Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M701984200 on July 26, 2007 Originally published In Press as doi:10.1074/jbc.M701984200 on July 24, 2007

J. Biol. Chem., Vol. 282, Issue 38, 27994-28003, September 21, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/38/27994    most recent
M701984200v2
M701984200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goedken, M.
Right arrow Articles by Nauseef, W. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goedken, M.
Right arrow Articles by Nauseef, W. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Impact of Two Novel Mutations on the Structure and Function of Human Myeloperoxidase*

Melissa Goedken{ddagger}, Sally McCormick{ddagger}, Kevin G. Leidal{ddagger}, Kazuo Suzuki§, Yosuke Kameoka, Joshua M. Astern||, Meilan Huang**, Artem Cherkasov**, and William M. Nauseef{ddagger}1

From the {ddagger}Inflammation Program, Department of Medicine, University of Iowa and Veterans Affairs Medical Center, Iowa City, Iowa 52241, §National Institute of Infectious Diseases, Toyama 1-23-1, Shinjuku-ku, Tokyo 162 8640, Japan, Laboratory of Genetic Resources, Division of Biomedical Resources, National Institute of Biomedical Innovation, 7-6-8, Saitoasagi, Ibaraki-City, Osaka, 567-0085, Japan, ||University of North Carolina, Kidney Center, Chapel Hill, North Carolina 27599, and **Division of Infectious Diseases, Department of Medicine, Faculty of Medicine, University of British Columbia, Vancouver V5Z 3J5, British Columbia, Canada

Received for publication, March 7, 2007 , and in revised form, July 23, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The heme protein myeloperoxidase (MPO) contributes critically to O2-dependent neutrophil antimicrobial activity. Two Japanese adults were identified with inherited MPO deficiency because of mutations at Arg-499 or Gly-501, conserved residues near the proximal histidine in the heme pocket. Because of the proximity of these residues to a critical histidine in the heme pocket, we examined the biosynthesis, function, and spectral properties of the peroxidase stably expressed in human embryonic kidney cells. Biosynthesis of normal MPO by human embryonic kidney cells faithfully mirrored events previously identified in cells expressing endogenous MPO. Mutant apopro-MPO was 90 kDa and interacted normally with the molecular chaperones ERp57, calreticulin, and calnexin in the endoplasmic reticulum. However, mutant precursors were not proteolytically processed into subunits of MPO, although secretion of the unprocessed precursors occurred normally. Although {delta}-[14C]aminolevulinic acid incorporation demonstrated formation of pro-MPO in both mutants, neither protein was enzymatically active. The Soret band for each mutant was shifted from the normal 430 to ~412 nm, confirming that heme was incorporated but suggesting that the number of covalent bonds or other structural aspects of the heme pocket were disrupted by the mutations. These studies demonstrate that despite heme incorporation, mutations in the heme environs compromised the oxidizing potential of MPO.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Phagocytes contribute significantly to human innate immunity, and polymorphonuclear neutrophils (PMN)2 are the predominant granulocyte in the circulation. When PMN are deficient in number or function, normal antimicrobial action is severely compromised, resulting in increased morbidity and mortality from infection. Well suited for the wide diversity of potential microbial challenges, PMN possess a broad array of responses by which to contain, control, kill, and degrade microorganisms, both in the phagosome and within the immediate cellular environs. These defenses include degradative and antimicrobial proteins, fabricated during myeloid development and stored within the granules, as well as reactive oxygen and nitrogen species generated de novo specifically in response to invasion. None of these elements functions alone, but rather there is extensive and overlapping collaborations within the context of the phagosome.

The most extensively studied example of the synergistic antimicrobial systems within human PMN is the myeloperoxidase-H2O2-halide system (1). PMN simultaneously activate the normally dormant NADPH oxidase and release granule contents in response to stimulation. The H2O2 produced by the multicomponent phagocyte NADPH oxidase (2) converts the azurophilic granule protein myeloperoxidase (MPO) from its resting state into compound I, a transient intermediate with potent oxidizing properties, which in turn oxidizes Cl- to Cl+, thereby generating the potent antimicrobial agent HOCl (3). In addition to HOCl, chloramines and other longer lived products of the MPO-H2O2-halide system have been implicated in mediating cytotoxicity to a broad array of microorganisms as well as mammalian proteins and cells (4–10). In its capacity as a peroxidase, the activity of MPO depends on a normal heme group, which in the case of MPO is a ferric protoporphyrin IX covalently linked to the protein backbone (11, 12). Data from the crystal structure of native human MPO indicate that the heme group stably interacts with the protein backbone via three covalent bonds and eight hydrogen bonds (11). Structural features unique to the heme group of MPO make it the only member of the animal peroxidase family capable of oxidizing chloride and thus generating HOCl, at physiologic pH (13–15).

Significant insights into the normal biosynthesis, structure, and function of MPO have been derived from studies of the functional impact of inherited mutations (reviewed in Ref. 6 and see Refs. 16–20). To date, none of the previously characterized genotypes has directly involved the region around the heme group of MPO. However, missense mutations at residue 5013 (glycine to serine, G501S) and residue 499 (arginine to cysteine, R499C) have been identified in two unrelated Japanese individuals with inherited MPO deficiency (21, 22). We describe here the structural and functional consequences caused by G501S and R499C, two mutations adjacent to the critical histidine 502 on the proximal side of the heme in MPO.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—K562 erythroleukemia cells and human embryonal kidney 293 (HEK) cells were obtained from American Type Culture Collection (Manassas, VA), ATCC CCL 243 and CRL-1573, respectively. Vectors pREP10 and pcDNA3.1 and antibiotics hygromycin and G-418 sulfate were obtained from Invitrogen; [35S]methionine/cysteine (26.7 x 107 Bq/0.5 ml) was from Amersham Biosciences. {delta}-[14C]Aminolevulinic acid (45.7 mCi/mmol) was custom-made by PerkinElmer Life Sciences. All tissue culture reagents were obtained from the University of Iowa Hybridoma Facility. Antibodies against calnexin and ERp57 were obtained from StressGen Bioreagents (Ann Arbor, MI). The monospecific rabbit antibody against human myeloperoxidase was generated in our laboratory (23), as was the rabbit antibody against human calreticulin (24), the latter available commercially from Affinity Bioreagents (Golden, CO). Endoglycosidase H and N-glycosidase F from Chryseobacterium meningosepticum were obtained from Calbiochem. Unless otherwise specified, all other reagents were purchased from Sigma.

Molecular Modeling—Reasoning that the missense mutations at residues 499 and 501 might adversely influence the structure around the heme in MPO, we modeled the active site of native and mutant forms of the protein. To that end, the three-dimensional structure of human MPO protein was retrieved from the protein data base (Protein Data Bank code 1D2V), and its heme-containing domain was subjected to simplistic energy minimization. For all three structures, we performed force field-based energy minimization of side chains in proximity to the heme to gain insight into the geometry and possible conformational changes of critical residues at the atomic level. We considered the heme, iron, and bromide ions and close proximity residues (Fig. 1). Mutant MPO structures were derived from the native MPO crystal structure by the in silico replacement of Arg-499 with cysteine and Gly-501 with serine using a molecular modeling package (Molecular Operation Environment, version 2004.10, Chemical Computation Group). The geometry of introduced residues of the mutant forms in the active site was minimized using the CHARMM 22 force field (25). The hydrogen atoms were added to the structures of native and mutated MPO protein using CHARMM HBUILD module, and their positions were further optimized.

Stably Transfected Cells Lines—K562 erythroleukemia cells were maintained in RPMI 1640 medium with 10% fetal calf serum, 2 mM L-glutamine, and penicillin/streptomycin at 37 °C in an atmosphere of 5% CO2 (18). HEK cells were maintained in Dulbecco's modified Eagle's medium/Ham's nutrient mixture F-12 medium supplemented with 10% fetal calf serum, 100 units/ml penicillin, 100 µg/ml streptomycin, 100 mM HEPES, and 2 mM L-glutamine. Stably transfected cell lines expressing G501S and R499C were created using the same approaches previously employed to analyze normal and specific mutants of human MPO (17). PCR was used to mutate Gly-501 or Arg-499 in normal MPO cDNA for heterologous expression in human cell lines that are devoid of endogenous MPO. The forward and reverse primers for mutagenesis of Gly-501 were GCCTTCCGCTACAGCCACACCCTCA and TGAGGGTGTGGCTGTAGCGGAAGGC, respectively, with the mutated residue indicated in boldface type, whereas primers ACCAATGCCTTCTGCTACGGCCACA and TGTGGCCGTAGCAGAAGGCATTGTT were used to create R499C. The presence of the desired mutation and absence of unintentional mutations were confirmed by sequencing the cDNA prior to transfection. Once the sequence of the desired mutant construct was confirmed, it was cloned into the expression vector (pREP10 for K562 cells and pcDNA3.1(-) for HEK cells). Stable transfectants were cloned by limiting dilution and selected using hygromycin and G-418 sulfate, respectively.

MPO Biosynthesis by Transfectants—Stable transfectants were used for the expression of wild-type and mutant forms of MPO (17, 18, 24, 26). Cells were maintained at low density in media supplemented with 2 µg/ml hemin for 24 h prior to labeling and placed in methionine-free RPMI medium supplemented with fetal calf serum and antibiotics for 1 h prior to pulse labeling with [35S]methionine/cysteine. Cells were labeled for the indicated period and then recovered or chased by the addition of 1000-fold excess of cold methionine, before solubilization for subsequent analysis.

MPO-related products were immunoprecipitated using antibodies against MPO, CRT, or CLN. Biosynthetically radiolabeled MPO-related proteins in cell lysates or culture medium were immunoprecipitated with monospecific, polyclonal rabbit anti-human MPO (17, 18, 24, 26–31) separated by SDS-PAGE, followed by autoradiography, and quantitated by direct measurement of radioactivity using a PhosphorImager (Typhoon 9410, Amersham Biosciences).

MPO-related species that were associated with CRT or CLN were recovered and quantitated using sequential immunoprecipitations (17, 24, 26). Cell lysates were immunoprecipitated first with CRT or CLN antiserum under nondenaturing conditions. The CRT- or CLN-associated proteins in the recovered complex were released by heating in the presence of 2% SDS, and the solution was cooled and diluted 10-fold before proceeding with the immunoprecipitation with MPO antiserum. CRT- and CLN-associated MPO species were separated by SDS-PAGE and quantitated using the PhosphorImager.

Heme acquisition was assessed by radiolabeling with {delta}-[14C]aminolevulinic acid, a precursor in heme synthesis, as done previously. Stable transfectants expressing normal or mutant MPO were cultured in the presence of {delta}-[14C]aminolevulinic acid overnight, followed by solubilization and immunoprecipitation of the cell lysate or conditioned culture media with MPO antibody, as described above. MPO species containing 14C were quantitated with the PhosphorImager.

MPO Activity—Four different assays were employed to assess MPO activity. Peroxidase activity of the expressed wild-type or mutant MPO was quantitated in two complementary ways. Nontransfected cells, normal MPO transfectants, and transfectants expressing mutant MPO were cultured in the presence of 2 µg/ml hemin for 48 h prior to recovery and solubilization for determination of enzymatic activity. Peroxidase activity was quantitated spectrophotometrically using o-dianisidine as a substrate (32). Peroxidase activity in cell lysates was also assessed by in situ staining in a native polyacrylamide gel. Duplicate samples were electrophoresed under nondenaturing conditions into two 10% polyacrylamide gels containing 0.05% (w/v) cetyltrimethylammonium bromide and 25% glycerol (w/v) in the absence of a stacking gel. Samples were electrophoresed at constant voltage (100 V) toward the cathode until the dye front was ~5 mm from the bottom of the gel (~5 h). To avoid permanently staining the Scotch Brite pads with crystal violet, we often electrophorese the dye front off the gel (800–1000 V-h) when subsequently blotting native gels. One gel was washed and stained with trimethylbenzidine to assess peroxidase activity (33–35). The other gel was soaked in transfer buffer for 1 h and then subjected to electroblotting to a nitrocellulose filter for 850 V-h. The resulting blot was blocked and then processed with MPO antiserum. By performing both analyses in parallel, peroxidase activity could be assigned to a specific protein immunochemically related to MPO.

The greater amounts of mutant protein generated by HEK transfectants made possible two additional assays that are specific for MPO. We quantitated the capacity of HEK cell lysates, either wild-type or transfectants expressing normal or mutant MPO, to consume H2O2, using a H2O2 electrode and modification of a method described previously (36). In the presence of chloride, H2O2 consumption by MPO reflected HOCl production. The electrode (Apollo 4000, World Precision Instruments, Sarasota, FL) was calibrated daily with dilutions of reagent grade H2O2 (0–20 mM), with the concentrations of the H2O2 standard verified spectrophotometrically using {epsilon}240 = 43.6 M-1 cm-1 (37). Cell lysates were added to known amounts of H2O2 in the presence of taurine, to scavenge HOCl and thus eliminate the possibility of its inactivation of the MPO (36), and the rate of H2O2 consumption was measured polarigraphically. Data are expressed as nanomoles H2O2 consumed per min per cell eq.

The lysates were likewise assessed for MPO-specific chlorinating capacity using the taurine chloramine assay (36). HOCl reacts with taurine to generate taurine monochloramine, which in turns reacts with 5-thio-2-nitrobenzoic acid to generate 5,5'-dithiobis(2-nitrobenzoic acid). The concentration of taurine monochloramine measured spectrophotometrically, {epsilon}412 = 14.1 M-1 cm-1, and its loss were monitored as a reflection of HOCl production. Lysates from wild-type or transfected cells were used as the potential peroxidase source, and acetaldehyde-xanthine oxidase served as a source for generating oxidants. Data are expressed as nanomoles of HOCl produced/min. All assays were performed in triplicate, and each experiment was performed at least three times. We confirmed our findings in a more sensitive and specific assay for MPO-dependent chloramine production that uses iodide-dependent oxidation of 3,3',5,5'-tetramethylbenzidine as substrate (38). As little as 200 pM MPO can be detected using this assay.

Glycosidase Susceptibility of MPO-related Proteins—Modifications of the carbohydrate side chains on MPO-related proteins were assessed by their relative susceptibility to endoglycosidases as done previously with MPO endogenously expressed in myeloid precursors (31, 39). MPO-related proteins were immunoprecipitated from cell lysates or culture medium at specified time points and treated with endoglycosidase H or N-glycanase to digest high mannose or complex carbohydrate side chains, respectively. Digested proteins and control immunoprecipitates were separated by SDS-PAGE and visualized by autoradiography.

Spectroscopy—Just as the endogenous MPO synthesized by myeloid precursors is largely compartmentalized into an intracellular organelle (1), MPO expressed by HEK cells was stored in membrane-bound organelles that could be recovered by differential centrifugation. HEK cells (1–2.5 x 108) were collected, treated with diisopropylfluorophosphate, washed, and resuspended in relaxation buffer (10 mM PIPES, 100 mM KCl, 3 mM NaCl, 3.5 mM MgCl2, 1 mM ATP, pH 7.3) at 2 x 107/ml. Cells were then disrupted by N2 cavitation (350 p.s.i.), and the cavitate was collected in a volume of EGTA, pH 7.4, to achieve a final concentration of 1.25 mM, using a method employed previously for recovering intact intracellular organelles from human neutrophils (40) and cultured promyelocytic cell lines (32). Unbroken cells and nuclei were removed by low speed centrifugation, and the supernatant was centrifuged at 12,000 x g for 20 min (4 °C) to recover a pellet enriched for dense intracellular organelles, including those containing MPO-related proteins. The pellet was resuspended in phosphate-buffered saline without calcium or magnesium, washed, and lysed by three freeze-thaw cycles using vigorous pipetting. Vigorous pipetting at each step was essential to maximize vesicle disruption. The clarified supernatant after pellet lysis was scanned from 400 to 600 nm in a Lambda 40 spectrophotometer (PerkinElmer Life Sciences). In addition, oxidation-reduction difference spectroscopy was performed, using dithionite to reduce the lysate in the sample cuvette. The concentration of normal MPO was calculated for oxidized samples using {epsilon}430 = 91 mM-1 cm-1 (41). For turbid samples reduced minus oxidized difference spectra were obtained, and the concentration was calculated using {epsilon}473 = 75 mM-1 cm-1 (41). For assays using mutant MPO, the same extinction coefficients were employed to approximate the concentrations of G501S and R499C.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Identification of MPO-deficient Subjects—As part of ongoing studies of the prevalence of inherited MPO deficiency in Japan (42), individuals with partial or complete deficiency were identified using automated flow hematocytochemistry to screen large populations. Among these deficient individuals were two with missense mutations in MPO, G501S, and R499C, that had not been reported previously. In both cases, the individuals were asymptomatic and had not suffered from frequent or severe infectious complications, as described in the detailed clinical reports (21, 22, 42).


Figure 1
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 1.
Models of the heme pockets of normal and mutant MPO. A, proximal heme-binding residue, His-502, and heme iron are depicted in a CPK model. His-502 anchors 6-coordinated Fe3+ ion of the heme from the underneath position, leaving the sixth coordination site above the heme available to react with substrate. B, normal MPO is depicted in green, R499C in yellow, and bromide (representing the halide-binding site) in orange. The proximity of the sulfur atom of the cysteine of R499C is sufficient to exert significant electrostatic effect on the heme iron. C, normal MPO is depicted in green, with G501S in gray. Because of steric limitations, the replacement of glycine with serine at residue 501 may significantly compromise heme binding. Furthermore, if possible, substitution of the flexible Gly-501 residue with serine would compromise backbone flexibility (backbone "hinge") in the heme pocket and consequently promote the departure of the His-502 anchoring side chain from the iron ion.

 
Predictions Derived from Molecular Modeling—Given the availability of the crystal structure of human MPO (11), we modeled the heme pocket of specific mutants at residues 499 and 501 for comparison with the native protein and to gain insight into their potential impact on MPO enzymatic activity. The iron ion in native MPO has six coordination sites as follows: four sites are mediated by pyrrole nitrogen atoms in the heme, and the fifth coordination is the axial His-502–iron bond. The sixth coordination site on the iron ion is vacant and serves to accept electrons and thereby participate in the electrochemistry of the iron-catalyzed oxidation (43) (Fig. 1A).

The heme in MPO is covalently bound to the protein through two ester linkages and a methionyl sulfonium linkage (11). In addition to the three covalent bonds, electrostatic interactions with pyrrole rings C and D contribute to the structure and stability of the heme pocket in MPO. The guanidinium group of Arg-499, as well as that of Arg-590, forms hydrogen bonds with the carboxyl group of a propionate in ring D (11). Replacement of Arg-499 with any residue that eliminates this electrostatic interaction would likely compromise heme binding and stability. Furthermore, after arranging the side chains in R499C to optimize favorable interactions with the molecular neighbors, the model of the heme pocket predicted sufficient space and side chain mobility to afford close proximity between its sulfur atom and the heme iron, if heme were incorporated into the pocket lacking the stabilizing arginine at 499. Whether in a neutral or deprotonated state, the sulfur introduced by R499C could coordinate with the iron, thereby forming a relatively strong interaction at ~2.5 Å (Fig. 1B). Such strong polar or covalent interaction could significantly compromise redox properties of the iron ion and thereby compromise the enzymatic activity of the mutant protein. Thus, the model predicts two consequences from R499C, one reflecting the loss of an important stabilizing electrostatic interaction with arginine and the other the introduction of a disruptive cysteine.

The optimized model of G501S likewise demonstrated potential changes that could compromise the function of the heme (Fig. 1C). The replacement of glycine with serine may leave inadequate space to stably accommodate the heme group. Furthermore, if the substitution was tolerated, replacement of glycine with serine would reduce the flexibility of the protein backbone in the heme environs. Although the highly flexible Gly-501 in native MPO allows close approximation of the aromatic nitrogen in His-502 below the heme iron atom, the loss of flexibility after the serine replacement might disturb proper heme function. Taken together, the simplistic models of each of the naturally occurring mutations in such close proximity to the redox center of MPO predicted structural consequences likely to compromise optimal function of the heme group.

Failure of G501S Precursor to Undergo Proteolytic Maturation—To examine directly the impact of these missense mutations on the fate of the protein, we created stable transfectants and compared synthesis of the mutant proteins with that of normal MPO. Stably transfected K562 cells expressing normal or G501S MPO were radiolabeled for 1 h and chased for 0 or 20 h before recovery of cells and the conditioned medium for immunoprecipitation. K562 transfectants expressing either normal or G501S MPO synthesized a 90-kDa protein after 1 h of labeling (Fig. 2). In the case of normal MPO, the 90-kDa protein underwent proteolytic processing during the 20 h of chase to yield the 59- and 13.5-kDa subunits of mature MPO. However, the precursor in G501S cells failed to yield the 59-kDa heavy subunit, and more of the 90-kDa precursor was present during the chase period in G501S-expressing cells than in transfectants expressing normal MPO, indicating that the absence of mature MPO reflected failure to undergo processing into MPO subunits and not the rapid degradation of the mutant G501S precursor.


Figure 2
View larger version (34K):
[in this window]
[in a new window]

  		FIGURE 2.
Biosynthesis of normal and G501S MPO by transfected K562 cells. K562 cells stably transfected with wild-type MPO (WT) or G501S mutant MPO (G501S) were pulse-labeled with [35S]methionine and chased for 0 or 20 h. Cell lysates at 0 and 20 h and culture medium at 20 h were immunoprecipitated with anti-MPO. Immunoprecipitates were separated by SDS-PAGE, and dried gels were subjected to autoradiography. Cells expressing G501S synthesized and secreted a 90-kDa precursor form of MPO but failed to process it into the mature MPO, represented by the generation of the 59-kDa heavy subunit of the native protein.

 


Figure 3
View larger version (16K):
[in this window]
[in a new window]

  		FIGURE 3.
Glycosylation of normal and G501S MPO produced by K562 transfectants. After 1 h of biosynthetic pulse labeling with [35S]methionine and a 20-h chase, cell lysates and culture medium from K562 cells expressing normal (WT) or mutant (G501S) MPO were immunoprecipitated with anti-MPO. Immunoprecipitates were incubated with buffer alone (C), endoglycosidase H (H), or N-glycanase (N) before recovery and analysis by SDS-PAGE and autoradiography. Fully glycosylated precursor migrated at 90 kDa, whereas the nonglycosylated product was 80 kDa. Arrows indicate individual glycosylated products. For both normal and mutant MPO, secreted MPO precursors were more resistant to endoglycosidase H digestion than were the intracellular forms.

 
Normal and G501S-expressing cells secreted the same amounts of 90-kDa MPO protein into the culture medium during the chase period (Fig. 2), suggesting that normal amounts of the G501S precursor entered the secretory pathway despite the failure of proteolytic maturation to proceed. As reported previously for normal MPO biosynthesis (20), ~10% of MPO precursor is secreted constitutively and undergoes limited modification of its oligosaccharide side chains during transit through the Golgi, whereby the secreted species is partially resistant to endoglycosidase H digestion (39). To determine whether the secreted MPO precursor from transfectants expressing G501S underwent oligosaccharide modification, the lysates of pulse-labeled cells and supernatants conditioned by the 20-h chase period were recovered from each cell line, immunoprecipitated with MPO antiserum, and subjected to digestion with endoglycosidase H or N-glycanase to cleave high mannose or both high mannose and complex mannose side chains, respectively. The oligosaccharides on the intracellular 90-kDa MPO precursors of normal and G501S were both fully susceptible to digestion with endoglycosidase H, indicating that the side chains were exclusively high mannose in nature (Fig. 3). However, the carbohydrates on the secreted MPO precursor were partially endoglycosidase H-resistant, as evidenced by limited digestion with endoglycosidase H but complete removal by N-glycanase treatment. The G501S mutant behaved in a fashion identical to that of normal MPO, suggesting that the G501S precursor entered the constitutive secretory pathway and was modified by Golgi resident enzymes in a normal fashion.


Figure 4
View larger version (16K):
[in this window]
[in a new window]

  		FIGURE 4.
Association of molecular chaperones with normal and G501S MPO in K562 cells. K562 transfectants expressing normal (wild type) or G501S MPO were biosynthetically radiolabeled for 1 h and chased with cold methionine for 0–4 h. Cell lysates were immunoprecipitated with anti-MPO or sequentially with anti-CRT or anti-CLN followed by anti-MPO. Resulting immunoprecipitates were analyzed by SDS-PAGE and autoradiography. Like normal MPO, the G501S precursor associated transiently with CRT and CLN.

 
During normal biosynthesis MPO precursors interact transiently with calreticulin (CRT), calnexin (CLN), and ERp57 (20), all molecular chaperones in the ER that contribute to the proper folding of many glycoproteins (44). Pulse-labeled K562 cells transfected with normal or G501S MPO were chased for 0, 1, 2, or 4 h, and the lysates were immunoprecipitated in parallel with antibodies against MPO, CRT, or CLN under nondenaturing conditions, as described previously. To recover the CRT- and CLN-associated MPO precursor at each time point, the immunoprecipitates were denatured and subjected to a second immunoprecipitation using the MPO antibody (Fig. 4). In both transfectants expressing normal and G501S MPO, the recoveries of CRT-associated and CLN-associated MPO precursor were the same as reported previously for normal MPO (24, 26), suggesting that the interactions between CRT or CLN with MPO precursors were not significantly altered by the G501S missense mutation.

Activity of G501S Precursors Expressed in K562 Cells—Normal MPO biosynthesis requires the insertion of heme into apopro-MPO in the ER, thereby converting an enzymatically inactive 90-kDa MPO precursor into a 90-kDa protein with peroxidase activity (45). We assessed first the peroxidase activity of the G501S product spectroscopically using o-dianisidine as the substrate. K562 cells lack endogenous MPO (18) and exhibited very low background peroxidase activity in this assay (0.9 IU). In contrast, an identical number of PLB-985 cells, a human promyelocytic cell line that actively synthesizes structurally and functionally normal MPO (24), had 17.2 IU of peroxidase activity. K562 cells transfected with normal MPO had 4.9 IU of peroxidase activity (n = 5), whereas G501S transfectants had 0.5 IU of activity, levels indistinguishable from base line. Because we were concerned that the relatively low efficiency of MPO expression in the K562 cell system might undermine our capacity to detect very low levels of activity by the G501S, we examined the suitability of using HEK cells for biosynthetic studies, based on its successful application to generating recombinant protein for use in immunological characterization of anti-MPO-mediated vasculitis (46).

MPO Biosynthesis by HEK Transfectants—Wild-type HEK cells lack endogenous MPO, but after transfection synthesized heme-containing precursors that underwent normal proteolytic processing to mature MPO and efficient targeting to an intracellular, membrane-bound compartment that could be pelleted by centrifugation (Fig. 5). All aspects of MPO biosynthesis seen in cultured myeloid cells were reproduced in the HEK-MPO system. Specifically, the 90-kDa apopro-MPO acquired heme in the ER to form pro-MPO and precursors interacted with molecular chaperones ERp57, CRT, and CLN (Fig. 6) with the same selectivity previously reported for the K562 transfectants (24, 26). Heme acquisition was necessary for exit from the ER and for proteolytic processing to mature subunits, with the latter event inhibited by disruption of the Golgi by treatment with brefeldin A (data not shown). Approximately 10% of MPO precursor entered the secretory pathway and underwent limited modification of its oligosaccharide side chains, as seen with MPO endogenously produced by cultured promyelocytes (39). The spectral properties of MPO-enriched pellets recovered from stable transfectants were identical to those of normal MPO (see below), with a {lambda}max of 430 nm for the oxidized sample and a Soret band at 473 nm for the reduced minus oxidized spectroscopy (41). Taken together, the data indicate that the HEK transfectants faithfully mirrored the events in normal MPO biosynthesis previously identified in myeloid precursors.


Figure 5
View larger version (72K):
[in this window]
[in a new window]

  		FIGURE 5.
Biosynthesis of normal MPO by stably transfected HEK cells. Wild-type HEK cells (WT) or HEK cells stably expressing normal MPO were biosynthetically radiolabeled, with intervals of chase of 0 and 20 h. Cell lysates and culture medium were immunoprecipitated with anti-MPO and the immunoprecipitates analyzed by SDS-PAGE and autoradiography. Wild-type HEK cells lacked endogenous MPO. When expressed in HEK cells, MPO precursors were synthesized, secreted, and proteolytically processed intracellularly in a fashion identical to that seen in myeloid cells expressing endogenous MPO.

 


Figure 6
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 6.
Association of molecular chaperones with normal MPO in stably transfected HEK cells. Stably transfected HEK cells expressing normal (wild-type MPO) or R499C mutant were biosynthetically radiolabeled for 1 h and immunoprecipitated with anti-MPO or antibodies against the molecular chaperones CRT, CLN, or ERp57 under nondenaturing conditions. Immunoprecipitates were analyzed by SDS-PAGE and autoradiography. Molecular chaperones coprecipitated with precursors of normal and mutant MPO (results representative of three independent experiments).

 
Most important for our studies was the improved level of MPO expression in HEK cells relative to that in the K562 transfectants. Wild-type HEK cells lack any evidence of endogenous MPO, as judged immunochemically, spectroscopically, or by assessing enzymatic activity. In contrast, the specific activity of HEK-MPO (4.2 nmol of H2O2 consumed per min/pmol MPO, n = 3) was the same as partially purified MPO recovered from granules of normal PMN (3.3 nmol of H2O2 consumed per min/pmol MPO, n = 3) or the human promyelocytic cell line PLB-985 cultured in hemin (3.6 nmol of H2O2 consumed per min/pmol MPO, n = 3). Although the amount of MPO in transfectants (3.9 pmol of MPO/106 cells, n = 3) was lower than that in normal PMN (11.7 pmol of MPO/106 cells, n = 3) or in PLB-985 cells grown in the presence of hemin (11 pmol of MPO/106 cells, n = 3), HEK transfectants provided a system to yield levels of protein sufficient to perform spectroscopy and reliably assess function of specific mutants.

HEK-R499C, a Second Mutation Near the Critical Proximal Histidine in the Heme Pocket—To assess the impact of the R499C missense mutation on MPO biosynthesis both in relation to normal MPO and to G501S, we created stably transfected HEK cell lines expressing the mutant forms of MPO. After1hof biosynthetic labeling with [35S]methionine, HEK-R499C associated with CRT, CLN, and ERp57 to the same extent as did wild-type MPO (Fig. 6), and the rates of dissociation during the chase were likewise the same (data not shown). Both R499C and G501S lacked enzymatic activity in native activity gels (Fig. 7). The HEK-R499C resembled G501S with respect to proteolytic processing, as both mutations resulted in synthesis of a 90-kDa species that was secreted normally but was not processed into mature subunits after a 20-h chase (Fig. 8A). As both mutants were enzymatically inactive and failed to undergo normal maturation, we anticipated that neither incorporated heme. However, transfectants expressing normal or mutant MPO and labeled with {delta}-[14C]aminolevulinic acid, a precursor of heme, synthesized the 90-kDa pro-MPO that was released into the culture medium (Fig. 8B). When normalized for the [35S]methionine content in MPO precursors, heme incorporation was 28.7 ± 2.9 and 23.7 ± 1.6% of control for R499C and G501S, respectively (n = 3). Based on these data and the amount of heme in HEK-MPO cells (3.9 pmol/106 cells), we estimate that R499C and G501S transfectants contained ~1.12 and 0.92 pmol of heme-containing MPO-related protein per 106 cells. Thus, in both mutants there was a maturation arrest at the stage of heme incorporation, whereby heme acquisition by mutant apopro-MPO was inefficient or the mutant pro-MPO was unstable and rapidly degraded. The stability of the mutant precursors was not increased by culturing cells in the presence of proteasome inhibitors (data not shown), in contrast to the proteasome-mediated degradation seen with the MPO mutant Y173C (17), indicating that if degradation of mutant proteins occurred, it was not mediated by the proteasome.


Figure 7
View larger version (49K):
[in this window]
[in a new window]

  		FIGURE 7.
Peroxidase activity of R499C MPO. Wild-type HEK cells, HEK cells stably transfected with R499C or normal MPO (MPO), or purified MPO (2 µg) were separated in two identical native gels. Resultant gels were stained for peroxidase activity (A) or electroblotted to nitrocellulose and probed with anti-MPO (B). No peroxidase activity was identified in HEK cells or in R499C-HEK cells, whereas HEK-MPO cells exhibited peroxidase activity (A). The lack of activity in R499C-HEK cells did not reflect the absence of the mutant protein from the gel, as demonstrated by the presence of immunoreactive protein in the R499C-HEK cell immunoblot (B).

 


Figure 8
View larger version (56K):
[in this window]
[in a new window]

  		FIGURE 8.
Biosynthetic incorporation of heme into normal, R499C, and G501S MPO. HEK transfectants expressing normal MPO, R499C, or G501S were pulse-labeled with [35S]methionine and chased for 20 h (A) or labeled with {delta}-[14C]aminolevulinic acid (B). The resultant cell lysates and culture media were immunoprecipitated with anti-MPO and analyzed by SDS-PAGE and autoradiography. Given the relative specific activities of the radioisotopes used, autoradiographs were exposed for 6 h or 11 days for 35S and 14C, respectively. Although heme was incorporated into the 90-kDa pro-MPO and 59-kDa mature subunit in HEK-MPO cells, heme acquisition for G501S and R499C was limited to the mutant 90-kDa pro-MPO form. When normalized for the amount of [35S]methionine-labeled MPO precursor, heme incorporation for G501S and R499C was 23.7 ± 1.6 and 28.7 ± 2.9% of that for normal MPO. Values represent mean ± S.E., n = 3.

 
Given the failure of either mutant to exhibit peroxidase activity in vitro, we anticipated that neither would chlorinate taurine. Neither G501S nor R499C chlorinated taurine (data not shown), and the capacity for G501S or R499C to consume H2O2 was low, 0.52 and 0.65 nmol/min/cell eq, respectively, and no different from that of wild-type HEK cells (0.91 nmol/min/cell eq). In contrast, HEK transfectants expressing normal MPO were fully active (5.75 nmol/min/cell eq), suggesting that although the mutant had incorporated heme, the resultant pro-MPO was not competent to mediate peroxidative events. To compare the spectral properties of normal and mutant proteins, samples enriched for the intracellular compartment in HEK cells containing normal and mutant MPO were prepared. The presence of MPO-related proteins in each pellet was confirmed by immunoblotting (data not shown). Although all four samples had identical spectra in the 200–400 nm range (data not shown), significant differences were noted in the Soret absorbance region. Wild-type HEK cells lacked a Soret peak between 400 and 500 nm (Fig. 9), whereas the pellets recovered from normal PMN or from HEK transfectants expressing normal MPO exhibited a peak at 430 nm, characteristic of MPO (41). In contrast, pellets from HEK transfectants expressing R499C or G501S exhibited a Soret band at 414 nm, with no detectable signal at 430 nm. The observed red shift of the absorbance peak in the mutant proteins suggests that each of the alterations near histidine 502, critical for binding on the proximal side of the heme, altered the structural conformation of the heme.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Mature MPO normally resides exclusively in the azurophilic granules of PMN and monocytes, compartments containing a variety of hydrolytic enzymes (for review of MPO biology see Ref. 1). Concomitant activation of the NADPH-dependent oxidase, a source of reactive oxygen species including H2O2, and release of granule contents, including MPO, into the newly formed phagolysosome, deliver to the ingested microorganism a variety of toxic reactants that synergistically mediate efficient killing (reviewed in Ref. 3). Among these noxious agents is HOCl, the result of the unique property of MPO to catalyze the 2-electron peroxidation of Cl- in the presence of H2O2 (47). HOCl is extremely toxic to bacteria; 108 HOCl molecules/cell can kill 5 g of Escherichia coli, whereas >1011 molecules of H2O2 (under metal-free conditions) or hydroxyl radical are necessary to achieve the same cytotoxicity (48–50). Several lines of evidence support the importance of the MPO-H2O2-Cl- system in oxygen-dependent microbicidal activity against a wide spectrum of organisms, including viruses, bacteria, fungi, protozoa, and tumor cells as well as promoting inflammation per se (reviewed in Ref. 47). Given that MPO and its unique chemistry appear especially well suited for a central role in antimicrobial activity, elucidation of critical structural determinants is essential to understand the basis for its biological action.

Heme peroxidases can be categorized into three superfamilies based on sequence: catalases, plant peroxidases, and mammalian peroxidases (51). Mammalian peroxidases include the cyclooxygenase and myeloperoxidase families, the latter composed of MPO, eosinophil peroxidase (EPO), lactoperoxidase (LPO), and thyroid peroxidase (TPO) (52, 53). These peroxidases share the unique property of having two or three covalent bonds between the heme and the mature enzyme. Availability of an expression system for MPO biosynthesis and processing that faithfully mirrors the endogenous events in myeloid cells is an analytical tool necessary for the study of structure-function relationships in the heme pocket of animal peroxidases. Previous studies of the structural features of the heme environment of MPO that employed mutagenesis (reviewed in Ref. 54) relied on recombinant protein isolated from transfectants unable to synthesize the functional, normal subunits of MPO. The recombinant MPO produced in Chinese hamster ovary cells used for these studies has oligosaccharide side chains significantly different from native MPO, fails to undergo proteolytic processing into mature subunits, and is expressed only in the monomeric form (55). Such differences may have functional consequences. For example, mutation of Met-409 to the corresponding residue in EPO (Thr), TPO (Val), or LPO (Gln) altered the spectral properties of the recombinant protein and eliminated its peroxidase activity (56), an unexpected finding given that this replacement normally exists in these related peroxidases. Given the quality control operative in the ER during MPO biosynthesis (17, 57, 58), it is possible that the observed deviations from normal biosynthesis have structural consequences that may undermine the interpretation of studies using the Chinese hamster ovary-derived recombinant protein.


Figure 9
View larger version (15K):
[in this window]
[in a new window]

  		FIGURE 9.
Spectral properties of normal and R499C MPO. The 48,000 x g pellet recovered from wild-type (WT) HEK cells or from HEK cells stably expressing normal MPO or the R499C mutant was scanned spectrophotometrically. Whereas pellets from wild-type HEK lysates lacked a Soret band, cells expressing normal MPO exhibited the ~430 nm peak characteristic of MPO. In contrast, the peak from R499C-HEK cells was shifted to 414 nm. Spectra are representative of three independent experiments.

 
Although K562 transfectants expressing normal MPO recapitulate biosynthetic events seen in myeloid cells expressing endogenous MPO, the yields of recombinant protein are insufficient for structural or functional studies. As an essential component of this study, we established that HEK cells stably transfected with normal MPO exhibited seminal features of the biosynthesis and proteolytic processing of MPO as first characterized in myeloid precursors (reviewed in Ref. 17 and see Refs. 18, 24, 26, 28, 30, 31, 57, 59–63). The primary translation product in HEK cells underwent cotranslational cleavage of the signal peptide, N-linked glycosylation, and limited deglucosylation of high mannose oligosaccharide side chains to generate the 90-kDa, enzymatically inactive precursor apopro-MPO that interacted in the ER transiently and reversibly with the molecular chaperones ERp57, CRT, and CLN with subsequent incorporation of heme to generate the enzymatically active 90-kDa pro-MPO. Heme synthesis inhibition blocked proteolytic maturation as well as export of MPO precursor from the ER, indicating that its acquisition of heme induced conformational changes necessary for successful maturation and intracellular targeting. Although 10% of pro-MPO entered the secretory pathway and was recovered from the culture media, as reported for myeloid cells (64, 65), most pro-MPO underwent modification of oligosaccharide side chains and proteolytic processing en route to a membrane-bound intracellular compartment. We believe that our expression system provides sufficient material that mirrors the native protein and is thus especially well suited to address several specific questions of structure-function relationships raised by its crystal structure.

Among the animal peroxidases, only MPO has been crystallized, with structures of both the human and canine enzyme published. Based on the crystal structure of human MPO at 1.8 Å (11), the heme pocket is in a crevice ~15–20 Å deep and is solvent-accessible via an open channel at the catalytic site on the distal side of the heme (53). There is significant amino acid identity among the animal peroxidases in the four helices that surround the heme group, and several lines of evidence (4, 66–68) implicate five residues in binding heme in MPO. Histidines at residues 261 and at 502 represent the distal and proximal ligands, respectively, and heme is covalently bound to MPO at three sites as follows: through a methionyl sulfonium linkage with Met-409 and through ester linkages to Glu-408 and Asp-260 (11, 69). The heme-protein interaction is further stabilized by hydrogen bonding between the carbonyl groups of ring C and D propionates and Thr-266, Asp-264, Arg-499, Arg-590, and water molecules (11). Although crystal structures for other family members have not been solved, modeling of homologous domains, NMR, mass spectrometry, and peptide analysis support the presence of the same two ester linkages in LPO, EPO, and TPO (11, 70–74). Ester bonds account for the 10 nm shift in the Soret band of LPO, EPO, and TPO relative to horseradish peroxidase, and the presence of the third covalent bond in MPO causes the red shift of the Soret band of oxidized MPO ({lambda}max = 430 nm) relative to the spectral peak for the other family members ({lambda}max = 412 nm) (73, 75, 76). The peculiar sulfonium linkage in MPO likely contributes as well to its unique facility to oxidize Cl- to HOCl at physiologic pH. The presence of covalent bonds between the prosthetic group and the protein is a feature unique to the animal peroxidases (51), and a H2O2-dependent autocatalytic process has been implicated in ester bond formation (72), although the precise mechanisms of ester bond formation in animal peroxidases and of sulfonium linkage in MPO in vivo are unknown. Although at least one covalent bond is required for peroxidase activity and the presence of covalent bonds with heme is a feature shared by all animal peroxidases, the functional or biological advantage of covalently bound heme is not known (73). Recent studies indicate that the presence of a single covalent bond between the heme group and its protein is sufficient to protect the heme vinyl group from modification by hypohalous acid generated by peroxidases (77–79). In this way, peroxidases such as MPO can generate large amounts of HOCl and its by-products within the neutrophil phagosome without incurring autoinactivation by modification of the heme vinyl groups and subsequent inactivation.

In this study we describe the impact of two novel mutations on the biosynthesis and function of human MPO. The target residues, Gly-501 and Arg-499, are present on the proximal side of the heme pocket and are conserved in all four members of the animal peroxidase family. Although both missense mutations compromised proper proteolytic processing and intracellular targeting of mature MPO, the precursors for each incorporated heme, albeit inefficiently. Both biosynthetic radiolabeling of heme (Fig. 8) and spectroscopy (Fig. 9) demonstrated the presence of small amounts of heme in the proproteins of G501S and R499C. However, the Soret band was blue-shifted in each, demonstrating a spectrum more akin to that seen with LPO, TPO, or EPO rather than that characteristic of native MPO. Although the spectra of the mutants were consistent with the presence of heme covalently bound, likely via two rather than three bonds, neither had enzymatic activity. Given the known electrostatic interaction between Arg-499 and the ring D propionates of the heme in MPO, we predicted that the loss of this critical arginine would itself compromise heme binding and stability. Furthermore, the presence of cysteine at this site might allow a strong polar or covalent interaction between the sulfur atom in Cys-499 and the heme iron, which could reduce the oxidation potential and enzymatic activity of the mutant MPO. In the case of changes at codon 501, glycine may be the only amino acid at that site that allows optimal heme binding, consistent with our spectral data indicating incorporation of only small amounts of heme. For any serine that is incorporated in the heme pocket, our modeling of G501S suggested that its dysfunction reflects the increased distance between the heme iron and its distal histidine at 502, which is predicted to be twice that present in normal MPO, consistent with the loss of one coordination site for the heme iron, as suggested experimentally by the spectroscopy.

Taken together, these studies of biosynthesis and biochemical characterization of mutant MPO expressed in HEK cells demonstrated the structural and functional impact of two naturally occurring missense mutations underlying hereditary myeloperoxidase deficiency. Future applications of these analytical techniques to other mutations, both experimentally created and spontaneously occurring, should provide novel insights regarding the structure-function relationships unique to the animal peroxidase protein family.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grant HL 53592 and a Merit Review from Veterans Affairs (to W. M. N.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Inflammation Program, and Dept. of Medicine, Roy J. and Lucille A. Carver College of Medicine, University of Iowa, D160 MTF, 2501 Crosspark Road, Coralville, IA 52241. Tel.: 319-335-4278; Fax: 319-335-4194; E-mail: william-nauseef{at}uiowa.edu.

2 The abbreviations used are: PMN, polymorphonuclear neutrophil; MPO, myeloperoxidase; HEK, human embryonic kidney; PIPES, 1,4-piperazinediethanesulfonic acid; EPO, eosinophil peroxidase; LPO, lactoperoxidase; TPO, thyroid peroxidase; ER, endoplasmic reticulum; CRT, calreticulin; CLN, calnexin. Back

3 Because considerations of MPO include the propeptide, our amino acid designations are 166 greater (for the 166 amino acids in the propeptide) than those used by Fenna and co-workers (11, 53). Back


   ACKNOWLEDGMENTS
 
We thank Dr. Ramaswamy Subramanian for advice on mutational analysis.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Klebanoff, S. J. (2005) J. Leukocyte Biol. 77, 598-625[Abstract/Free Full Text]
  2. Nauseef, W. M. (2004) Histochem. Cell Biol. 122, 277-291[CrossRef][Medline] [Order article via Infotrieve]
  3. Hampton, M. B., Kettle, A. J., and Winterbourn, C. C. (1998) Blood 92, 3007-3017[Free Full Text]
  4. Hazen, S. L., Hsu, F. F., Mueller, D. M., Crowley, J. R., and Heinecke, J. W. (1996) J. Clin. Investig. 98, 1283-1289[Medline] [Order article via Infotrieve]
  5. Hazen, S. L., Hsu, F. F., and Heinecke, J. W. (1996) J. Biol. Chem. 271, 1861-1867[Abstract/Free Full Text]
  6. Henderson, J. P., Byun, J., and Heinecke, J. W. (1999) J. Biol. Chem. 274, 33440-33448[Abstract/Free Full Text]
  7. Hazen, S. L., d'Avignon, A., Anderson, M. M., Hsu, F. F., and Heinecke, J. W. (1998) J. Biol. Chem. 273, 4997-5005[Abstract/Free Full Text]
  8. Hazen, S. L., Hsu, F. F., d'Avignon, A., and Heinecke, J. W. (1998) Biochemistry 37, 6864-6873[CrossRef][Medline] [Order article via Infotrieve]
  9. Domigan, N. M., Charlton, T. S., Duncan, M. W., Winterbourn, C. C., and Kettle, A. J. (1995) J. Biol. Chem. 270, 16542-16548[Abstract/Free Full Text]
  10. Winterbourn, C. C., Pichorner, H., and Kettle, A. J. (1997) Arch. Biochem. Biophys. 338, 15-21[CrossRef][Medline] [Order article via Infotrieve]
  11. Fiedler, T. J., Davey, C. A., and Fenna, R. E. (2000) J. Biol. Chem. 275, 11964-11971[Abstract/Free Full Text]
  12. Furtmüller, P. G., Zederbauer, M., Jantschko, W., Helm, J., Bogner, M., Jakopitsch, C., and Obinger, C. (2006) Arch. Biochem. Biophys. 445, 199-213[CrossRef][Medline] [Order article via Infotrieve]
  13. Furtmüller, P. G., Burner, U., and Obinger, C. (1998) Biochemistry 37, 17923-17930[CrossRef][Medline] [Order article via Infotrieve]
  14. Marquez, L. A., and Dunford, H. B. (1994) J. Biol. Chem. 269, 7950-7956[Abstract/Free Full Text]
  15. Furtmüller, P. G., Obinger, C., Hsuanyu, Y., and Dunford, H. B. (2000) Eur. J. Biochem. 267, 5858-5864[Medline] [Order article via Infotrieve]
  16. Marchetti, C., Patriarca, P., Solero, G. P., Baralle, F. E., and Romano, M. (2004) Hum. Mutat. 23, 496-505[CrossRef][Medline] [Order article via Infotrieve]
  17. DeLeo, F. R., Goedken, M., McCormick, S. J., and Nauseef, W. M. (1998) J. Clin. Investig. 101, 2900-2909[Medline] [Order article via Infotrieve]
  18. Nauseef, W. M., Cogley, M., and McCormick, S. (1996) J. Biol. Chem. 271, 9546-9549[Abstract/Free Full Text]
  19. Nauseef, W. M., McCormick, S., and Goedken, M. (2000) Redox Rep. 5, 197-206[CrossRef][Medline] [Order article via Infotrieve]
  20. Hansson, M., Olsson, I., and Nauseef, W. M. (2006) Arch. Biochem. Biophys. 445, 214-224[CrossRef][Medline] [Order article via Infotrieve]
  21. Ohashi, Y. Y., Kameoka, Y., Persad, A. S., Koi, F., Yamagoe, S., Hashimoto, K., and Suzuki, K. (2004) Gene (Amst.) 327, 195-200[CrossRef][Medline] [Order article via Infotrieve]
  22. Persad, A. S., Kameoka, Y., Kanda, S., Niho, Y., and Suzuki, K. (2006) Gene Expr. 13, 1-5[Medline] [Order article via Infotrieve]
  23. Nauseef, W. M., Root, R. K., and Malech, H. L. (1983) J. Clin. Investig. 71, 1297-1307[Medline] [Order article via Infotrieve]
  24. Nauseef, W. M., McCormick, S. J., and Clark, R. A. (1995) J. Biol. Chem. 270, 4741-4747[Abstract/Free Full Text]
  25. MacKerell, A. D., Bashford, D., Bellott, M., Dunbrack, R. L., Jr., Evanseck, J. D., Field, M. J., Fischer, S., Gao, J., Guo, H., Ha, S., Joseph-McCarthy, D., Kuchnir, L., Kuczera, K., Lau, F. T. K., Mattos, C., Michnick, S., Ngo, T., Nguyen, D. T., Prodhom, B., Reiher, W. E., III, Roux, B., Schlenkrich, M., Smith, J. C., Stote, R., Straub, J., Watanabe, M., Wiórkiewicz-Kuczera, J., Yin, D., and Karplus, M. (1998) J. Phys. Chem. B 102, 3586-3616
  26. Nauseef, W. M., McCormick, S. J., and Goedken, M. (1998) J. Biol. Chem. 273, 7107-7111[Abstract/Free Full Text]
  27. Bülow, E., Nauseef, W. M., Goedken, M., McCormick, S., Calafat, J., Gullberg, U., and Olsson, I. (2002) J. Leukocyte Biol. 71, 279-288[Abstract/Free Full Text]
  28. Nauseef, W. M., McCormick, S., and Yi, H. (1992) Blood 80, 2622-2633[Abstract/Free Full Text]
  29. Nauseef, W. M., Olsson, I., and Strömberg-Arnljots, K. (1988) Eur. J. Haematol. 40, 97-110[Medline] [Order article via Infotrieve]
  30. Nauseef, W. M. (1986) Blood 67, 865-872[Abstract/Free Full Text]
  31. Nauseef, W. M. (1987) Blood 70, 1143-1150[Abstract/Free Full Text]
  32. Nauseef, W. M., and Clark, R. A. (1986) Blood 68, 442-449[Abstract/Free Full Text]
  33. Olsen, R. L., and Little, C. (1983) Biochem. J. 209, 781-787[Medline] [Order article via Infotrieve]
  34. Pember, S. O., Shapira, R., and Kindade, J. M., Jr. (1983) Arch. Biochem. Biophys. 221, 391-403[CrossRef][Medline] [Order article via Infotrieve]
  35. Van Dalen, C. J., Whitehouse, M. W., Winterbourn, C. C., and Kettle, A. J. (1997) Biochem. J. 327, 487-492[Medline] [Order article via Infotrieve]
  36. Kettle, A. J., and Winterbourn, C. C. (1994) Methods Enzymol. 233, 502-512[Medline] [Order article via Infotrieve]
  37. Beers, R. J., and Sizer, I. W. (1952) J. Biol. Chem. 195, 133-140[Free Full Text]
  38. Dypbukt, J. M., Bishop, C., Brooks, W. M., Thong, B., Eriksson, H., and Kettle, A. J. (2005) Free Radic. Biol. Med. 39, 1468-1477[CrossRef][Medline] [Order article via Infotrieve]
  39. Andersson, E., Hellman, L., Gullberg, U., and Olsson, I. (1998) J. Biol. Chem. 273, 4747-4753[Abstract/Free Full Text]
  40. Borregaard, N., Heiple, J. M., Simons, E. R., and Clark, R. A. (1983) J. Cell Biol. 97, 52-61[Abstract/Free Full Text]
  41. Bos, A. J., Wever, R., and Roos, D. (1978) Biochim. Biophys. Acta 525, 37-44[Medline] [Order article via Infotrieve]
  42. Kameoka, Y., Persad, A. S., and Suzuki, K. (2004) Jpn. J. Infect. Dis. 57, S12-S13[Medline] [Order article via Infotrieve]
  43. Battistuzzi, G., Bellei, M., Zederbauer, M., Furtmüller, P. G., Sola, M., and Obinger, C. (2006) Biochemistry 45, 12750-12755[CrossRef][Medline] [Order article via Infotrieve]
  44. Helenius, A., Trombetta, E. S., Hebert, D. N., and Simons, J. F. (1997) Trends Cell Biol. 7, 193-200[CrossRef][Medline] [Order article via Infotrieve]
  45. Arnljots, K., and Olsson, I. (1987) J. Biol. Chem. 262, 10430-10434[Abstract/Free Full Text]
  46. Erdbrügger, U., Hellmark, T., Bunch, D. O., Alcorta, D. A., Jennette, J. C., Falk, R. J., and Nachman, P. H. (2006) Kidney Int. 69, 1799-1805[CrossRef][Medline] [Order article via Infotrieve]
  47. Klebanoff, S. J. (1999) Proc. Assoc. Am. Physicians 111, 383-389[Medline] [Order article via Infotrieve]
  48. Elzanowska, H., Wolcott, R. G., Hannum, D. M., and Hurst, J. K. (1995) Free Radic. Biol. Med. 18, 437-449[CrossRef][Medline] [Order article via Infotrieve]
  49. Wolcott, R. G., Franks, B. S., Hannum, D. M., and Hurst, J. K. (1994) J. Biol. Chem. 269, 9721-9728[Abstract/Free Full Text]
  50. Hurst, J. K., and Lymar, S. V. (1999) Acc. Chem. Res. 32, 520-528[CrossRef]
  51. Dunford, H. B. (1999) Heme Peroxidases, 1st Ed., pp. 528, Wiley-VCH, New York
  52. Kimura, S., and Ikeda-Saito, M. (1988) Proteins 3, 113-120[CrossRef][Medline] [Order article via Infotrieve]
  53. Zeng, J., and Fenna, R. E. (1992) J. Mol. Biol. 226, 185-207[CrossRef][Medline] [Order article via Infotrieve]
  54. Moguilevsky, N. (2000) in The Peroxidase Multigene Family of Enzymes (Nauseef, W. M., and Petrides, P. E., eds) pp. 38-44, Springer-Verlag, New York
  55. Moguilevsky, N., Garcia-Quintana, L., Jacquet, A., Tournay, C., Fabry, L., Piérard, L., and Bollen, A. (1991) Eur. J. Biochem. 197, 605-614[Medline] [Order article via Infotrieve]
  56. Kooter, I. M., Moguilevsky, N., Bollen, A., van der Veen, L. A., Otto, C., Dekker, H. L., and Wever, R. (1999) J. Biol. Chem. 274, 26794-26802[Abstract/Free Full Text]
  57. Nauseef, W. M. (1999) J. Lab. Clin. Med. 134, 215-221[CrossRef][Medline] [Order article via Infotrieve]
  58. Nauseef, W. M. (2003) in Calreticulin (Eggleton, P., and Michalak, M., eds) pp. 63-74, Landes Bioscience, Georgetown, TX
  59. Johnson, K. R., Nauseef, W. M., Care, A., Wheelock, M. J., Shane, S., Hudson, S., Koeffler, H. P., Selsted, M., Miller, C., and Rovera, G. (1987) Nucleic Acids Res. 15, 2013-2028[Abstract/Free Full Text]
  60. Nauseef, W. M. (1989) Blood 73, 290-295[Abstract/Free Full Text]
  61. Nauseef, W. M., Brigham, S., and Cogley, M. (1994) J. Biol. Chem. 269, 1212-1216[Abstract/Free Full Text]
  62. Nauseef, W. M. (1998) J. Mol. Med. 76, 661-668[CrossRef][Medline] [Order article via Infotrieve]
  63. Nauseef, W. M. (1988) in Hematology/Oncology Clinics of North America (Curnutte, J. T., ed) pp. 135-158, W. B. Saunders Co., Philadelphia
  64. Yamada, M., Hur, S.-J., and Toda, H. (1990) Biochem. Biophys. Res. Commun. 166, 852-859[CrossRef][Medline] [Order article via Infotrieve]
  65. Yamada, M., Mori, M., and Sugimura, T. (1981) Biochemistry 20, 766-771[CrossRef][Medline] [Order article via Infotrieve]
  66. Kettle, A. J., and Winterbourn, C. C. (1990) Biochim. Biophys. Acta 1052, 379-385[Medline] [Order article via Infotrieve]
  67. Zgliczynski, J. M., Stelmaszynska, T., Domanski, J., and Ostrowski, W. (1971) Biochim. Biophys. Acta 235, 419-424[Medline] [Order article via Infotrieve]
  68. Strauss, R. R., Paul, B. B., Jacobs, A. A., and Sbarra, A. J. (1971) Infect. Immun. 3, 595-602[Abstract/Free Full Text]
  69. Henderson, L. M., and Chappell, J. B. (1996) Biochim. Biophys. Acta 1273, 87-107[Medline] [Order article via Infotrieve]
  70. DeGioia, L., Ghibaudi, E. M., Laurenti, E., Salmona, M., and Ferrari, R. P. (1996) J. Biol. Inorg. Chem. 1, 476-485[CrossRef]
  71. Ferrari, R. P. (2000) in The Peroxidase Multigene Family of Enzymes: Biochemical Basis and Clinical Applications (Petrides, P. E., and Nauseef, W. M., eds) pp. 114-121, Springer-Verlag, Berlin
  72. DePillis, G. D., Ozaki, S., Kuo, J. M., Maltby, D. A., and Ortiz de Montellano, P. R. (1997) J. Biol. Chem. 272, 8857-8860[Abstract/Free Full Text]
  73. Colas, C., and Ortiz de Montellano, P. R. (2003) Chem. Rev. 103, 2305-2332[CrossRef][Medline] [Order article via Infotrieve]
  74. Fayadat, L., Niccoli-Sire, P., Lanet, J., and Franc, J.-L. (1999) J. Biol. Chem. 274, 10533-10538[Abstract/Free Full Text]
  75. Kooter, I. M., Moguilevsky, N., Bollen, A., Sijtsema, N. M., Otto, C., and Wever, R. (1997) J. Biol. Inorg. Chem. 2, 191-197[CrossRef]
  76. Brogioni, S., Feis, A., Marzocchi, M. P., Zederbauer, M., Furtmüller, P. G., Obinger, C., and Smulevich, G. (2006) J. Raman Spectrosc. 37, 263-276[CrossRef]
  77. Huang, L., Wojciechowski, G., and Ortiz de Montellano, P. R. (2006) J. Biol. Chem. 281, 18983-18988[Abstract/Free Full Text]
  78. Huang, L., Wojciechowski, G., and Ortiz de Montellano, P. R. (2005) J. Am. Chem. Soc. 127, 5345-5353[CrossRef][Medline] [Order article via Infotrieve]
  79. Huang, L., and de Montellano, P. R. O. (2006) Arch. Biochem. Biophys. 446, 77-83[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/38/27994    most recent
M701984200v2
M701984200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goedken, M.
Right arrow Articles by Nauseef, W. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goedken, M.
Right arrow Articles by Nauseef, W. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement