| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 282, Issue 38, 27825-27840, September 21, 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1
From the
Department für Chemie, Universität für Bodenkultur, Muthgasse 18, Wien A-1190, Austria, the Abteilung für Chromosomenbiologie, Vienna Biocenter II, Wien A-1030, Austria, and the ¶Institut für Biochemie, Justus-Liebig-Universität, Giessen D-35292, Germany
Received for publication, May 23, 2007 , and in revised form, July 18, 2007.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
-N-acetylglucosaminidases. In Drosophila, the recently characterized enzyme encoded by the fused lobes (fdl) gene specifically removes the non-reducing N-acetylglucosamine residue from the 
1,3-antenna of N-glycans. In the present study, we examined the products of five -N-acetylhexosaminidase genes from Caenorhabditis elegans (hex-1 to hex-5, corresponding to reading frames T14F9.3, C14C11.3, Y39A1C.4, Y51F10.5, and Y70D2A.2) in addition to three from Arabidopsis thaliana (AtHEX1, AtHEX2, and AtHEX3, corresponding to reading frames At1g65590, At3g55260, and At1g05590). Based on homology, the Caenorhabditis HEX-1 and all three Arabidopsis enzymes are members of the same sub-family as the aforementioned Drosophila fused lobes enzyme but either act as chitotriosidases or non-specifically remove N-acetylglucosamine from both N-glycan antennae. The other four Caenorhabditis enzymes are members of a distinct sub-family; nevertheless, two of these enzymes displayed the same 1,3-antennal specificity as the fused lobes enzyme. Furthermore, a deletion of part of the Caenorhabditis hex-2 gene drastically reduces the native N-glycan-specific hexosaminidase activity in mutant worm extracts and results in a shift in the N-glycan profile, which is a demonstration of its in vivo enzymatic relevance. Based on these data, it is hypothesized that the genetic origin of paucimannosidic glycans in nematodes, plants, and insects involves highly divergent members of the same hexosaminidase gene family. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
1,3-fucose and 1,2-xylose is widespread in "lower" multicellular organisms, as is the tendency for core modified N-glycans to have mannose residues at the non-reducing termini. These oligosaccharides based on a trimannosyl core (see, e.g. the so-called MM, MMF6, or MMXF3 structures shown in Scheme 1)2 have been named "paucimannosidic" or "truncated" to distinguish them from oligomannosidic, hybrid, and complex N-glycans; particularly the latter are seen as a hallmark of mammals and other vertebrates.
The reactions resulting in the biosynthesis of complex N-glycans in mammals have been well characterized (2) and begin with the transfer of Glc3Man9GlcNAc2 by oligosaccharyltransferase, followed by both removal and addition of glycan residues. As summarized in Scheme 2, key events in mammalian N-glycan biosynthesis are the sequential actions of N-acetylglucosaminyltransferase I (GlcNAc-TI; EC 2.4.1.14
[EC]
3) and Golgi mannosidase II (EC 3.2.1.114
[EC]
), whereby the N-acetylglucosamine residue transferred to the 1,3-antenna by GlcNAc-TI is retained in the finally processed glycan.
A simplistic explanation of the origin of paucimannosidic glycans in invertebrates and plants would be that truncated glycans, as in some protozoans (3), are transferred by oligosaccharyltransferase. However, it has been shown that plants and insects synthesize the full Glc3Man9GlcNAc2 structure (4, 5). Furthermore, various knock-outs show that normal glycan processing in these species is, as in mammals, dependent on the action of GlcNAc-TI (6–8). Enzymes dependent on Glc-NAc-TI include Golgi mannosidase II from plants, insects, and nematodes (9–11), core 1,3-fucosyltransferases from plants and insects (12, 13), 1,2-xylosyltransferases from plants, snails, and trematodes (14–16), and core 1,6-fucosyltransferases from invertebrates in general (17). Also, genes encoding GlcNAc-TI and GlcNAc-TII are known to be present in plants, insects, and nematodes (6, 8, 18–20). Thus, to explain the "paradox" that the residue transferred by GlcNAc-TI is absent in many of the N-glycans isolated from invertebrates and plants, whereas, e.g. core fucose, is present, the concept of a "processing" hexosaminidase in these lower eukaryotes must be invoked.
|
To investigate the hexosaminidases of both nematodes and plants (specifically Caenorhabditis elegans and Arabidopsis thaliana) in more detail, we set out to examine their family 20 glycoside hydrolases. A total of five nematode and three plant hexosaminidase cDNAs was engineered for expression of soluble forms of the corresponding proteins in the yeast Pichia pastoris. Whereas two A. thaliana hexosaminidases possessed the expected plant-type "random" specificity for terminal GlcNAc residues, it was found that two members of the novel nematode hexosaminidase subfamily removed specifically the 1,3-antennal GlcNAc residue from N-glycans. Thus, it appears that non-orthologous members of glycosidase family 20 are responsible for the appearance of paucimannosidic or truncated N-glycans in insects, plants, and nematodes.
|
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
For isolation of the full open reading frames, the forward primers CeHex1/5 (atgcgacttttaattcccatac), CeHex2/5 (atgttcccgatgcggtgta), CeHex3/5 (atgcttcgaggttttttcgg), CeHex4/5 (atgcataaaatgtcgaaactc), and CeHex5/5 (atgtgcaacatttttcagattg) were used in conjunction with the aforementioned reverse primers, and the fragments were subcloned into the pGEM-T vector (Promega, Madison, USA) and sequenced.
In the case of the A. thaliana hexosaminidases, partial cDNAs were cloned after reverse transcription-PCR of TRIzol-extracted RNA from the Columbia ecotype with the primers AtHex1/1/EcoRI (cggaattcatagagaggttgaggatt) with AtHex1/2/XbaI (gctctagatcactgagcgagacaagaac), AtHex2/1/EcoRI (cggaattctcgccggctgattctcct) with AtHex2/2/XbaI (gctctagatcactgagcatagcaagagc), and AtHex3/1/EcoRI (cggaattcaacatttggccaaagccg) with AtHex3/2/XbaI (gctctagattattgatcttgaagagcacc).
The cDNA fragments were purified from the PCR reactions using the GFX DNA purification kit (GE Healthcare). Both fragment and vector were digested with the relevant restriction enzymes prior to ligation of the fragments into pPICZB or -C, either in the form purchased from the supplier (Invitrogen) or in a form in which the vector was modified by inverse PCR to include a region encoding a FLAG tag just upstream of the multiple cloning site but downstream of the region encoding the Ste13 signal cleavage site. Ligation products were transformed into Escherichia coli TOP10F' prior to selection on zeocin, plasmid preparation, and sequencing. The expression vectors were linearized and transformed into P. pastoris (GS115 strain), colonies were selected on Zeocin, and expression was performed with methanol induction at 16 or 30 °C as previously described (26). N-terminally FLAG-tagged forms of the C. elegans hexosaminidases HEX-1, HEX-3, and HEX-4 were detectable after Western blotting using the anti-FLAG M2 monoclonal antibody (1:10,000) and alkaline phosphatase-conjugated anti-mouse IgG (1:10,000).
In Silico Analysis—The in silico analysis of protein sequences was performed using the DIALIGN alignment program at the BibiServ server of the Universität Bielefeld (27) using default parameters.
Hexosaminidase Assays—Total nematode extracts were prepared as previously described from wild-type or mutant C. elegans (28), whereas the microsomal preparation resulted from a low percentage Triton wash of wild-type nematode membranes followed by high speed centrifugation (23). Crude supernatants of P. pastoris expressing recombinant C. elegans and A. thaliana hexosaminidases, as well as ammonium sulfate fractions (between 50 and 90% saturation) of these supernatants, were also assayed using a range of enzymatic assays. The majority of the recombinant enzymes were stable for several months at either 4 °C or -80 °C but not at -20 °C. A supernatant of Pichia expressing C. elegans Golgi mannosidase II was prepared during a previous study (10).
For the standard assay with p-nitrophenylglycosides, 5 µl of sample was incubated in a microtiter well with 25 µl of McIl-vaine citrate-phosphate buffer (pH 3.5–8.0), 2.5 µl of 100 mM p-nitrophenylglycoside in Me2SO, and 17.5 µl of water for 1 h at 37 °C; in some cases, diluted enzyme was used to attain linear substrate turnover over a period of up to 2 h. The reaction was stopped by addition of 250 µl of 0.4 M glycine-NaOH, pH 10.4, and the A405 was read using an enzyme-linked immunosorbent assay plate reader. Three hexosaminidase inhibitors were employed in this study: N-acetylcastanospermine (6-acetamido-6-deoxycastanospermine, Industrial Research Ltd., New Zealand), 2-acetamido-1,2-dideoxynojirimycin (2-acetamido-1,2,5-trideoxy-1,5-imino-D-glucitol, the kind gift of Dr. Arnold Stütz), and O-(2-acetamido-2-deoxy-D-glucopyranosylidene)amino N-phenylcarbamate (PUGNAc,3 Toronto Research Chemicals, Canada). For oligosaccharide substrates, dabsylglycopeptides (0.25 nmol) or pyridylaminooligosaccharides (0.1 nmol) were used. The incubation mixture was then subject to either MALDI-TOF MS (dabsyl) or RP-HPLC (pyridylamino) as previously described (10). The dabsyl-GNGN substrate was prepared using a dabsylated fibrin glycopeptide remodeled sequentially with sialidase, galactosidase, and finally bovine milk 1,4-galactosyltransferase, using UDP-GalNAc as donor (29). For an explanation of the abbreviations for the glycan substrates, see Scheme 1.
Analyses of Wild-type and Mutant Glycans—N-Glycans were prepared by peptide:N-glycosidase A-mediated release from peptic peptides, and a portion of each preparation was subject to pyridylamination, RP-HPLC, and MALDI-TOF MS (28, 30). Pyridylaminated glycans of the tm2350 mutant were also subject to single or double enzymatic digestions with recombinant Streptococcus -hexosaminidase (Sigma, 50 milliunits, using the manufacturer's reaction buffer), bovine kidney -fucosidase (Sigma, 15 milliunits, in 50 mM ammonium acetate, pH 5), or Aspergillus 1,4-galactosidase (27 milliunits, in 50 mM sodium citrate, pH 4.6) further purified from a cruder commercial preparation (31), prior to re-analysis by RP-HPLC. Glycans were analyzed by MALDI-TOF MS (Ultraflex Tof/Tof, Bruker-Daltonics, Bremen, Germeny) using a 6-aza-2-thiothymine matrix (5 mg/ml 6-aza-2-thiothymine in H2O) either in the MS or MS/MS mode. Normally 100–500 shots were summed. For external calibration, a peptide standard mixture (Bruker) was used.
Tissue-specific Promoter Analysis—The 2000 bp upstream of the ATG start codon of each C. elegans hex gene was isolated by PCR from genomic DNA using Expand polymerase and the following primer pairs: CeHex1/prom3/BamHI (cgggatcctaatcataataaggcttcgaac) with CeHex1/prom4/BamHI (cgggatccatcaccttaacttcatagatg), CeHex2/prom5/BamHI (cgggatccggcaattttatgatctatggta) with CeHex2/prom6/BamHI (cgggatccatttttttacatttgaggctaa), CeHex3/prom1/BamHI (cgggatccgagtatcacttcccgtcc) with CeHex3/prom2/BamHI (cgggatccatggcgacgtttattgca), CeHex4/prom11/BamHI (cgggatccggtttgccgttaacgttt) with CeHex4/prom8/BamHI (cgggatccattattgtatttgtattgtacaa), and CeHex5/prom9/BamHI (cgggatcctggaatttccatagcctg) with CeHex5/prom10/BamHI (cgggatccataatcataatcaaaaaagattaaa).
The reporter plasmid used was a modified form of the pPD95.67 (L2459) promoterless gfp vector modified, as previously described (10), by insertion of a HindIII/XbaI fragment carrying the unc-119 gene into its multiple cloning site to generate pPD95.67/unc-119. PCR fragments and the vector were digested with BamHI and ligated. Selected clones were sequenced and verified to contain the expected upstream regions in the correct orientation and were used to transform unc-119 (ed3) mutants with a particle gun (Bio-Rad). Individuals from integrated lines were examined by confocal laser scanning microscopy (Leica TCS SP2) with argon laser excitation at 488 nm and emission 500–540 nm using an HC Plans 10x/25 occular and HC PL Fluotar 63x/0.30 objective.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
The three A. thaliana hexosaminidase sequences identified in this study were previously included in the CAZy data base (36); we hereby define them as AtHEX1 (At1g65590), AtHEX2 (At3g55260), and AtHEX3 (At1g05590). All three genes encode proteins of Mr 
60,000 with five predicted, generally non-conserved, N-glycosylation sites and N-terminal hydrophobic regions, which may constitute signal sequences or transmembrane domains; AtHEX2 has been identified in a proteomic study as being a vacuolar resident (37), whereas both AtHEX1 and AtHEX3 are predicted by the WoLF PSORT program to have a vacuolar localization. AtHEX1 and AtHEX2 are 51% identical at the amino acid level, whereas AtHEX3 is more distantly related and displays only 29% identity to AtHEX1. Interestingly, the rice genome contains not only two genes homologous to the AtHEX1/AtHEX2 "pair" but also two genes homologous to AtHEX3.
The Hexosaminidase Family 20 Has Two Major Branches—To align the hexosaminidase-related protein sequences from a variety of species, which appear not to be globally related but are only similar to one another in certain, narrow regions, the DIALIGN alignment program (27) had to be employed. Standard alignment algorithms (e.g. ClustalW using BLOSUM30 or PAM matrices) under a variety of conditions failed to align the conserved regions of the sequences. Using DIALIGN, a His/Asn-Xaa-Gly-Ala/Cys/Gly/Met-Asp-Glu-Ala/Ile/Leu/Val sequence was found in all sequences (see Fig. 1A). The glutamate residue of this motif corresponds to the general acid/base involved in the catalytic mechanism of hexosaminidases (38).
The phylogenetic analysis (Fig. 1B) suggests that the nematode HEX-1 belongs to the same sub-family as the human lysosomal and subunits and the plant AtHEX1, AtHEX2, and AtHEX3; this sub-family also includes three sequences (Hexo1, Hexo2, and Fdl) from D. melanogaster (22) as well as ascomycete hexosaminidases such as Penicillium NagA (39). Indeed, C. elegans HEX-1 and AtHEX1 display 36–38% identity over 500 residues to the human hexosaminidase and subunits, respectively. On the other hand, the other four C. elegans hexosaminidase homologues (see also supplemental data for an alignment) can be grouped together with one sequence each from D. melanogaster, mouse, and man; members of this subfamily poorly align with the human and plant sequences. The six selected bacterial sequences, such as the well studied Streptomyces plicatus SpHex (40), also clearly associate with one or the other subfamily (Fig. 1A), suggestive of an ancient origin for the two branches.
Expression of Recombinant Caenorhabditis and Arabidopsis Hexosaminidase Homologues—cDNA fragments encoding the putative luminal domains of each C. elegans and A. thaliana hexosaminidase homologue (i.e. lacking putative cytosolic and transmembrane domains) were engineered into Pichia expression vectors as non-tagged and/or FLAG-tagged forms. In the case of the nematode HEX-1, HEX-3, and HEX-4, both Coomassie staining and anti-FLAG Western blotting of crude supernatants and ammonium sulfate fractions indicated expression of proteins of Mr 80,000, 70,000, and 55,000, respectively; HEX-2 was only ever detected after SDS-PAGE by Coomassie staining (Mr 60000), and it was considered possible that the FLAG tag was removed by proteolysis, potentially at dibasic sites in the stem region. The expression of HEX-5 was, however, apparently below the detection limits of Western blotting and Coomassie staining, although a number of independent clones reproducibly showed an activity absent from control "empty vector" supernatants. AtHEX1, AtHEX2, and AtHEX3 were seen as FLAG-tagged bands of Mr 65000 in either 50% or 70% ammonium sulfate fractions of the supernatants of recombinant yeast (data not shown).
The initial enzymatic tests were performed with artificial chromogenic substrates (p-nitrophenyl--N-acetylgalactosaminide and p-nitrophenyl--N-acetylglucosaminide) and showed that the homologues were indeed enzymatically active and that no enzyme activity was present in the supernatants of Pichia transfected with empty vector. Whereas HEX-1 was approximately equally active toward both substrates, HEX-2, HEX-3, HEX-4, and HEX-5 were most active (or only active) toward p-nitrophenyl--N-acetylgalactosaminide (see also Fig. 2); the latter hexosaminidases are, indeed, other than the Streptococcus pneumoniae StrH enzyme (41), the first members of a new sub-division of family 20 to be enzymatically studied. The Km value of HEX-1 for p-nitrophenyl--N-acetylglucosaminide was estimated to be 1.1 mM, which can be compared with a previously reported value of 0.45 mM with 4-methylumbelliferyl--N-acetylglucosaminide for a hexosaminidase activity in crude C. elegans extracts (42). The plant hexosaminidases AtHEX1, AtHEX2, and AtHEX3 were active with p-nitrophenyl--N-acetylglucosaminide as substrate (see also Fig. 3) but displayed only a minor activity toward p-nitrophenyl--N-acetylgalactosaminide (data not shown).
Effects of pH and Inhibitors on Recombinant Hexosaminidase Activities—Using the artificial p-nitrophenyl substrates, the activities of the recombinant C. elegans HEX-1, -2, -3, -4, and -5 were compared with the activity in native C. elegans extract in terms of pH optimum within the linear range of product formation with respect to time. As measured in the presence of McIlvaine buffers, C. elegans HEX-1 to HEX-4 have pH optima of pH 5.5–6.5 (Fig. 2, A and B), whereas HEX-5 was most active at pH 4.5 (only with p-nitrophenyl--N-acetylgalactosaminide (Fig. 2B)). The pH dependence curve for the activity in native extract followed most closely that of recombinant HEX-1. In comparison, the Arabidopsis hexosaminidases had optimal activity at pH 4–5 (Fig. 3A); according to the literature, the well known jack bean hexosaminidase has optimal activity at pH 5 with a citrate buffer (43).
Three inhibitors specific for hexosaminidases were employed with the nematode enzymes: N-acetylcastanospermine, 2-acetamido-1,2-dideoxynojirimycin, and PUGNAc. For the first compound IC50 values of 0.4–1.6 µM have been reported with jack bean and various animal hexosaminidases (44), whereas for the latter two, respective Ki values of 140–600 µM and 0.1 µM have been reported (45, 46). N-Acetylcastanospermine and 2-acetamido-1,2-dideoxynojirimycin were previously both found to inhibit the Drosophila Fdl processing hexosaminidase (22). However, whereas HEX-2, -3, -4, and -5 did not show sensitivity to any of these inhibitors at the concentrations used (up to 0.4 mM), only the activity of HEX-1 and of the native worm p-nitrophenyl--N-acetylhexosaminidase activity was particularly affected when using 5 mM p-nitrophenyl substrates (for results with N-acetylcastanospermine using p-nitrophenyl--N-acetylgalactosaminide as substrate, see Fig. 2C). The Ki values of HEX-1 for N-acetylcastanospermine (5 µM), 2-acetamido-1,2-dideoxynojirimycin (1 mM), and PUGNAc (2 µM) were estimated using Dixon plots.
Finally, the three recombinant plant enzymes were tested for their sensitivity toward N-acetylcastanospermine and particularly AtHEX1 and AtHEX2 were found to be inhibited (see Fig. 3B). AtHEX1 was also tested for its sensitivity to 2-acetamido-1,2-dideoxynojirimycin and PUGNAc; 50% inhibition with the former was achieved at 0.2 mM and 90% with the latter at 0.1 mM (data not shown). Overall, therefore, the inhibition data (i.e. the lack of inhibition of HEX-2, -3, -4, and -5 as compared with other hexosaminidases) indicate a distinct functional difference between the two major sub-families of the class 20 glycoside hydrolases, which reflects the aforementioned divergence at the primary structural level.
Activity of Caenorhabditis and Arabidopsis Hexosaminidase toward Glycan Substrates—The various hexosaminidases were tested with typical N-glycan substrates. Under the conditions used, C. elegans HEX-2 was able to remove three HexNAc residues from the biantennary dabsylglycopeptide GNGN, which carries non-reducing terminal GalNAc residues (see Scheme 1 for structure). On the other hand, HEX-4 and HEX-5 removed only up to two HexNAc residues from GNGN, whereas HEX-3 did not detectably cleave residues from this substrate (Fig. 4). Of the five enzymes, only HEX-2 and HEX-3 cleaved one residue from the asialoagalactodabsylglycopeptide GnGn (see supplemental data). In contrast, HEX-1 cleaved no residues from either GNGN or GnGn even after extended incubation times of up to 3 days.
|
|
|
|
Native Hexosaminidases in Wild-type and Mutant Caenorhabditis Extracts—In the course of our previous studies assaying core fucosyltransferase activity in crude worm extracts, we noticed a significant hexosaminidase activity at pH 6 when using GnGn or GnGnF6 with a preference also for the 1,3-arm (see also Fig. 6A). As discussed above in connection with recombinant HEX-2 and HEX-3, this specificity is reminiscent of the one determined to be present in microsomal membrane fractions of insect cells and of recombinant fruit fly FDL (21, 22). However, previous studies on C. elegans suggested that only M4Gn and MGn were substrates for a microsomal hexosaminidase (23). In preliminary trials, preparing the same type of Triton-washed microsomal fraction, however, did not result in observing any difference in the specificity; this procedure merely removed the low level of activity, which results in the presence of MM in the incubations. As with HEX-2 or HEX-3 when using GnGn-PA as a substrate, the native GnGn-digesting activity was reduced by 80% in the presence of 200 µM N-acetylcastanospermine and had an optimum at pH 5.5 (data not shown).
To prove more directly, than by the use of recombinant enzymes, whether our hypothesis as regards the in vivo functions of HEX-2 and HEX-3 was correct, mutants carrying deletions in selected C. elegans hexosaminidase genes were obtained, and these were analyzed for changes in enzyme activities and N-glycan structure. None of these mutants displayed obvious and consistent biological defects under standard laboratory conditions, a situation reminiscent of other C. elegans glycomutants (8, 10), but alterations in enzymatic activities were observed.
The hex-1 (tm1992) mutant had a normal ability to digest GnGn to GnM (Fig. 6A). On the other hand, this mutant displayed no chitotriosidase activity (Fig. 6C) and a much reduced ability to degrade p-nitrophenyl--N-acetylglucosaminide (data not shown). Thus, considering the properties of recombinant HEX-1, it is concluded that this enzyme is both the major p-nitrophenylhexosaminidase and the major chitotriosidase in the worm; on the other hand, despite its relationship to fruit fly FDL, it has no obvious role in N-glycan processing.
The hex-2 (tm2350) mutant was of particular interest, because, of the four "novel" worm hexosaminidases, the corresponding gene is the one with the most ubiquitous expression (see below). Also, as mentioned above, recombinant HEX-2 displayed the ability to specifically degrade GnGn to GnM as well as aid, in the presence of mannosidase II, the processing of Man5Gn to MM. Incubation of the extract of the hex-2 mutant with glycan substrates showed a greatly reduced activity toward GnGn (Fig. 6A) and a block in the processing of Man5Gn to MM, with only the products of mannosidase II (Man4Gn and MGn) being significantly present in the incubations (Fig. 6B). The latter HPLC elution data were verified by MALDI-TOF MS of the pooled fractions as shown by the presence of species with m/z 1214.497, 1376.584, and 1538.636, which correspond to pyridylaminated [M+Na]+ forms of MGn, Man4Gn, and Man5Gn. In contrast, the hex-2 mutant extract displayed normal activity toward chitotriose (Fig. 6C). The normal chitotriosidase and mannosidase II activities were considered to be an indication that only the N-glycan processing hexosaminidase was affected by the deletion. We, therefore, conclude that HEX-2 is an enzyme responsible for part of the specific hexosaminidase-mediated degradation of N-glycans observed in native nematode extracts in vitro.
|
|
1,4-galactosidase and either fucosidase or hexosaminidase resulted in a shift to peaks of lower retention time (peaks with the same retention times as MGn and MMF6 were, respectively, increased). Thus, our model was that peak G contains mainly an MGnF6 glycan carrying a 1,4-linked galactose (MGnF6Gal; see Scheme 1) on the core fucose residue, akin to a "complex core modification" found by Reinhold and co-workers in wild-type C. elegans (50) and by others on squid rhodopsin (51) and keyhole limpet hemocyanin (52). This presumption was confirmed by MALDI-TOF MS/MS (Fig. 9A), which resulted in the presence of a fragment of m/z 607, consistent with a Gal-Fuc-GlcNAc-PA structure. Another component of peak G with the composition Fuc2Hex4HexNAc3-PA was also examined by MS/MS (Fig. 9C), but no unambiguous assignment of the position of the second fucose was possible; the second fucose may either be on the terminal mannose or "second" core GlcNAc residue, as seen for other structures in previous reports on nematode glycans (50, 53). Finally, a putatively methylated form of MGnF6Gal eluting at 28 min (m/z 1514; peak H) was also sensitive to hexosaminidase and galactosidase digestion. Due to the presence of fragments corresponding to Hex3HexNAc3Me1-PA and Hex2HexNAc3-PA, it is hypothesized that the methyl group is attached to the unsubstituted non-reducing mannose residue (Fig. 9B). Such a modification of mannose by a methyl group has been reported for gastropod paucimannosidic N-glycans (54).
|
Differential Expression of Nematode Hexosaminidase Promoters—Considering the multiplicity of hexosaminidases in C. elegans, it was sought to examine whether they are expressed temporally and spatially in a differential manner. Therefore, promoter gfp reporter constructs were generated, which contained, in each case, the 2000 bp upstream of the start codon. These vectors, containing a copy of the unc-119 gene, were stably integrated into unc-119(ed3) mutants. Confocal microscopy of at least two independent lines for each gene showed a range of locations for the expression of these constructs. The hex-1 promoter was particularly active in coelomocytes as well as in neurons of the pharyngeal region and nerve cord (Fig. 10, A and B), as compared with the head and tail pattern observed in strain BC14144 (also carrying a hex-1::gfp construct) as part of a large-scale screen (55). The hex-2::gfp construct appeared to be active in the hypodermal cells, vulval toroids, and various adult head and tail neurons (Fig. 10, C–F), whereas the hex-3 construct was expressed in gut granules (Fig. 10G). The hex-4::gfp line displayed staining of seam cells in late embryos and L1 larvae (Fig. 10, H and I). Expression of hex-5 was restricted to certain cells at the 3-fold stage but was also present in the vulval, head (muscle), and tail regions in larval and adult worms (Fig. 10, J and K). Of the five promoters, hex-1, hex-2, hex-3, and hex-5 were expressed throughout the life-cycle, whereas hex-4 was restricted to the embryonal and L1 stages. Thus, to varying degrees, the results with these gfp constructs were indicative of both temporal and spatial differential expression of these genes and are in accordance with the results showing that a single hexosaminidase is not responsible for the presence of high amounts of paucimannosidic species in the N-glycan profile of wild-type worms.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
|
1,3-antennal GlcNAc residue on N-glycans as a previously characterized Golgi hexosaminidase found in extracts of Sf9 cells (22). On the other hand, the two recombinant Sf9 insect cell hexosaminidases characterized to date can remove both GlcNAc residues from GnGn (48, 49).
This latter property is shared with the AtHEX1 and AtHEX2 described in the present study, because these two putatively vacuolar enzymes also have no especially strict arm preference. The ability of AtHEX1 to cleave a plant-type GnGnXF3 glycan to a mixture of products was also observed (data not shown). In this respect, these recombinant plant enzymes mimic the activity of the commercially available jack bean hexosaminidase, and the products reflect that plant glycomes contain N-glycans with a GlcNAc on either the 1,3- or 1,6-arms, e.g. the MGnXF3 and GnMXF3 structures found in pollens (30) (see Scheme 1 for structures and Scheme 2 for a putative processing pathway). Another contrast to the insect (FDL) and nematode (HEX-2, HEX-3, and native) hexosaminidases is that the plant hexosaminidases will remove the non-reducing terminal GlcNAc from Man5Gn-type structures both in vitro, as shown in this study with AtHEX1, and in vivo, as exemplified by the presence of Man5XF3 in a mannosidase II knock-out plant (11) and in papaya (59).
Plants, Insects, and Nematodes Possess Family 20 Glycosidases with Chitotriosidase Activity—The third plant hexosaminidase, AtHEX3, is a putative chitotriosidase and, thus, shares some properties with the Hexo1 and Hexo2 from Drosophila (22); however, it is evolutionarily closer to fungal hexosaminidases with this type of activity and may, in conjunction with family 18 and 19 chitinases (60), have roles in defense-related chitin degradation in vivo. The nematode HEX-1, the major p-nitrophenyl--N-acetylglucosaminide-cleaving enzyme in the worm, is also a putative chitotriosidase; such an activity has been previously reported in C. elegans extracts (61). Chitin is a component of nematode eggshells, and C. elegans possesses two chitin synthase genes (62). Thus, exo- and endoglycosidases capable of degrading chitin can be expected in this organism and family 18 endochitinases have been described from other nematodes (61, 63). The hex-1 promoter-driven expression of GFP in coelomocytes may correlate with the degradative and scavenging function of these cells.
The Nematode Genome Encodes Unusual N-Glycan-specific Hexosaminidases—The nematode HEX-2 and HEX-3 remove specifically the 1,3-antennal GlcNAc residue (i.e. that transferred by GlcNAc-TI) from the GnGn N-glycan. Thus, their activity is akin to that of FDL, and this, therefore, suggests that the same basic mechanism for generation of paucimannosidic N-glycans operates in both insects and nematodes, i.e. that the residue transferred by GlcNAc-TI is removed; however, non-orthologous enzymes are responsible. On the other hand, HEX-2, HEX-4, and HEX-5 are capable of removing also the non-reducing terminal GalNAc residues from the GNGN N-glycan. It is unclear whether the latter reaction is physiological, but certainly C. elegans possesses a 1,4-N-acetylgalactosaminyltransferase (BRE-4) that can generate LacdiNAc moieties on N-glycans in vitro (64) and probably glycolipids in vivo (65). Although N-glycans with LacdiNAc moieties are not demonstrated on C. elegans, such structures are found in the nematode Trichinella spiralis (66).
|
Comparing Insect and Nematode N-Glycan Processing—One consideration with respect to N-glycan processing pathways in insects and nematode is that GnGn is probably not a dominant intermediate. Insect cells have apparently low levels of GlcNAc-TII (67, 68), thus reducing the potential GnGn pool within the secretory pathway; certainly, MM-related, and not GnM-related, structures dominate in both insects or nematodes. Thus, it is probable that MGn or MGnF6 are major in vivo substrates of the processing hexosaminidases in these organisms. Certainly, the D. melanogaster core 1,3-fucosyltransferase (FucTA) and the C. elegans core 1,6-fucosyltransferase are capable of modifying both MGn and Man5Gn in vitro (69); indeed, these enzymes must act on these glycans prior to removal of the non-reducing terminal GlcNAc residue. On the other hand, the C. elegans core 1,3-fucosyltransferase can accept MM and GnM, but not GnGn (28); this enzyme can also fucosylate Man5.4 Thus, as previously hypothesized (10, 17, 70) and as summarized in Scheme 2, a pathway of Man5 
Man5Gn MGn MGnF6 MMF6 MMF3F6 may operate in C. elegans, whereas in insects the order is slightly different: Man5 Man5Gn MGn MGnF6 MGnF3F6 MMF3F6, with the potential that some Man5 is directly converted to MM by a so-called mannosidase III (71). In the absence of processing hexosaminidase activity, an accumulation of Man3–5Glc-NAc3Fuc1 may result. Indeed in the fdl fruit fly mutant, MGnF6 is a dominant species in the glycan profile (22). This predicted effect, however, only occurs to a lesser extent in the nematode hex-2 mutant. This would correlate with the finding that the deletion of part of the hex-2 gene does not entirely abolish the GnGn-digesting activity in worm extracts. Thus, even though the hexosaminidase activity toward N-glycans is drastically reduced, this does not result in a lack of MM and MMF6. This effect is, though, partly reminiscent of an experiment with antisense-mediated knockdown of GlcNAc-TI in plants: a large decrease in enzyme activity had only a minor effect on the glycan profile (72). Presumably a small amount of a residual activity of a processing hexosaminidase (putatively HEX-3, whose promoter is also active in tissues in which the hex-2-driven GFP expression is absent) can be sufficient to generate a glycomic profile with MM and MMF6 remaining as major structures. Nevertheless, there is an impact on the glycome of the hex-2 mutant worm: glycans with an "extra" HexNAc, such as MGn and MGnF6, are more pronounced in the hex-2 N-glycome than that of wild-type N2 or hex-1 worms. Furthermore, as with the aman-2 mutant in which various non-wild-type hybrid glycans were present (10), unusual N-glycans result from knocking-out hex-2, presumably due to otherwise minor biosynthetic pathways being revealed. In particular, novel N-glycans of the form Fuc1–2Hex3–4HexNAc3Me0–1 are found in the hex-2 mutant, which are forms of MGn modified by galactosylated core fucose moieties, the latter modification having been previously found on other glycans in wild-type worms (50). Thereby, it is noteworthy how the use of nematode mutants aids identification or verification of new aspects of the glycomic capabilities of this species.
|
|
CONCLUSION |
|---|
|
TOP |
|---|
