminal hydrophobic regions, which may constitute signal sequences or transmembrane domains; AtHEX2 has been identified in a proteomic study as being a vacuolar resident (37), whereas both AtHEX1 and AtHEX3 are predicted by the WoLF PSORT program to have a vacuolar localization. AtHEX1 and AtHEX2 are 51% identical at the amino acid level, whereas AtHEX3 is more distantly related and displays only 29% identity to AtHEX1. Interestingly, the rice genome contains not only two genes homologous to the AtHEX1/AtHEX2 "pair" but also two genes homologous to AtHEX3.

The Hexosaminidase Family 20 Has Two Major Branches—To align the hexosaminidase-related protein sequences from a variety of species, which appear not to be globally related but are only similar to one another in certain, narrow regions, the DIALIGN alignment program (27) had to be employed. Standard alignment algorithms (e.g. ClustalW using BLOSUM30 or PAM matrices) under a variety of conditions failed to align the conserved regions of the sequences. Using DIALIGN, a His/Asn-Xaa-Gly-Ala/Cys/Gly/Met-Asp-Glu-Ala/Ile/Leu/Val sequence was found in all sequences (see Fig. 1A). The glutamate residue of this motif corresponds to the general acid/base involved in the catalytic mechanism of hexosaminidases (38).

The phylogenetic analysis (Fig. 1B) suggests that the nematode HEX-1 belongs to the same sub-family as the human lysosomal {alpha} and beta subunits and the plant AtHEX1, AtHEX2, and AtHEX3; this sub-family also includes three sequences (Hexo1, Hexo2, and Fdl) from D. melanogaster (22) as well as ascomycete hexosaminidases such as Penicillium NagA (39). Indeed, C. elegans HEX-1 and AtHEX1 display 36–38% identity over ~500 residues to the human hexosaminidase {alpha} and beta subunits, respectively. On the other hand, the other four C. elegans hexosaminidase homologues (see also supplemental data for an alignment) can be grouped together with one sequence each from D. melanogaster, mouse, and man; members of this subfamily poorly align with the human and plant sequences. The six selected bacterial sequences, such as the well studied Streptomyces plicatus SpHex (40), also clearly associate with one or the other subfamily (Fig. 1A), suggestive of an ancient origin for the two branches.

Expression of Recombinant Caenorhabditis and Arabidopsis Hexosaminidase Homologues—cDNA fragments encoding the putative luminal domains of each C. elegans and A. thaliana hexosaminidase homologue (i.e. lacking putative cytosolic and transmembrane domains) were engineered into Pichia expression vectors as non-tagged and/or FLAG-tagged forms. In the case of the nematode HEX-1, HEX-3, and HEX-4, both Coomassie staining and anti-FLAG Western blotting of crude supernatants and ammonium sulfate fractions indicated expression of proteins of Mr 80,000, 70,000, and 55,000, respectively; HEX-2 was only ever detected after SDS-PAGE by Coomassie staining (Mr ~ 60000), and it was considered possible that the FLAG tag was removed by proteolysis, potentially at dibasic sites in the stem region. The expression of HEX-5 was, however, apparently below the detection limits of Western blotting and Coomassie staining, although a number of independent clones reproducibly showed an activity absent from control "empty vector" supernatants. AtHEX1, AtHEX2, and AtHEX3 were seen as FLAG-tagged bands of ~Mr 65000 in either 50% or 70% ammonium sulfate fractions of the supernatants of recombinant yeast (data not shown).

The initial enzymatic tests were performed with artificial chromogenic substrates (p-nitrophenyl-beta-N-acetylgalactosaminide and p-nitrophenyl-beta-N-acetylglucosaminide) and showed that the homologues were indeed enzymatically active and that no enzyme activity was present in the supernatants of Pichia transfected with empty vector. Whereas HEX-1 was approximately equally active toward both substrates, HEX-2, HEX-3, HEX-4, and HEX-5 were most active (or only active) toward p-nitrophenyl-beta-N-acetylgalactosaminide (see also Fig. 2); the latter hexosaminidases are, indeed, other than the Streptococcus pneumoniae StrH enzyme (41), the first members of a new sub-division of family 20 to be enzymatically studied. The Km value of HEX-1 for p-nitrophenyl-beta-N-acetylglucosaminide was estimated to be 1.1 mM, which can be compared with a previously reported value of 0.45 mM with 4-methylumbelliferyl-beta-N-acetylglucosaminide for a hexosaminidase activity in crude C. elegans extracts (42). The plant hexosaminidases AtHEX1, AtHEX2, and AtHEX3 were active with p-nitrophenyl-beta-N-acetylglucosaminide as substrate (see also Fig. 3) but displayed only a minor activity toward p-nitrophenyl-beta-N-acetylgalactosaminide (data not shown).

Effects of pH and Inhibitors on Recombinant Hexosaminidase Activities—Using the artificial p-nitrophenyl substrates, the activities of the recombinant C. elegans HEX-1, -2, -3, -4, and -5 were compared with the activity in native C. elegans extract in terms of pH optimum within the linear range of product formation with respect to time. As measured in the presence of McIlvaine buffers, C. elegans HEX-1 to HEX-4 have pH optima of pH 5.5–6.5 (Fig. 2, A and B), whereas HEX-5 was most active at pH 4.5 (only with p-nitrophenyl-beta-N-acetylgalactosaminide (Fig. 2B)). The pH dependence curve for the activity in native extract followed most closely that of recombinant HEX-1. In comparison, the Arabidopsis hexosaminidases had optimal activity at pH 4–5 (Fig. 3A); according to the literature, the well known jack bean hexosaminidase has optimal activity at pH 5 with a citrate buffer (43).

Three inhibitors specific for hexosaminidases were employed with the nematode enzymes: N-acetylcastanospermine, 2-acetamido-1,2-dideoxynojirimycin, and PUGNAc. For the first compound IC50 values of 0.4–1.6 µM have been reported with jack bean and various animal hexosaminidases (44), whereas for the latter two, respective Ki values of 140–600 µM and 0.1 µM have been reported (45, 46). N-Acetylcastanospermine and 2-acetamido-1,2-dideoxynojirimycin were previously both found to inhibit the Drosophila Fdl processing hexosaminidase (22). However, whereas HEX-2, -3, -4, and -5 did not show sensitivity to any of these inhibitors at the concentrations used (up to 0.4 mM), only the activity of HEX-1 and of the native worm p-nitrophenyl-beta-N-acetylhexosaminidase activity was particularly affected when using 5 mM p-nitrophenyl substrates (for results with N-acetylcastanospermine using p-nitrophenyl-beta-N-acetylgalactosaminide as substrate, see Fig. 2C). The Ki values of HEX-1 for N-acetylcastanospermine (5 µM), 2-acetamido-1,2-dideoxynojirimycin (1 mM), and PUGNAc (2 µM) were estimated using Dixon plots.

Finally, the three recombinant plant enzymes were tested for their sensitivity toward N-acetylcastanospermine and particularly AtHEX1 and AtHEX2 were found to be inhibited (see Fig. 3B). AtHEX1 was also tested for its sensitivity to 2-acetamido-1,2-dideoxynojirimycin and PUGNAc; ~50% inhibition with the former was achieved at 0.2 mM and 90% with the latter at 0.1 mM (data not shown). Overall, therefore, the inhibition data (i.e. the lack of inhibition of HEX-2, -3, -4, and -5 as compared with other hexosaminidases) indicate a distinct functional difference between the two major sub-families of the class 20 glycoside hydrolases, which reflects the aforementioned divergence at the primary structural level.

Activity of Caenorhabditis and Arabidopsis Hexosaminidase toward Glycan Substrates—The various hexosaminidases were tested with typical N-glycan substrates. Under the conditions used, C. elegans HEX-2 was able to remove three HexNAc residues from the biantennary dabsylglycopeptide betaGNbetaGN, which carries non-reducing terminal GalNAc residues (see Scheme 1 for structure). On the other hand, HEX-4 and HEX-5 removed only up to two HexNAc residues from betaGNbetaGN, whereas HEX-3 did not detectably cleave residues from this substrate (Fig. 4). Of the five enzymes, only HEX-2 and HEX-3 cleaved one residue from the asialoagalactodabsylglycopeptide GnGn (see supplemental data). In contrast, HEX-1 cleaved no residues from either betaGNbetaGN or GnGn even after extended incubation times of up to 3 days.


Figure 3
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 1.
Alignment and phylogenetic analysis of class 20 hexosaminidase sequences. A, alignment of the region surrounding the His/Asn-Xaa-Gly-Ala/Cys/Gly/Met-Asp-Glu-Ala/Ile/Leu/Val motif conserved in all class 20 hexosaminidases; B, phylogenetic tree analysis of class 20 hexosaminidases showing the division into two major subfamilies, one including the novel C. elegans hexosaminidases examined in this study and the other including previously studied human, fungal, and insect hexosaminidases. The following protein sequences were analyzed by DIALIGN and Treeview programs: MmHexD, M. musculus hexosaminidase homologue D; CeHex1–5, C. elegans hexosaminidases 1–5; OiHex, Oceanobacillus iheyensis hexosaminidase homologue; CpHex, Clostridium perfringens hexosaminidase; SpmHex, Streptococcus pneumoniae StrH hexosaminidase; AtHex1–3, A. thaliana hexosaminidases 1–3; OsHex 1–4, O. sativa (rice) hexosaminidase homologues 1–4; NagA, Penicillium chrysogenum hexosaminidase; CpoHex, Coccidioides posadasii hexosaminidase; AoHexA, Aspergillus oryzae hexosaminidase; TnHEX, Trichoplusia ni hexosaminidase; HsHEXA/B, H. sapiens hexosaminidases A/B; DmFDL, D. melanogaster Fdl hexosaminidase; DmHEXO1/2, D. melanogaster hexosaminidases 1/2; DmHEX4, D. melanogaster hexosaminidase homologue 4; SfHEX1/2, S. frugiperda hexosaminidases 1/2; SpHEX, Streptomyces plicatus hexosaminidase; EsHEX, Enterobacter sp. Hexosaminidase; and CfHEX, Cellulomonas fimi hexosaminidase.

 


Figure 4
View larger version (46K):
[in this window]
[in a new window]

 
FIGURE 2.
Enzymatic properties of Caenorhabditis class 20 hexosaminidases. A, pH dependence of activity toward p-nitrophenyl-beta-N-acetylglucosaminide (pNP-GlcNAc) of native and recombinant C. elegans hexosaminidases assayed at 37 °C over a 1-h period using a range of McIlvaine buffers. B, pH dependence of activity toward p-nitrophenyl-beta-N-acetylgalactosaminide (pNP-GalNAc) of native and recombinant C. elegans hexosaminidases assayed at 37 °C over a 1-h period using a range of McIlvaine buffers. C, sensitivity of native and recombinant C. elegans hexosaminidases assayed at 37 °C over a 1-h period at optimal pH using p-nitrophenyl-beta-N-acetylgalactosaminide as substrate and various concentrations of N-acetylcastanospermine as potential inhibitor. Crude culture supernatants of yeast transformed with hex partial open reading frames (1:10 diluted in the case of hex-1 and hex-2) or an extract of wild-type N2 worms were used as the enzyme sources; in all cases, data were recalculated with the condition yielding the highest absorbance at 405 nm with p-nitrophenyl-beta-N-acetylgalactosaminide as substrate being normalized to 100%.

 
To determine the specificity of HEX-2 and HEX-3 further, pyridylamino-GnGn was used as a substrate; digestion of GnGn to either MGn or GnM is associated with diagnostic differences in retention time when using RP-HPLC (47). A shift in the retention time to that indicative of GnM, but not of MGn, was observed with both HEX-2 and HEX-3 (Fig. 5A). The specific cleavage by HEX-2 and HEX-3 of GnGn to GnM is a property shared with the D. melanogaster FDL hexosaminidase and with an activity in native worm extracts (see below); HEX-1, HEX-4, and HEX-5 did not digest this substrate. In contrast, AtHEX1 and AtHEX2 displayed no distinct preference for a specific terminal GlcNAc residue and indeed cleaved GnGn to a mixture of products (i.e. overnight to MGn, GnM, and MM (Fig. 5A)), as is also the case with Sf9 hexosaminidases (48, 49).


Figure 5
View larger version (31K):
[in this window]
[in a new window]

 
FIGURE 3.
Enzymatic properties of Arabidopsis class 20 hexosaminidases. A, pH dependence of activity toward p-nitrophenyl-beta-N-acetylglucosaminide (pNP-GlcNAc) of recombinant A. thaliana hexosaminidases assayed at 37 °C over a 1-h period using a range of McIlvaine buffers. B, sensitivity of recombinant A. thaliana hexosaminidases assayed at 37 °C for 1 h at optimal pH using p-nitrophenyl-beta-N-acetylglucosaminide as substrate and various concentrations of N-acetylcastanospermine as potential inhibitor. Ammonium sulfate fractions of yeast culture supernatants were used as enzyme sources (70% saturation for AtHEX1 and AtHEX2, 50% saturation for AtHEX3).

 
To reproduce a potential in vivo pathway, Man5Gn was incubated with recombinant C. elegans mannosidase II together with HEX-2, -3, or -4. Although the mannosidase II digested the Man5Gn to MGn, only incubation with HEX-2 or HEX-3 resulted, as shown by co-elution with a known standard, in further digestion to MM (Fig. 5B); indeed, the digestion in these two cases was complete. On the other hand, in the absence of mannosidase II, HEX-2 and HEX-3 did not digest Man5Gn, whereas incubation of this substrate with AtHEX1 resulted in the appearance of Man5.


Figure 6
View larger version (15K):
[in this window]
[in a new window]

 
FIGURE 4.
Assay of recombinant Caenorhabditis hexosaminidases with a dabsylated GalNAc-modified biantennary N-glycopeptide substrate. Culture supernatants of yeast expressing C. elegans HEX-1, -2, -3, -4, or -5 were incubated overnight at 37 °C with dabsyl-betaGNbetaGN (m/z 2468) and analyzed by MALDI-TOF MS. Laser-induced degradation of the dabsyl moiety results in a loss of m/z 132 (species indicated by an asterisk), whereas loss of m/z 203 corresponds to removal of one HexNAc residue; corresponding data for GnGn is shown as supplemental data. The volume of culture supernatant added was equal in each case: approximately three-times more HEX-1 than HEX-4 and ten-times more HEX-1 than HEX-3 was present, as measured by enzyme-linked immunosorbent assays with anti-FLAG, whereas as judged by Coomassie staining the amounts of HEX-1 and HEX-2 are approximately equal; HEX-5 was not detected by enzyme-linked immunosorbent assay or Coomassie staining. Extended incubation times (3 days) verified that a total of three HexNAc residues were removed by HEX-2, whereas HEX-4 and HEX-5 never removed more than two residues and that the spectrum with HEX-3 was unchanged in comparison to that shown. In comparison, commercial jack bean hexosaminidase removes four HexNAc residues from this substrate. The two glycan structures are depicted according to the nomenclature of the Consortium for Functional Glycomics.

 
In the tests with dabsylated or pyridylaminated N-glycan substrates, C. elegans HEX-1 and AtHEX3 displayed no obvious activity; thus, we considered the possibility that other GlcNAc-containing compounds may be substrates. In these tests, chitotriose-PA was digested almost completely overnight by a 50% ammonium sulfate fraction of a supernatant yeast expressing AtHEX3 and by C. elegans microsomes as well as, to a lesser extent, by a supernatant of yeast expressing C. elegans HEX-1 (Fig. 5C). Supernatants from other recombinant or control yeast showed no or low chitotriosidase activity.

Native Hexosaminidases in Wild-type and Mutant Caenorhabditis Extracts—In the course of our previous studies assaying core fucosyltransferase activity in crude worm extracts, we noticed a significant hexosaminidase activity at pH 6 when using GnGn or GnGnF6 with a preference also for the {alpha}1,3-arm (see also Fig. 6A). As discussed above in connection with recombinant HEX-2 and HEX-3, this specificity is reminiscent of the one determined to be present in microsomal membrane fractions of insect cells and of recombinant fruit fly FDL (21, 22). However, previous studies on C. elegans suggested that only M4Gn and MGn were substrates for a microsomal hexosaminidase (23). In preliminary trials, preparing the same type of Triton-washed microsomal fraction, however, did not result in observing any difference in the specificity; this procedure merely removed the low level of activity, which results in the presence of MM in the incubations. As with HEX-2 or HEX-3 when using GnGn-PA as a substrate, the native GnGn-digesting activity was reduced by 80% in the presence of 200 µM N-acetylcastanospermine and had an optimum at pH 5.5 (data not shown).

To prove more directly, than by the use of recombinant enzymes, whether our hypothesis as regards the in vivo functions of HEX-2 and HEX-3 was correct, mutants carrying deletions in selected C. elegans hexosaminidase genes were obtained, and these were analyzed for changes in enzyme activities and N-glycan structure. None of these mutants displayed obvious and consistent biological defects under standard laboratory conditions, a situation reminiscent of other C. elegans glycomutants (8, 10), but alterations in enzymatic activities were observed.

The hex-1 (tm1992) mutant had a normal ability to digest GnGn to GnM (Fig. 6A). On the other hand, this mutant displayed no chitotriosidase activity (Fig. 6C) and a much reduced ability to degrade p-nitrophenyl-beta-N-acetylglucosaminide (data not shown). Thus, considering the properties of recombinant HEX-1, it is concluded that this enzyme is both the major p-nitrophenylhexosaminidase and the major chitotriosidase in the worm; on the other hand, despite its relationship to fruit fly FDL, it has no obvious role in N-glycan processing.

The hex-2 (tm2350) mutant was of particular interest, because, of the four "novel" worm hexosaminidases, the corresponding gene is the one with the most ubiquitous expression (see below). Also, as mentioned above, recombinant HEX-2 displayed the ability to specifically degrade GnGn to GnM as well as aid, in the presence of mannosidase II, the processing of Man5Gn to MM. Incubation of the extract of the hex-2 mutant with glycan substrates showed a greatly reduced activity toward GnGn (Fig. 6A) and a block in the processing of Man5Gn to MM, with only the products of mannosidase II (Man4Gn and MGn) being significantly present in the incubations (Fig. 6B). The latter HPLC elution data were verified by MALDI-TOF MS of the pooled fractions as shown by the presence of species with m/z 1214.497, 1376.584, and 1538.636, which correspond to pyridylaminated [M+Na]+ forms of MGn, Man4Gn, and Man5Gn. In contrast, the hex-2 mutant extract displayed normal activity toward chitotriose (Fig. 6C). The normal chitotriosidase and mannosidase II activities were considered to be an indication that only the N-glycan processing hexosaminidase was affected by the deletion. We, therefore, conclude that HEX-2 is an enzyme responsible for part of the specific hexosaminidase-mediated degradation of N-glycans observed in native nematode extracts in vitro.


Figure 7
View larger version (20K):
[in this window]
[in a new window]

 
FIGURE 5.
Assay of recombinant Caenorhabditis and Arabidopsis hexosaminidases with pyridylaminated oligosaccharide substrates. Culture supernatants of yeast expressing C. elegans hexosaminidases or mannosidase II andammoniumsulfate-fractionatedsupernatantsofyeastexpressingA. thaliana hexosaminidases were incubated for 20 h at 37 °C using pyridylaminated forms of GnGn, Man5Gn, or chitotriose prior to RP-HPLC using a gradient of 4.2–5.7% methanol over 15 min. A, assays with GnGn-PA as substrate showing that only HEX-2 and HEX-3 displayed the activity specifically converting GnGn to GnM (as shown by the shift to higher retention time), whereas AtHEX1 and AtHEX2 converted GnGn into a mixture of MGn, MM, and GnM. B, assays with Man5Gn-PA as substrate showing that conversion of Man5Gn to MM requires the action of both C. elegans mannosidase II (AMAN-2) and either HEX-2 or HEX-3; AMAN-2 alone catalyzed the shift to MGn, but HEX-2 and HEX-3 did not catalyze a shift to Man5, whereas AtHEX1 was capable of the latter reaction. C, assays with chitotriose-PA showing that HEX-1 and, especially, AtHEX3 catalyze the conversion of chitotriose to a species of lower retention time.

 
N-Glycans of Hexosaminidase Mutants—The effects of deletions within hexosaminidase genes on the worm N-glycome were also appraised; considering the results of the enzymatic assay data, it was assumed that the hex-2 mutant would show an altered N-glycan profile. Indeed, even though paucimannosidic glycans still dominated the MALDI-TOF MS spectrum of glycans derived from the hex-2 mutant, species with the composition Hex3–4HexNAc3Fuc1–2 were present either in greater amounts than in the N2 wild-type or were novel to hex-2 worms (Fig. 7, compare A and B; see also Table 1).


View this table:
[in this window]
[in a new window]

 
TABLE 1
Summary of MS data for pyridylaminated glycans from the N2 and tm2350 strains Monoisotopic m/z values [M+H+] from the spectra presented in Fig. 7 and the corresponding hypothesized compositions are shown for pyridylaminated peptide N-glycosidase F A-released N-glycans from wild-type N2 and mutant hex-2 tm2350 strains. Abundances for detected glycans refer to percentage intensities relative to the peak of highest intensity (m/z 989). ND, not detected; NR, not resolved (the isotopic distribution of a neighboring strong signal does not allow any potential Fuc1Hex3HexNAc3PC1 to be distinguished). In the hex-2 tm2350 strain, small amounts of novel structures with extra HexNAc or HexNAcPC moieties appear; the relative amounts of Hex3HexNAc3, Fuc1Hex3HexNAc3 and Fuc1Hex4HexNAc3 are much increased in keeping with the proposed role of C. elegans HEX-2 as a processing hexosaminidase.

 
A further comparison was made with RP-HPLC analysis of the pyridylaminated glycans from N2 wild-type, the hex-1 mutant (tm1992), two hex-2 mutants (tm2350 and VC1278), and a hex-3 mutant (tm2725). These analyses showed that both hex-2 mutants had similar glycan profiles and verified the appearance of peaks (designated G and H) absent from the wild-type, hex-1, and hex-3 chromatograms (Fig. 8). Digestions of the "whole N-glycome" of the tm2350 mutant with glycosidases were then performed. Particularly, a peak eluting at 24 min (peak G) was considered to be specific to the hex-2 profile; the major species in this peak was of m/z 1500, which would correspond to Fuc1Hex4HexNAc3-PA. This peak was not sensitive to fucosidase digestion alone; however, incubation with beta1,4-galactosidase and either fucosidase or hexosaminidase resulted in a shift to peaks of lower retention time (peaks with the same retention times as MGn and MMF6 were, respectively, increased). Thus, our model was that peak G contains mainly an MGnF6 glycan carrying a beta1,4-linked galactose (MGnF6Gal; see Scheme 1) on the core fucose residue, akin to a "complex core modification" found by Reinhold and co-workers in wild-type C. elegans (50) and by others on squid rhodopsin (51) and keyhole limpet hemocyanin (52). This presumption was confirmed by MALDI-TOF MS/MS (Fig. 9A), which resulted in the presence of a fragment of m/z 607, consistent with a Gal-Fuc-GlcNAc-PA structure. Another component of peak G with the composition Fuc2Hex4HexNAc3-PA was also examined by MS/MS (Fig. 9C), but no unambiguous assignment of the position of the second fucose was possible; the second fucose may either be on the terminal mannose or "second" core GlcNAc residue, as seen for other structures in previous reports on nematode glycans (50, 53). Finally, a putatively methylated form of MGnF6Gal eluting at 28 min (m/z 1514; peak H) was also sensitive to hexosaminidase and galactosidase digestion. Due to the presence of fragments corresponding to Hex3HexNAc3Me1-PA and Hex2HexNAc3-PA, it is hypothesized that the methyl group is attached to the unsubstituted non-reducing mannose residue (Fig. 9B). Such a modification of mannose by a methyl group has been reported for gastropod paucimannosidic N-glycans (54).


Figure 8
View larger version (16K):
[in this window]
[in a new window]

 
FIGURE 6.
Assay of mutant and wild-type Caenorhabditis extracts with pyridylaminated oligosaccharide substrates. A, extracts (8 µg, as measured by Pierce micro BCA protein assay) of wild-type (N2), hex-1 (tm1992), and hex-2 (tm2350 or VC1278) worms were incubated overnight with GnGn-PA prior to RP-HPLC and detection by fluorescence; conversion to GnM-PA was barely detected in the hex-2 extracts and the similar "biochemical phenotype" of these two independently isolated mutants indicates a role for HEX-2 as the major processing hexosaminidase in C. elegans. B, extracts of N2 or tm2350 worms were incubated overnight with Man5Gn-PA prior to RP-HPLC; although the tm2350 extract converts Man5Gn to Man4Gn and MGn (as verified by MALDI-TOF MS and indicative that mannosidase II activity is not affected by the mutation), conversion of these intermediates to MM by a hexosaminidase was relatively minor. C, extracts of N2, tm1992, or tm2350 worms were incubated overnight with chitotriose-PA prior to RP-HPLC; the result with the tm1992 extract is indicative that deletion of part of the hex-1 gene results in an abolition of chitotriosidase activity.

 
Overall, it is concluded that glycans with non-reducing terminal N-acetylhexosamine residues, absent from the wild-type, are present in hex-2 worms, consistent with the proposed enzymatic function of the corresponding gene product. The remaining hexosaminidase activity (as measured with GnGn in vitro; see above), however, may still be sufficient to account for the presence of MM and MMF6 glycans in the hex-2 worm and, on the basis of the data with recombinant enzymes, is putatively due to HEX-3. In the future the effect of double mutants should be appraised to make final conclusions as to the relative contribution of the different GnGn-digesting hexosaminidases toward the wild-type nematode N-glycan spectrum.

Differential Expression of Nematode Hexosaminidase Promoters—Considering the multiplicity of hexosaminidases in C. elegans, it was sought to examine whether they are expressed temporally and spatially in a differential manner. Therefore, promoter gfp reporter constructs were generated, which contained, in each case, the ~2000 bp upstream of the start codon. These vectors, containing a copy of the unc-119 gene, were stably integrated into unc-119(ed3) mutants. Confocal microscopy of at least two independent lines for each gene showed a range of locations for the expression of these constructs. The hex-1 promoter was particularly active in coelomocytes as well as in neurons of the pharyngeal region and nerve cord (Fig. 10, A and B), as compared with the head and tail pattern observed in strain BC14144 (also carrying a hex-1::gfp construct) as part of a large-scale screen (55). The hex-2::gfp construct appeared to be active in the hypodermal cells, vulval toroids, and various adult head and tail neurons (Fig. 10, C–F), whereas the hex-3 construct was expressed in gut granules (Fig. 10G). The hex-4::gfp line displayed staining of seam cells in late embryos and L1 larvae (Fig. 10, H and I). Expression of hex-5 was restricted to certain cells at the 3-fold stage but was also present in the vulval, head (muscle), and tail regions in larval and adult worms (Fig. 10, J and K). Of the five promoters, hex-1, hex-2, hex-3, and hex-5 were expressed throughout the life-cycle, whereas hex-4 was restricted to the embryonal and L1 stages. Thus, to varying degrees, the results with these gfp constructs were indicative of both temporal and spatial differential expression of these genes and are in accordance with the results showing that a single hexosaminidase is not responsible for the presence of high amounts of paucimannosidic species in the N-glycan profile of wild-type worms.


Figure 9
View larger version (21K):
[in this window]
[in a new window]

 
FIGURE 7.
MALDI-TOF MS analysis of N-glycans from N2 wild-type and hex-2 mutant worms. Pyridylaminated peptide N-glycosidase F A-released N-glycans from N2 or tm2350 strains were pooled after RP-HPLC and subjected to monoisotopic MALDI-TOF MS. The spectra are annotated with the m/z values of selected species and the major putative structures (as deduced by the HPLC, exoglycosidase digestion, and MS/MS data shown in Figs. 8 and 9) are depicted using the nomenclature of the Consortium for Functional Glycomics. A shift to structures containing an extra HexNAc is apparent in the hex-2 mutant; the relative peak intensities for these data are summarized in Table 1.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 REFERENCES
 
Comparing Insect and Plant N-Glycan Processing—As discussed in the introduction, the hexosaminidase-mediated removal of the GlcNAc transferred by GlcNAc-TI, after modification by core fucosyltransferases, has been invoked to explain the paucimannosidic N-glycan structures observed in insects and plants. The identity of such a processing hexosaminidase, proposed to be located in either the insect Golgi or plant vacuole (21, 24), has been a stumbling block in our understanding and exploitation of N-glycan biosynthesis in these species. Indeed, the presence of paucimannosidic N-glycans on the glycoproteins of plants and of insect cells means that these may be less valuable as biotechnological products due to the lack of mammalian-type features and could, if used therapeutically, be immunogenic (56) and be cleared from the circulation faster, although the latter property can be an advantage for enzyme replacement therapy of lysosomal storage diseases (57). Thus, the cloning of hexosaminidase genes from plants and insects is considered, in conjunction with other approaches (58), to be necessary in the development of knock-out/down strategies for attaining a more human-like glycosylation in biotechnologically relevant systems.


Figure 10
View larger version (28K):
[in this window]
[in a new window]

 
FIGURE 8.
RP-HPLC analysis of N-glycans from N2 wild-type and hexosaminidase-defective mutant worms. Pyridylaminated peptide N-glycosidase F A-released N-glycans were subject to RP-HPLC using a gradient of 0.3% methanol per minute and detected by fluorescence (response in mV); the column was calibrated in terms of glucose units (g.u.). Analysis of glycans of wild-type N2 and hex-1 tm1992 worms resulted in similar chromatograms, whereas the analysis of N-glycans from the two hex-2 mutants (VC1278 and tm2350) showed the appearance of new peaks of high retention time (over 11 g.u.); other than in the region below 4 g.u. (for which there is no clear data as to the nature of the peaks), the hex-3 (tm2725) chromatogram is similar to the wild-type one, suggesting a minor role for HEX-3 in N-glycan processing. The N-glycans from the hex-2 tm2350 mutant were subject to fractionation; peaks A–H were collected and analyzed by MALDI-TOF MS and found to contain species with the following m/z values [M+H]+: A (11 min), 1637.669 and 1799.742; B (12.5 min), 1961.751 and 1637.655; C (16 min), 1192.587; D (17 min), 989.552 and 1313.725; E (21.5 min), 1338.623 and 1135.531; F (22 min) 1135.465; G (24 min), 1500.616 and 1646.669; and H (29 min), 1514.673. The whole pool of N-glycans from the hex-2 tm2350 mutant was also subject to various single and double exoglycosidase digests with Streptococcus hexosaminidase (Hex; resulting in removal of peaks C and E and shifts of peaks G and H), bovine kidney fucosidase (Fuc; resulting in reduction of peaks E and F), Aspergillus galactosidase and bovine fucosidase (Gal+Fuc; resulting in the near abolition of peaks E, F, and G and an apparent increase in peak C), Aspergillus galactosidase alone (Gal; resulting in an increase in peak E at the expense of peak G and a shift forward of peak H), Aspergillus galactosidase and Streptococcus hexosaminidase (Gal+Hex; resulting in removal of peaks C and G and a shift in peak H). The elution position of peak C and its sensitivity to hexosaminidase is indicative that this glycan is the MGn isomer of Hex3HexNAc3-PA. The fucose residue of the glycans in peaks E and F is, as judged by the relative retention time and sensitivity to bovine fucosidase, core {alpha}1,6-linked. On the other hand, the putatively {alpha}1,6-linked fucose residues of peaks G and H are only accessible to digestion when fucosidase is used in combination with Aspergillus beta1,4-specific galactosidase, whereas bovine testes galactosidase, which is beta1,3-specific, has no effect on the glycan profile (not shown). The composition of peak H (m/z 1514) is compatible with the presence of a methyl group, which makes the glycan more hydrophobic than the related major glycan of peak G (m/z 1500).

 
A recent advance was the identification of the fdl hexosaminidase gene from D. melanogaster, which was shown to be important for the normal processing of N-glycans in this organism and to encode an enzyme, present in the secretory pathway, with the same specificity toward the {alpha}1,3-antennal GlcNAc residue on N-glycans as a previously characterized Golgi hexosaminidase found in extracts of Sf9 cells (22). On the other hand, the two recombinant Sf9 insect cell hexosaminidases characterized to date can remove both GlcNAc residues from GnGn (48, 49).

This latter property is shared with the AtHEX1 and AtHEX2 described in the present study, because these two putatively vacuolar enzymes also have no especially strict arm preference. The ability of AtHEX1 to cleave a plant-type GnGnXF3 glycan to a mixture of products was also observed (data not shown). In this respect, these recombinant plant enzymes mimic the activity of the commercially available jack bean hexosaminidase, and the products reflect that plant glycomes contain N-glycans with a GlcNAc on either the {alpha}1,3- or {alpha}1,6-arms, e.g. the MGnXF3 and GnMXF3 structures found in pollens (30) (see Scheme 1 for structures and Scheme 2 for a putative processing pathway). Another contrast to the insect (FDL) and nematode (HEX-2, HEX-3, and native) hexosaminidases is that the plant hexosaminidases will remove the non-reducing terminal GlcNAc from Man5Gn-type structures both in vitro, as shown in this study with AtHEX1, and in vivo, as exemplified by the presence of Man5XF3 in a mannosidase II knock-out plant (11) and in papaya (59).

Plants, Insects, and Nematodes Possess Family 20 Glycosidases with Chitotriosidase Activity—The third plant hexosaminidase, AtHEX3, is a putative chitotriosidase and, thus, shares some properties with the Hexo1 and Hexo2 from Drosophila (22); however, it is evolutionarily closer to fungal hexosaminidases with this type of activity and may, in conjunction with family 18 and 19 chitinases (60), have roles in defense-related chitin degradation in vivo. The nematode HEX-1, the major p-nitrophenyl-beta-N-acetylglucosaminide-cleaving enzyme in the worm, is also a putative chitotriosidase; such an activity has been previously reported in C. elegans extracts (61). Chitin is a component of nematode eggshells, and C. elegans possesses two chitin synthase genes (62). Thus, exo- and endoglycosidases capable of degrading chitin can be expected in this organism and family 18 endochitinases have been described from other nematodes (61, 63). The hex-1 promoter-driven expression of GFP in coelomocytes may correlate with the degradative and scavenging function of these cells.

The Nematode Genome Encodes Unusual N-Glycan-specific Hexosaminidases—The nematode HEX-2 and HEX-3 remove specifically the {alpha}1,3-antennal GlcNAc residue (i.e. that transferred by GlcNAc-TI) from the GnGn N-glycan. Thus, their activity is akin to that of FDL, and this, therefore, suggests that the same basic mechanism for generation of paucimannosidic N-glycans operates in both insects and nematodes, i.e. that the residue transferred by GlcNAc-TI is removed; however, non-orthologous enzymes are responsible. On the other hand, HEX-2, HEX-4, and HEX-5 are capable of removing also the non-reducing terminal GalNAc residues from the betaGNbetaGN N-glycan. It is unclear whether the latter reaction is physiological, but certainly C. elegans possesses a beta1,4-N-acetylgalactosaminyltransferase (BRE-4) that can generate LacdiNAc moieties on N-glycans in vitro (64) and probably glycolipids in vivo (65). Although N-glycans with LacdiNAc moieties are not demonstrated on C. elegans, such structures are found in the nematode Trichinella spiralis (66).


Figure 11
View larger version (35K):
[in this window]
[in a new window]

 
FIGURE 9.
MALDI-TOF MS/MS analysis of putatively core galactofucosylated N-glycans from mutant hex-2 worms. The major species from peaks G (A and C; m/z 1500 and 1646) and H (B; m/z 1514) isolated by RP-HPLC fractionation of pyridylaminated N-glycans derived from the hex-2 tm2350 mutant (see Fig. 8) were subject to MALDI-TOF MS/MS analysis. In conjunction with the necessity to co-incubate the glycans with galactosidase in order that they become fucosidase-sensitive, the Fuc1Hex1HexNAc1-PA fragment (m/z 607) in both MS/MS spectra is indicative of a galactose-substituted core fucose residue. The presence of a Hex3HexNAc3Me1-PA (m/z 1206) fragment and low abundance Hex2HexNAc3-PA (m/z 1030) and Hex2HexNAc2Me1-PA (m/z 841) fragments is suggestive that the methyl group of the m/z 1514 glycan (B) is present on the free mannose residue, which is not substituted by a HexNAc. In the case of the m/z 1646 glycan (C), the position of the second fucose residue is ambiguous, but the MS/MS offers verification that the composition is Fuc2Hex4HexNAc3-PA. Based on the enzyme digestion data (Fig.8), it is concluded that the second fucose is not attached to the galactose or GlcNAc residues, whereas the lack of an effect on the retention time as compared with the "parent" glycan suggests that the second fucose is not attached to the reducing terminal GlcNAc; in comparison to other data on nematode glycans, it is, therefore, hypothesized that the second fucose is either linked to the "distal core" GlcNAc or on the free non-reducing mannose residue. Both potential models for the structure are shown. The proposed glycan structures are depicted according to the nomenclature of the Consortium for Functional Glycomics.

 
The relative insensitivity of the nematode HEX-2, -3, -4, and -5 toward standard hexosaminidase inhibitors, when using p-nitrophenyl substrates, was another complicating factor in tracking down the processing hexosaminidase in the worm. This is due to the finding that the native GnGn-digesting activity is inhibited by 80% in the presence of N-acetylcastanospermine. However, when using this "natural" substrate, N-acetylcastanospermine also inhibits both recombinant HEX-2 and HEX-3 by some 80%. The apparent discrepancy in the inhibition data may be due to the vastly lower "native" substrate concentration used (20 µM), as compared with that of the p-nitrophenyl substrates (5 mM) and of the inhibitor (200 µM). As judged by the use of GFP fusions, the hex-2 and hex-3 promoters appear to be expressed in a tissue-specific manner.

Comparing Insect and Nematode N-Glycan Processing—One consideration with respect to N-glycan processing pathways in insects and nematode is that GnGn is probably not a dominant intermediate. Insect cells have apparently low levels of GlcNAc-TII (67, 68), thus reducing the potential GnGn pool within the secretory pathway; certainly, MM-related, and not GnM-related, structures dominate in both insects or nematodes. Thus, it is probable that MGn or MGnF6 are major in vivo substrates of the processing hexosaminidases in these organisms. Certainly, the D. melanogaster core {alpha}1,3-fucosyltransferase (FucTA) and the C. elegans core {alpha}1,6-fucosyltransferase are capable of modifying both MGn and Man5Gn in vitro (69); indeed, these enzymes must act on these glycans prior to removal of the non-reducing terminal GlcNAc residue. On the other hand, the C. elegans core {alpha}1,3-fucosyltransferase can accept MM and GnM, but not GnGn (28); this enzyme can also fucosylate Man5.4 Thus, as previously hypothesized (10, 17, 70) and as summarized in Scheme 2, a pathway of Man5 -> Man5Gn -> MGn -> MGnF6 -> MMF6 -> MMF3F6 may operate in C. elegans, whereas in insects the order is slightly different: Man5 -> Man5Gn -> MGn -> MGnF6 -> MGnF3F6 -> MMF3F6, with the potential that some Man5 is directly converted to MM by a so-called mannosidase III (71). In the absence of processing hexosaminidase activity, an accumulation of Man3–5Glc-NAc3Fuc1 may result. Indeed in the fdl fruit fly mutant, MGnF6 is a dominant species in the glycan profile (22). This predicted effect, however, only occurs to a lesser extent in the nematode hex-2 mutant. This would correlate with the finding that the deletion of part of the hex-2 gene does not entirely abolish the GnGn-digesting activity in worm extracts. Thus, even though the hexosaminidase activity toward N-glycans is drastically reduced, this does not result in a lack of MM and MMF6. This effect is, though, partly reminiscent of an experiment with antisense-mediated knockdown of GlcNAc-TI in plants: a large decrease in enzyme activity had only a minor effect on the glycan profile (72). Presumably a small amount of a residual activity of a processing hexosaminidase (putatively HEX-3, whose promoter is also active in tissues in which the hex-2-driven GFP expression is absent) can be sufficient to generate a glycomic profile with MM and MMF6 remaining as major structures. Nevertheless, there is an impact on the glycome of the hex-2 mutant worm: glycans with an "extra" HexNAc, such as MGn and MGnF6, are more pronounced in the hex-2 N-glycome than that of wild-type N2 or hex-1 worms. Furthermore, as with the aman-2 mutant in which various non-wild-type hybrid glycans were present (10), unusual N-glycans result from knocking-out hex-2, presumably due to otherwise minor biosynthetic pathways being revealed. In particular, novel N-glycans of the form Fuc1–2Hex3–4HexNAc3Me0–1 are found in the hex-2 mutant, which are forms of MGn modified by galactosylated core fucose moieties, the latter modification having been previously found on other glycans in wild-type worms (50). Thereby, it is noteworthy how the use of nematode mutants aids identification or verification of new aspects of the glycomic capabilities of this species.


Figure 12
View larger version (66K):
[in this window]
[in a new window]

 
FIGURE 10.
Analysis of GFP expression driven by Caenorhabditis hexosaminidase promoters. Fluorescence microscopy of worms transformed with various hex::gfp constructs indicates that there is differential expression driven by the putative promoter regions of the hex-1, -2, -3, -4, and -5 genes. Pairs of confocal and fluorescent micrographs for hex-1::gfp (whole worm (A) and tail coelomocyte (B)), hex-2::gfp (head region (C), vulval region lateral view (D), vulval region top view (E), and tail region (F)), hex-3::gfp (L1 larvae (G)), hex-4::gfp (L1 larvae (H) and embryos (I)) and hex-5::gfp (embryo (J) and whole worm (K)) transgenic worms are shown.

 
Other fates of aberrant N-glycans with terminal GlcNAc are conceivable in invertebrates, because the GlcNAc can be "capped" with other moieties, such as fucosylated LacdiNAc in honeybee venom (73), sialylated LacNAc in fruit fly embryos (74) or phosphorylcholine-containing glycans in nematodes (75, 76). However, large shifts to these structures are not seen in the fruit fly fdl or worm hex-2 mutants, although some extra phosphorylcholine-modified glycans were observed in the latter. The biological repercussions of alterations in the N-glycome of hex-2 worms are, as yet, unknown, but it is interesting to note that mutations in the three C. elegans GlcNAc-TI genes result in alterations in nematode survival in the presence of bacterial pathogens (70).


    CONCLUSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 REFERENCES
 
Overall, the examination of recombinant forms of plant, nematode, and, in an earlier study (22), insect N-glycan-modifying hexosaminidases suggests that, although the final result is similar in that paucimannosidic N-linked oligosaccharides are expressed in these organisms, the exact genetic mechanisms are different with non-orthologous members of glycoside hydrolase family 20 being responsible for the biosynthesis of these structures. Obviously, questions remain as to the intracellular localization of the nematode hexosaminidases, the mechanisms by which their transcription is controlled, their relevance as models for human lysosomal storage diseases, and the effect of knocking out multiple worm hexosaminidase genes as well as the effect of knocking-out the plant hexosaminidases. However, the use of mutant organisms as well as of recombinant enzymes demonstrates that the major processing hexosaminidases in C. elegans have been molecularly identified and show a remarkable example of functional convergence between enzymes displaying low homology yet still being members of the same glycosidase family.


    FOOTNOTES
 
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AM748820, AM748821, AM748822, AM748823, and AM748824.

* This work was supported by Grants P15475 [GenBank] and P18447 [GenBank] (to I. B. H. W.) from the Austrian Fonds zur Förderung der wissenschaftlichen Forschung. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1 and S2. Back

1 To whom correspondence should be addressed. Tel.: 43-1-36006-6541; Fax: 43-1-36006-6076; E-mail: iain.wilson{at}boku.ac.at.

2 All glycan abbreviations are defined in Scheme 1. Back

3 The abbreviations used are: PUGNAc, O-(2-acetamido-2-deoxy-D-glucopyranosylidene)amino N-phenylcarbamate; GFP, green fluorescent protein; GlcNAc-TI, N-acetylglucosaminyltransferase I; MALDI-TOF, matrix-assisted laser desorption ionization/time-of flight; MS, mass spectrometry; MS/MS, tandem mass spectrometry; PA, pyridylamino; RP-HPLC, reversed-phase-high pressure liquid chromatography; g.u., glucose units. Back

4 I. B. H. Wilson, unpublished data. Back


    ACKNOWLEDGMENTS
 
We thank Denise Kerner for technical assistance, Ramona Dumreanu, Claudia Eisenkölbl, Daniel Gregorich, Lilian Kuster, and Johannes Lesigang, project students in the laboratory, for performing some of the experiments; Dr. Arnold Stütz (Technische Universität Graz, Austria) for the kind gift of 2-acetamido-1,2-dideoxynojirimycin; the National Bioresource Project for the Experimental Animal Nematode C. elegans (Tokyo Women's Medical University, Japan) for the tm1992, tm2350, and tm2725 mutant strains and the Caenorhabditis Genetics Centre for the VC1278 (being provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, part of the International C. elegans Gene Knock-out Consortium); the original pPD118.25 (L3786) vector was the kind gift of Drs. Andrew Fire and Si-Qun Xu.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 REFERENCES
 

  1. Wilson, I. B. H. (2002) Curr. Opin. Struct. Biol. 12, 569-577[CrossRef][Medline] [Order article via Infotrieve]
  2. Kornfeld, R., and Kornfeld, S. (1985) Annu. Rev. Biochem. 54, 631-664[CrossRef][Medline] [Order article via Infotrieve]
  3. Samuelson, J., Banerjee, S., Magnelli, P., Cui, J., Kelleher, D. J., Gilmore, R., and Robbins, P. W. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 1548-1553[Abstract/Free Full Text]
  4. Hori, H., and Elbein, A. D. (1983) Arch. Biochem. Biophys. 220, 415-425[CrossRef][Medline] [Order article via Infotrieve]
  5. Parker, G. F., Williams, P. J., Butters, T. D., and Roberts, D. B. (1991) FEBS Lett. 290, 58-60[CrossRef][Medline] [Order article via Infotrieve]
  6. Sarkar, M., Leventis, P. A., Silvescu, C. I., Reinhold, V. N., Schachter, H., and Boulianne, G. L. (2006) J. Biol. Chem. 281, 12776-12785[Abstract/Free Full Text]
  7. von Schaewen, A., Sturm, A., O'Neill, J., and Chrispeels, M. J. (1993) Plant Physiol. 102, 1109-1118[Abstract]
  8. Zhu, S., Hanneman, A., Reinhold, V., Spence, A., and Schachter, H. (2004) Biochem. J. 382, 995-1001[CrossRef][Medline] [Order article via Infotrieve]
  9. Altmann, F., and März, L. (1995) Glycoconj. J. 12, 150-155[CrossRef][Medline] [Order article via Infotrieve]
  10. Paschinger, K., Hackl, M., Gutternigg, M., Kretschmer-Lubich, D., Stemmer, U., Jantsch, V., Lochnit, G., and Wilson, I. B. H. (2006) J. Biol. Chem. 281, 28265-28277[Abstract/Free Full Text]
  11. Strasser, R., Schoberer, J., Jin, C., Glössl, J., Mach, L., and Steinkellner, H. (2006) Plant J. 45, 789-803[CrossRef][Medline] [Order article via Infotrieve]
  12. Fabini, G., Freilinger, A., Altmann, F., and Wilson, I. B. H. (2001) J. Biol. Chem. 276, 28058-28067[Abstract/Free Full Text]
  13. Wilson, I. B. H., Rendic, D., Dumic, J., Freilinger, A., Altmann, F., Mucha, J., Müller, S., and Hauser, M.-T. (2001) Biochim. Biophys. Acta 1527, 88-96[Medline] [Order article via Infotrieve]
  14. Strasser, R., Mucha, J., Mach, L., Altmann, F., Wilson, I. B. H., Glössl, J., and Steinkellner, H. (2000) FEBS Lett. 472, 105-108[CrossRef][Medline] [Order article via Infotrieve]
  15. Mulder, H., Dideberg, F., Schachter, H., Spronk, B. A., De Jong-Brink, M., Kamerling, J. P., and Vliegenthart, J. F. G. (1995) Eur. J. Biochem. 232, 272-283[Medline] [Order article via Infotrieve]
  16. Faveeuw, C., Mallevaey, T., Paschinger, K., Wilson, I. B. H., Fontaine, J., Mollicone, R., Oriol, R., Altmann, F., Lerouge, P., Capron, M., and Trottein, F. (2003) Eur. J. Immunol. 33, 1271-1281[CrossRef][Medline] [Order article via Infotrieve]
  17. Paschinger, K., Staudacher, E., Stemmer, U., Fabini, G., and Wilson, I. B. H. (2005) Glycobiology 15, 463-474[Abstract/Free Full Text]
  18. Bakker, H., Lommen, A., Jordi, W., Stiekema, W., and Bosch, D. (1997) Biochem. Biophys. Res. Commun. 261, 829-832[CrossRef]
  19. Chen, S., Tan, J., Reinhold, V. N., Spence, A. M., and Schachter, H. (2002) Biochim. Biophys. Acta 1573, 271-279[Medline] [Order article via Infotrieve]
  20. Strasser, R., Steinkellner, H., Boren, M., Altmann, F., Mach, L., Glössl, J., and Mucha, J. (1999) Glycoconj. J. 16, 787-791[CrossRef][Medline] [Order article via Infotrieve]
  21. Altmann, F., Schwihla, H., Staudacher, E., Glössl, J., and März, L. (1995) J. Biol. Chem. 270, 17344-17349[Abstract/Free Full Text]
  22. Léonard, R., Rendic, D., Rabouille, C., Wilson, I. B. H., Préat, T., and Altmann, F. (2006) J. Biol. Chem. 281, 4867-4875[Abstract/Free Full Text]
  23. Zhang, W., Cao, P., Chen, S., Spence, A. M., Zhu, S., Staudacher, E., and Schachter, H. (2003) Biochem. J. 372, 53-64[CrossRef][Medline] [Order article via Infotrieve]
  24. Vitale, A., and Chrispeels, M. J. (1984) J. Cell Biol. 99, 133-140[Abstract/Free Full Text]
  25. Fitchette-Lainé, A. C., Gomord, V., Cabanes, M., Michalski, J. C., Saint Macary, M., Foucher, B., Cavelier, B., Hawes, C., Lerouge, P., and Faye, L. (1997) Plant J. 12, 1411-1417[CrossRef][Medline] [Order article via Infotrieve]
  26. Bencúrová, M., Rendic, D., Fabini, G., Kopecky, E. M., Altmann, F., and Wilson, I. B. H. (2003) Biochimie (Paris) 85, 413-422
  27. Morgenstern, B. (2004) Nucleic Acids Res. 32, W33-W36[Abstract/Free Full Text]
  28. Paschinger, K., Rendic, D., Lochnit, G., Jantsch, V., and Wilson, I. B. H. (2004) J. Biol. Chem. 279, 49588-49598[Abstract/Free Full Text]
  29. Mucha, J., Domlatil, J., Lochnit, G., Rendic, D., Paschinger, K., Hinterkörner, G., Hofinger, A., Kosma, P., and Wilson, I. B. H. (2004) Biochem. J. 382, 67-74[CrossRef][Medline] [Order article via Infotrieve]
  30. Wilson, I. B. H., and Altmann, F. (1998) Glycoconj. J. 15, 1055-1070[CrossRef][Medline] [Order article via Infotrieve]
  31. Zeleny, R., Altmann, F., and Praznik, W. (1997) Anal. Biochem. 246, 96-101[CrossRef][Medline] [Order article via Infotrieve]
  32. Coutinho, P. M., and Henrissat, B. (1999) in Recent Advances in Carbohydrate Bioengineering (Gilbert, H. J., Davies, G., Henrissat, B., and Svensson, B., eds) pp. 3-12, The Royal Society of Chemistry, Cambridge
  33. Fan, X., She, Y. M., Bagshaw, R. D., Callahan, J. W., Schachter, H., and Mahuran, D. J. (2005) Glycobiology 15, 952-964[Abstract/Free Full Text]
  34. Kaji, H., Saito, H., Yamauchi, Y., Shinkawa, T., Taoka, M., Hirabayashi, J., Kasai, K.-i., Takahashi, N., and Isobe, T. (2003) Nat. Biotech. 21, 667-672[CrossRef][Medline] [Order article via Infotrieve]
  35. Giraudo, C. G., and Maccioni, H. J. (2003) Mol. Biol. Cell 14, 3753-3766[Abstract/Free Full Text]
  36. Henrissat, B., Coutinho, P. M., and Davies, G. J. (2001) Plant Mol. Biol. 47, 55-72[CrossRef][Medline] [Order article via Infotrieve]
  37. Carter, C., Pan, S., Zouhar, J., Avila, E. L., Girke, T., and Raikhel, N. V. (2004) Plant Cell 16, 3285-3303[Abstract/Free Full Text]
  38. Hou, Y., Vocadlo, D. J., Leung, A., Withers, S. G., and Mahuran, D. (2001) Biochemistry 40, 2201-2209[CrossRef][Medline] [Order article via Infotrieve]
  39. Diez, B., Rodriguez-Saiz, M., de la Fuente, J. L., Moreno, M. A., and Barredo, J. L. (2005) FEMS Microbiol. Lett. 242, 257-264[CrossRef][Medline] [Order article via Infotrieve]
  40. Mark, B. L., Vocadlo, D. J., Knapp, S., Triggs-Raine, B. L., Withers, S. G., and James, M. N. (2001) J. Biol. Chem. 276, 10330-10337[Abstract/Free Full Text]
  41. Clarke, V. A., Platt, N., and Butters, T. D. (1995) J. Biol. Chem. 270, 8805-8814[Abstract/Free Full Text]
  42. Bolanowski, M., Jacobson, L. A., and Russell, R. L. (1983) Mech. Aging Dev. 21, 295-319[CrossRef][Medline] [Order article via Infotrieve]
  43. Li, S. C., and Li, Y. T. (1970) J. Biol. Chem. 245, 5153-5160[Abstract/Free Full Text]
  44. Liu, P. S., Kang, M. S., and Sunkara, P. S. (1991) Tetrahedron Lett. 32, 719-720[CrossRef]
  45. Gradnig, G., Legler, G., and Stütz, A. E. (1996) Carbohyd. Res. 287, 49-57[CrossRef][Medline] [Order article via Infotrieve]
  46. Horsch, M., Hoesch, L., Vasella, A., and Rast, D. M. (1991) Eur. J. Biochem. 197, 815-818[Medline] [Order article via Infotrieve]
  47. Tomiya, N., Awaya, J., Kurono, M., Endo, S., Arata, Y., and Takahashi, N. (1988) Anal. Biochem. 171, 73-90[CrossRef][Medline] [Order article via Infotrieve]
  48. Aumiller, J. J., Hollister, J. R., and Jarvis, D. L. (2006) Protein Expr. Purif. 47, 571-590[CrossRef][Medline] [Order article via Infotrieve]
  49. Tomiya, N., Narang, S., Park, J., Abdul-Rahman, B., Choi, O., Singh, S., Hiratake, J., Sakata, K., Betenbaugh, M. J., Palter, K. B., and Lee, Y. C. (2006) J. Biol. Chem. 281, 19545-19560[Abstract/Free Full Text]
  50. Hanneman, A. J., Rosa, J. C., Ashline, D., and Reinhold, V. (2006) Glycobiology 16, 874-890[Abstract/Free Full Text]
  51. Takahashi, N., Masuda, K., Hiraki, K., Yoshihara, K., Huang, H.-H., Khoo, K.-H., and Kato, K. (2004) Eur. J. Biochem. 270, 2627-2632[CrossRef]
  52. Wuhrer, M., Robijn, M. L., Koeleman, C. A., Balog, C. I., Geyer, R., Deelder, A. M., and Hokke, C. H. (2004) Biochem. J. 378, 625-632[CrossRef][Medline] [Order article via Infotrieve]
  53. Haslam, S. M., Coles, G. C., Munn, E. A., Smith, T. S., Smith, H. F., Morris, H. R., and Dell, A. (1996) J. Biol. Chem. 271, 30561-30570[Abstract/Free Full Text]
  54. Gutternigg, M., Ahrer, K., Grabher-Meier, H., Burgmayr, S., and Staudacher, E. (2004) Eur. J. Biochem. 271, 1348-1356[Medline] [Order article via Infotrieve]
  55. McKay, S. J., Johnsen, R., Khattra, J., Asano, J., Baillie, D. L., Chan, S., Dube, N., Fang, L., Goszczynski, B., Ha, E., Halfnight, E., Hollebakken, R., Huang, P., Hung, K., Jensen, V., Jones, S. J., Kai, H., Li, D., Mah, A., Marra, M., McGhee, J., Newbury, R., Pouzyrev, A., Riddle, D. L., Sonnhammer, E., Tian, H., Tu, D., Tyson, J. R., Vatcher, G., Warner, A., Wong, K., Zhao, Z., and Moerman, D. G. (2003) Cold Spring Harbor Symp. Quant. Biol. 68, 159-169[CrossRef][Medline] [Order article via Infotrieve]
  56. van Remoortere, A., Bank, C. M. C., Nyame, A. K., Cummings, R. D., Deelder, A. M., and van Die, I. (2003) Glycobiology 13, 217-225[Abstract/Free Full Text]
  57. Van Patten, S. M., Hughes, H., Huff, M. R., Piepenhagen, P. A., Waire, J., Qiu, H., Ganesa, C., Reczek, D., Ward, P. V., Kutzko, J. P., and Edmunds, T. (2007) Glycobiology 17, 467-478[Abstract/Free Full Text]
  58. Betenbaugh, M. J., Tomiya, N., Narang, S., Hsu, J. T., and Lee, Y. C. (2004) Curr. Opin. Struct. Biol. 14, 601-606[CrossRef][Medline] [Order article via Infotrieve]
  59. Wilson, I. B. H., Zeleny, R., Kolarich, D., Staudacher, E., Stroop, C. J. M., Kamerling, J. P., and Altmann, F. (2001) Glycobiology 11, 261-274[Abstract/Free Full Text]
  60. Iseli, B., Armand, S., Boller, T., Neuhaus, J. M., and Henrissat, B. (1996) FEBS Lett. 382, 186-188[CrossRef][Medline] [Order article via Infotrieve]
  61. Wu, Y., Egerton, G., Underwood, A. P., Sakuda, S., and Bianco, A. E. (2001) J. Biol. Chem. 276, 42557-42564[Abstract/Free Full Text]
  62. Zhang, Y., Foster, J. M., Nelson, L. S., Ma, D., and Carlow, C. K. (2005) Dev. Biol. 285, 330-339[CrossRef][Medline] [Order article via Infotrieve]
  63. Gao, B., Allen, R., Maier, T., McDermott, J. P., Davis, E. L., Baum, T. J., and Hussey, R. S. (2002) Int. J. Parasitol. 32, 1293-1300[CrossRef][Medline] [Order article via Infotrieve]
  64. Kawar, Z., van Die, I., and Cummings, R. D. (2002) J. Biol. Chem. 277, 34924-34932[Abstract/Free Full Text]
  65. Griffitts, J. S., Haslam, S. M., Yang, T., Garczynski, S. F., Mulloy, B., Morris, H., Cremer, P. S., Dell, A., Adang, M. J., and Aroian, R. V. (2005) Science 307, 922-925[Abstract/Free Full Text]
  66. Morelle, W., Haslam, S. M., Olivier, V., Appleton, J. A., Morris, H. R., and Dell, A. (2000) Glycobiology 10, 941-950[Abstract/Free Full Text]
  67. Altmann, F., Kornfeld, G., Dalik, T., Staudacher, E., and Glössl, J. (1993) Glycobiology 3, 619-625[Abstract/Free Full Text]
  68. Hollister, J., Grabenhorst, E., Nimtz, M., Conradt, H., and Jarvis, D. L. (2002) Biochemistry 41, 15093-15104[CrossRef][Medline] [Order article via Infotrieve]
  69. Rendic, D., Linder, A., Paschinger, K., Borth, N., Wilson, I. B. H., and Fabini, G. (2006) J. Biol. Chem. 281, 3343-3353[Abstract/Free Full Text]
  70. Shi, H., Tan, J., and Schachter, H. (2006) Methods Enzymol. 417, 359-389[Medline] [Order article via Infotrieve]
  71. Kawar, Z., Karaveg, K., Moremen, K. W., and Jarvis, D. L. (2001) J. Biol. Chem. 276, 16335-16340[Abstract/Free Full Text]
  72. Strasser, R., Altmann, F., Glössl, J., and Steinkellner, H. (2004) Glycoconj. J. 21, 275-282[CrossRef][Medline] [Order article via Infotrieve]
  73. Kubelka, V., Altmann, F., Staudacher, E., Tretter, V., März, L., Hård, K., Kamerling, J. P., and Vliegenthart, J. F. G. (1993) Eur. J. Biochem. 213, 1193-1204[Medline] [Order article via Infotrieve]
  74. Aoki, K., Perlman, M., Lim, J. M., Cantu, R., Wells, L., and Tiemeyer, M. (2007) J. Biol. Chem. 282, 9127-9142[Abstract/Free Full Text]
  75. Haslam, S. M., Houston, K. M., Harnett, W., Reason, A. J., Morris, H. R., and Dell, A. (1999) J. Biol. Chem. 274, 20953-20960[Abstract/Free Full Text]
  76. Pöltl, G., Kerner, D., Paschinger, K., and Wilson, I. B. H. (2007) FEBS J. 274, 714-726[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
T. Takeuchi, K. Hayama, J. Hirabayashi, and K.-i. Kasai
Caenorhabditis elegans N-glycans containing a Gal-Fuc disaccharide unit linked to the innermost GlcNAc residue are recognized by C. elegans galectin LEC-6
Glycobiology, November 1, 2008; 18(11): 882 - 890.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
K. S Lau and J. W Dennis
N-Glycans in cancer progression
Glycobiology, October 1, 2008; 18(10): 750 - 760.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Geisler, J. J. Aumiller, and D. L. Jarvis
A fused lobes Gene Encodes the Processing {beta}-N-Acetylglucosaminidase in Sf9 Cells
J. Biol. Chem., April 25, 2008; 283(17): 11330 - 11339.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/38/27825    most recent
M704235200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gutternigg, M.
Right arrow Articles by Wilson, I. B. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gutternigg, M.
Right arrow Articles by Wilson, I. B. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement