|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 282, Issue 38, 28074-28086, September 21, 2007
Transcriptional Regulation of AQP-8, a Caenorhabditis elegans Aquaporin Exclusively Expressed in the Excretory System, by the POU Homeobox Transcription Factor CEH-6*
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Consistent with the excretory cell's role in osmoregulation, previous experiments have shown that the excretory duct cell pumping rates in dauer larvae (a nematode diapause state induced by adverse environmental pressures) were inversely proportional to environmental osmotic pressures (5). Laser ablation of the excretory cell, duct cell, or pore cell leads to fluid retention within the worm (5). These two examples clearly demonstrate that the nematode excretory system is an osmoregulatory organ and therefore functionally analogous to the vertebrate kidney (1). The constrained developmental processes for such a unique structure and the physiological properties of the excretory cell make it an ideal tissue for studies on transcriptional regulation and how they relate to both renal and neuronal development. In addition, the excretory cell is the largest single cell in the worm making it ideal for studies of gross morphological defects.
To maintain fluid homeostasis between an organism and its environment and between tissues, members of the aquaporin (AQP)6 family of water channels are expressed in various tissues and developmental stages in all forms of life to facilitate water movement across biological membranes. The existence of AQPs in virtually all cells allows for bidirectional passive flux of water across lipid bilayers, which in the absence of these proteins are essentially impermeable barriers. In addition, many cell types incorporate multiple different AQPs per cell and/or tissue. The spatial and temporal expression redundancy of AQPs may explain the relative lack of resultant gross phenotypes in AQP knock-out studies. AQPs have been discovered in all types of organisms, from mammals to a recently discovered 270-amino acid homolog, AQPV1, in the Chlorella virus MT325s (6).
The first AQP cloned, the 28-kDa protein AQP1, is a common protein in human red blood cell plasma membranes occurring at a level of
120,000-160,000 copies per cell (7, 8). Besides transporting water, many AQP members have the capacity to transport other small non-charged molecules. Selectivity of the channel for different uncharged solutes is derived from a proton filter region in the protein characterized by a pore-associated arginine residue in association with neighboring aromatic amino acids (9). Due to these different channel specificities, AQPs are grouped into two functionally distinct classes: the aquaporins, which are exclusively water channels, and the aquaglyceroporins, which also have the ability to transport small non-ionic molecules such as glycerol and urea (10). AQPs contain a pair of signature domains, the NPA motifs (asparagine-proline-alanine, or in some cases, asparagine-proline-valine), which are essential for the pore structure and function (10). The locations of the NPA amino acid residues allow passage of water through the pore. Due to hydrogen bonding interactions, the molecules travel through the pore in a single file manner (11). Overall, each AQP1 unit has the capacity to allow the passage of three billion molecules of water per second (11). An additional requirement for a functional aquaporin is a conserved fold in the protein, which has been observed in both AQP1 and the bacterial aquaglyceroporin, GlpF (11). Some AQPs can be blocked by Hg2+ at a pore-associated cysteine residue (12).
In humans, 7 of 13 identified AQPs are expressed in various parts of the kidney to maintain osmotic balance and to prevent excessive fluid loss (13). The C. elegans genome contains eleven AQPs (aqps 1-11) (14). Like their mammalian counterparts, C. elegans AQP-4 (F40F9.9) and AQP-2 (C01G6.1), have been shown to be involved in fluid homeostasis. These results were obtained by physiological experiments determining changes in water flux as a result of the insertion of AQPs into Xenopus laevis oocyte membranes (15-17). In addition, AQP-4 was shown to be inhibited by Hg2+, much like other aquaporins (12, 16, 17). The expression patterns for the C. elegans AQPs 1-8 have been determined previously (15). Three of the eight AQPs studied were demonstrated to be expressed in the excretory cell (aqp-2, aqp-3, and aqp-8) (15).
Prior studies have identified DNA regions containing functional cis-regulatory elements of various AQPs. Areas containing positive acting cis-regulatory elements for human AQP1 have been determined by analyzing the transcriptional activity of various length gene-upstream fragments (18). Regions containing negative transcriptional regulators of mouse AQP2 have also been determined (19). In addition, human AQP4, which has two splice variants that lead to isoforms with distinct N termini and pore permeability properties, has been shown to be under the control of alternate upstream regulatory sequences directly upstream of each splice variant (20). Studies in plants have also revealed regions containing cis-regulatory elements, which modulate AQPs. An analysis of the AthH2 (PIP1b), an Arabidopsis AQP, upstream regulatory region revealed two phytohormone-induced enhancer-containing regions (21).
In this study we have determined a cis-regulatory element that is required for the expression of an aquaporin in the excretory cell of C. elegans. Information pertaining to AQP expression and regulation in the excretory system of C. elegans will provide complementary information to previous studies on transcriptional regulation of aquaporins and to also perhaps provide a basis for determining mechanisms controlling transcription in mammalian renal and neuronal tissues.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
|
pes-10::GFP). All GFP variants used are modified by the addition of a 5'-nuclear localization, 3'-unc-54-untranslated region, S65C mutation, and additional synthetic introns. Site-directed mutagenesis of the motif site was carried out via nucleotide substitutions corresponding to residue changes in the motif in the forward primer. In all cases except the
pes-10::GFP fusion construct and the AQP-8::GFP translational fusion construct, the reverse primer for upstream regulatory region amplification is aqp-8R: agtcgacctgcaggcatgcaagcttagaaacggatcgcagaaaa.
The forward primers used for amplification of deletional constructs are shown in supplemental Table S1. The forward primers used for mutagenesis of the cis-regulatory element are as follows (mutated residues are underlined): aqp-8 oct G
A: ttgccaaaatttacatactggaat and aqp-8 oct C
G: ttgccaaaatttggatactggaat. Primers used for tandem motif fusion to
pes-10::GFP are as follows: 4XOCTR: agtcgacctgcaggcatgcaagcttatgcaaatttatgcaaattta. 4XOCTL: aatttgcataaatttgcataaatttgcataaatttgcata. The reverse primer used for generating the translational AQP-8::GFP construct was AQP-8protB: TTTCTACCGGTACCCTCAAGGGtccactactgtcactatactctctgtca. The forward primer used for the translational construct corresponds to aqp-8-1.6kb (supplemental Table S1).
PCR constructs were co-injected with the Dpy-5 rescuing construct, pCeh361 (24), into the syncitial gonad of late L4 dpy-5(e907) worms. Wild-type F1 worms were plated individually. Wild-type F2 worms were selected to start the lines. In the case of generating multiple independent lines, each were analyzed separately and designated as individual segregants (Table 1).
Microscopy—A Zeiss Axioscope equipped with a QImaging camera and the appropriate optical filter sets were used for GFP expression pattern analysis. Worms were immobilized with 100 mM sodium azide (in water) immediately prior to imaging. All images were taken at 400x with identical camera settings for all images (exposure times are indicated in the figures). Images were captured using QCapture software and processed using Adobe Photoshop CS.
Sequence Analysis—DNA and peptide sequence alignments were carried out using ClustalX (25) with default settings. The DNA sequence spanning the bases -283 to -234 upstream of the C. elegans aqp-8 translational start site was used as a query in the Transcriptional Element Search System (TESS) to identify potential conserved transcription factor binding sites. Default parameters were used.
Electrophoretic Mobility Shift Assay—Nuclear and cytoplasmic extracts were isolated from N2 worms harvested in M9 buffer. The extracts were prepared using the NE-PER Nuclear and Cytoplasmic Extraction Reagents Kit (Pierce). The synthetic biotinylated oligonucleotides used in this study include the consensus octamer oligonucleotide, 5'-ATTGCCAAAATTTGCATACTGGAAT-3' and its complement 5'-ATTCCAGTATGCAAATTTTGGCAAT-3'. EMSA reactions were carried out using the LightShift Chemiluminescent EMSA Kit (Pierce). Samples were then loaded into an 8% non-denaturing polyacrylamide gel and electrophoresed in 0.5x Tris/Borate buffer at 100 V for 1 h. The entire gel electrophoresis apparatus was chilled using an ice-bath during operation.
RNAi—Adult BC6925 (AQP-8::GFP-expressing) worms were injected with 200 ng/µl dsRNA corresponding to either eri-1 (control) or a mixture of both eri-1 and ceh-6 dsRNA (experimental). The progeny of the injected worms were scored 48 h post-injection for the presence of GFP fluorescence in the excretory cell using a standard image exposure time of 1 s with identical camera settings for all images.
Bioinformatic Analysis—To identify genes that are potentially regulated by CEH-6 and the POU homeobox transcription factor DNA binding site (ATTTGCAT) in C. elegans, we carried out a bioinformatics search. We searched the putative upstream regions (in this analysis defined as 1000 bp upstream of the translational start site (ATG)) of all C. elegans protein-coding genes, as well as the gene-upstream regions of genes in the related nematodes C. briggsae and C. remanei, for the motif ATTTGCAT. A C. elegans gene is considered if its C. briggsae and C. remanei orthologs both contain one or more octamer motifs as well. To achieve this, genome sequences of these three Caenorhabditis species and the predicated motifs were loaded into a MySQL data base using the GFF3 format. Comparative analysis is done by Perl using a Bio::DB::GFF module (26). Candidate C. elegans CEH-6-regulated genes were examined for their expression patterns by searching a C. elegans GFP expression data base.7
|
S,
v. The resulting probability is |S|/|N|. | RESULTS |
|---|
|
|
|---|
The closest mammalian homolog of C. elegans AQP-8 is AQP10, an aquaglyceroporin predominantly expressed in the jejunum glands (Crypts of Lieberkühn), and the duodenum epithelia. The jejunum glands function to secrete various digestive enzymes and contain mitotically active stem cells for the purpose of epithelial regeneration. A possible role for AQP10 is to regulate osmolarity in these regions of the small intestine that are known to be subject to considerable changes in solute concentrations. In particular, stringent regulation of duodenum osmolytes may be due to large changes in solute concentrations as undiluted stomach contents are passed directly through to it (31). Like AQP-8, vertebrate AQP10 has two isoforms with five (30 kDa) and six (35 kDa) transmembrane domains, respectively (32). Though bona fide transcripts have been identified for the shorter splice variants of both AQP-8 and AQP10, it is possible that these isoforms are non-functional. Unlike AQP-8, AQP10 can conduct both water and glycerol (15, 32). It has been suggested, however, that AQP-8 may be important for adaptation to osmotic stress, because its expression levels have been observed to be induced significantly when worms are placed under hypotonic stress (15). The two NPA domains in K02G10.7b are located between the transmembrane segments II/III and V/VI, which correspond to the locations of the NPA domains in human AQP1. A null mutant of aqp-8 (tm1919) does not show any obvious structural defects in the excretory cell or any assayable response to changes in osmotic pressures (data not shown). Likewise, treatment of nematodes with RNAi corresponding to aqp-8, clone sjj_K02G10.7 (33), did not result in any obvious change in response from that of wild-type worms when placed in media containing different levels of salinity (data not shown). Although loss of AQP-8 itself does not lead to an observable phenotype, quadruple mutants of aqp-2, aqp-3, aqp-4, and aqp-8 have been shown to lead to worms with impaired mobility when subjected to hypotonic environments (15). To determine whether AQP-8 remains in the excretory cell after translation, we generated a K02G10.7 translational GFP fusion. This construct consisted of GFP (pPD 95.75) fused in-frame at the C terminus of a PCR product consisting of aqp-8's 1.6-kb upstream region and coding sequence. Localization of AQP-8 was identical to the expression pattern revealed by the transcriptional GFP fusions albeit displaying a lesser level of fluorescence than worms carrying the promoter::GFP (and promoter::GFP-PEST) constructs (Fig. 1, D and E). The lower fluorescence level of the translational reporter construct relative to the transcriptional reporter constructs may be attributable to a higher protein turnover of the AQP-8::GFP protein relative to untagged GFP.
Determination of Upstream Regions Required for Excretory Cell Expression of aqp-8—The initial expression pattern analysis of aqp-8 was examined for two constructs in vivo using the 1.6-kb fragment fused to both GFP and GFP-PEST. To map the upstream DNA elements responsible for the excretory system-specific expression of aqp-8 in C. elegans, a series of fragments consisting of progressive 5' deletions of the upstream regulatory region of aqp-8 were fused to the GFP or GFP-PEST coding cassettes. A cis-regulatory element was initially localized to a region spanning the nucleotides -342
-207. A further round of deletions within the defined window resolved the cis- regulatory element containing region to an interval between -279 and -261. GFP expression levels and patterns of the transgenics were consistent with the original 1.6-kb aqp-8 upstream constructs' expression pattern until loss of expression in -261 constructs and all subsequent shorter constructs (Fig. 2). From the deletion analysis of the upstream regulatory region, we have determined that aqp-8 expression is modulated by at least one cis-regulatory element located within the 19-bp interval spanning -279 to -261bp relative to the translational start site of aqp-8.
Phylogenetic Footprinting of the aqp-8 Gene Upstream Region—Although the morphologies of the two nematode species, C. briggsae and C. elegans, are similar, analysis of the mutation rates in gene ortholog pairs have revealed that the two species have diverged
80-110 million years ago (34). Because their general body plan and developmental programs have changed very little over the long evolutionary distance, most DNA coding regions and functional non-coding DNA elements are likely to be under purifying selection. With the availability of both of their genomic sequences, we can compare orthologous non-coding genomic regions to identify conserved functional nucleotide regions. In addition to the extensively curated C. elegans (14) and annotated C. briggsae (34) genome sequences, the recent availability of two other closely related nematode genome sequences, C. remanei and C. brenneri, allows for a multiple alignment of the four species' orthologous upstream regions. A ClustalX alignment revealed a perfectly conserved 10-bp region between the four nematode species (AATTTGCATA) that falls within the region (-279 bp to -261 bp), in C. elegans, determined by the upstream regulatory region-deletional analysis (Fig. 3). The distances between the start of the motif and the translational start sites were fairly well conserved with the positions in C. remanei (-277 bp) and C. briggsae (-283 bp). The similarity in the upstream distance of the motifs indicates that the position of the element relative to the translational start site may be important for the ability of the element to modulate gene expression. Positional preference of cis-regulatory elements upstream of the gene translational start sites in C. elegans has been observed with the X-box (35), E-box, SMAD, and CdxA (36) transcription factor binding motifs.
|
A change at position -264 (Fig. 4, A and B). The single residue change did not lead to a change in the GFP expression level. Previous studies have shown that the site, ATTTACAT, and/or its reverse complement, ATGTAAAT, are functional POU transcription factor binding sites (46, 47). Changing the adjacent downstream residue in the octamer site (ATTTGCAT
ATTTGGAT) lead to a complete loss of GFP expression (Fig. 4, A and B). Crystallographic studies of the Oct1 POU domain bound to an octamer motif containing DNA strand have shown that the -263 G
C change affects a DNA binding site amino acid in the POUs region of the transcription factor (38). The POU homeobox DNA-interacting amino acid residues, which contact this region of the DNA octamer motif, are highly conserved among POU transcription factor homologs in both mammals and C. elegans (data not shown).
|
pes-10::GFP cassette (pPD97.78, kindly provided by A. Z. Fire, Stanford University School of Medicine). The
pes-10::GFP cassette is composed of the minimal promoter from C. elegans pes-10 fused to a GFP reporter. Alone, the
pes-10::GFP reporter construct has minimal transcriptional activity. The minimal promoter can be activated by the presence of upstream enhancers for the purpose of determining the transcriptional activities of the introduced cis-linked elements. Using the
pes-10::GFP construct, we tested for the ability of the putative cis-regulatory element to act as an excretory system enhancer. We fused four tandem repeats of the 10-bp nematode conserved sequence (AATTTGCATA) to the 5'-end of the
pes-10::GFP cassette (Fig. 4C). The resulting GFP fluorescence, driven by the tandem repeats fused to the basal promoter, was observed in the excretory cell beginning at L1 and continuing into adulthood much like the expression pattern of the aqp-8::GFP constructs, albeit at a much lower level than the initial GFP-expressing constructs (Figs. 4C and 5). We did not detect expression in the additional cell identified earlier as possibly the excretory gland cell. This may be due to expression of GFP in the additional cell being below the detection level of the microscope configuration used or that expression in the gland cell is controlled by a separate cis-regulatory element. Additional GFP fluorescence arising from this construct was detected in two anterior neurons. The expression in the anterior neurons indicates that the octamer motif may also be responsible for recruiting transcription factor(s) responsible for driving expression in those neurons. The lower excretory cell expression level can be explained by the possibility of additional expression enhancing cis-regulatory elements, which exist downstream of the octamer element that were not included in the sequence fused to the
pes-10::GFP cassette. Another possible explanation is that the expression level may be dependent upon the distance between the cis-regulatory element and the translational start site.
|
|
Confirmation of the CEH-6-Octamer Interaction—To verify the dependence of aqp-8 transcription on CEH-6, we knocked down CEH-6 in an AQP-8::GFP-expressing background using RNAi (49). We performed a double RNAi experiment using both aqp-8 and eri-1 dsRNA. eri-1 encodes an small interfering RNase, which expresses in C. elegans gonadal and nervous tissue. Knocking down ERI-1 leads to a pronounced RNAi effect in the tissues, in which ERI-1 is expressed (50). Treatment of the AQP-8::GFP-expressing worms with eri-1 dsRNA (n = 30) failed to down-regulate AQP-8::GFP expression in any worms, however, the double RNAi treatment of AQP-8::GFP-expressing worms with both eri-1 and ceh-6 dsRNA (n = 30) led to a consistent complete elimination of GFP expression in the excretory cell when scored 48 h post-injection (Fig. 5). The double dsRNA treatment led to developmental arrest at the L2 stage larva as a result of knocking down ceh-6 expression. This phenotype is consistent with the phenotype of the ceh-6(mg60) null mutant showing that the double dsRNA treatment is effectively knocking down ceh-6 expression. Developmental arrest was not observed for worms injected with eri-1 dsRNA alone (scored at 72 h post treatment, data not shown). Taken together, we show that CEH-6 is the POU transcription factor that regulates aqp-8 via binding to its cognate octameric POU homeobox transcription factor binding site.
Determination of Other Candidate Genes Modulated by CEH-6—With the confirmed interaction of CEH-6 with the octamer element, we searched for instances in which the octamer motif was conserved between these three nematode species: C. elegans, C. briggsae, and C. remanei to determine other potentially co-regulated genes. Four sets of analyses were done according to different filtering criteria. The common criteria among all four sets were that the gene is orthologous in C. elegans, C. briggsae, and C. remanei and that there is at least one octamer motif predicted in the upstream-regulatory region. The other criteria specific for each set are summarized in Table 2. 107 genes were identified with perfect motif matches among the three genomes under the most relaxed condition, and 44 genes were identified under the strictest condition (supplemental Table S2). Of the candidate genes identified, promoter::GFP expression pattern data have been generated for 19 (relaxed condition; all) and ten (strictest condition; S.E.) of the upstream regulatory regions using promoter::GFP reporter constructs, respectively (29) (Table 2). Three genes that contain excretory cell expression are consistently observed for all gene sets (Table 3). To determine whether octamer motifs are enriched in genes expressed in excretory cells, we carried out statistical analysis calculating the significance of observing three excretory cell expressions. We found that the probabilities were 0.3556 and 0.0857 for the most relaxed and most stringent conditions, respectively (Table 2). Of the 28 gene candidates identified with the least stringent conditions (S.E.) (Table 3), 17 genes have associated gene ontology terms (supplemental Table S3) and thus provide a starting point for determining the physiological role of AQP-8 and its orthologs.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
12% of C. elegans excretory expressing genes may be transcriptionally regulated by the EX-1 cis-regulatory motif in conjunction with its cognate transcription factor, DCP-66 (51). DCP-66 is a widely expressed transcription factor and has been shown to be expressed in neurons, the pharynx, body wall muscle, excretory cell, and vulva (51). Close homologs of DCP-66 generally act as transcriptional repressors, although in the case presented by Zhao et al. (51), DCP-66 clearly acted as a positive regulator of gene expression. In addition, Zhao et al. (51) reported two other cis-regulatory elements that mediate gene expression in the excretory cell. Although the expression of AQP-8 is tightly regulated in the excretory system, all of the transcriptional regulatory elements that contribute to its expression pattern have not been elucidated. Previous studies have reported the expression pattern of AQP-8, but we have discovered that expression is found in another cell, which we presume to be the excretory gland cell. Moreover, using a reporter protein with a limited half-life, we have determined a precise temporal window of expression for aqp-8. Here we present a novel model of transcriptional regulation, which is the interaction of the POU homeobox transcription factor, CEH-6, with an octamer motif in the upstream regulatory region of aqp-8.
The binucleate excretory gland cell is the product of a cell fusion. Although the gland cell has been proposed to function as a secretory organ, based on its morphology, it is the only non-vital cell in the excretory system. Laser ablation of the gland cell does not lead to any obvious shortcomings in worm development or function under standard laboratory conditions (5). Clues as to the excretory gland cell's role in the worm can be inferred by virtue of its possible co-developmental regulation with the excretory cell.
Expression pattern analysis using GFP-based reporters generally agreed with SAGE profiles derived from either staged worms or fluorescence-activated cell sorting-based isolation of certain cell types. Surprisingly, aqp-8 message was also detected in AFD-specific libraries (29). Analyses of mutants and cell ablations of the AFDs have determined that the ciliated neurons AFDL and AFDR are required for thermosensation in C. elegans (52, 53). The developmental lineages of the excretory cell and the AFD neurons diverge at the four-cell stage, a stage that has not been used for deriving the AFD SAGE library (54). A possible reason for the SAGE tag arising in the AFD-specific library is that the tag might represent message derived from background foreign cell contamination during the fluorescence-activated cell sorting stage.
By assaying for the expression activity of progressive deletions of the aqp-8 upstream regulatory region, we have delimited a region important for the expression of aqp-8. We used sequenced closely related rhabditid genomes to facilitate interspecies comparisons of the upstream regulatory region of aqp-8. The alignments, in conjunction with the window derived from the promoter truncation analysis, allowed us to identify a single cis-regulatory element required for expression of AQP-8. The cis-regulatory element corresponds to the octamer motif, a DNA sequence known to recruit POU homeobox transcription factors for activation of downstream genes. We demonstrate that the transcription factor responsible for aqp-8 excretory cell expression is CEH-6 using a double RNAi strategy, which enhances the RNAi effects in certain tissue types. We find that CEH-6 is found in both the cytosolic and nuclear protein extracts. The presence of a cytosolic binding partner for the octamer site is not surprising due to the fact that POU homeobox transcription factors have highly conserved basic nuclear localization and leucine-rich hydrophobic nuclear export signals (55, 56). An alignment of the human POU homeobox TFs, Oct6 and Brn1, against all three C. elegans members reveals that the two localization signal sequences are conserved in the nematode POU proteins (data not shown). To verify the cytosolic localization of CEH-6, we assayed for the expression pattern of a CEH-6 translational GFP fusion construct. The construct revealed that the protein is intracellularly localized both to the nucleus and the cytoplasm of the excretory cell (data not shown). The nuclear export signal found in POU TFs has been demonstrated to act in a CRM1/Exp1-dependent manner. The C. elegans genome contains an ortholog of CRM1/Exp1, IMB-4 (importin-beta-like protein-4, ZK742.1). The GFP signal resulting from the transgene ZK742.1::GFP was too weak to be detected, and therefore we could not determine if CEH-6 and IMB-4 are cellularly co-localized. The EMSA results also indicate a greater abundance of the DNA-interacting protein in the cytoplasm than in the nucleus. This may indicate a nuclear export rate for CEH-6 that exceeds its nuclear import rate. The existence of these localization signals in CEH-6 likely facilitates rapid transient transcriptional modulation of target genes via nucleocytoplasmic shuttling with the cytosol acting as a repository.
Analysis of the expression pattern derived from the tandem POU motif repeat fused to the
pes-10::GFP reporter revealed that the motif also drove expression in the AUA (AUAL and AUAR) and AVH (AVHL and AVHR) neuron pairs (Fig. 4D). The AUA neurons are involved with integrating environmental cues to dictate social versus solitary feeding choices (57). Although AQP-8 was not detected in the AUA neurons, AQP-8 may play a role in integrating osmoregulatory cues in conjunction with these cells. The function of the AVH neurons is unknown, but it appears that both the AUA-type and AVH-type neurons co-express the glutamate receptor GLR-4 and a splice variant of the tyramine receptor SER-2 (58). The motif repeats fused to the minimal reporter was sufficient to drive excretory cell expression of the reporter in vivo, albeit at a lower expression level than that the aqp-8 promoter-reporter constructs, suggesting that there are other elements downstream of the octamer element that are important for fine-tuning the levels of mRNA production but which themselves do not necessarily modulate the spatial pattern of AQP-8. This leads to a combinatorial model for gene expression of aqp-8. This is supported by multiple alignments of the region between the POU motif and the translational start site of four nematode species, which show seven blocks of perfect conservation for sequences greater than six residues (Fig. 3). Another possible explanation for the lower observed GFP expression level as a result of the
pes-10::GFP-based construct is that the motif may have an optimal effectiveness at a specific distance relative to the translational start site. Further studies should be carried out to determine which if not both of these hypotheses are applicable in this situation. An alternative, osmotic balance-controlled model of gene regulation has been also suggested for aqp-8 (15). It is possible that some of the other conserved regions upstream of aqp-8 may be responsible for this aspect of its regulation.
The vertebrate ortholog of CEH-6 is the class III POU homeobox protein, Brn1. Members of the class III POU transcription factors play important roles in the development of the nervous system (59). Zebrafish Brn1 has been localized via whole mount in situ expression patterning to neuronal tissue (60). Brn1 expression has also been detected in the gastrointestinal tract of embryonic sea urchins (61). The Brn1 ortholog in quail has been observed, by whole mount in situ hybridization, to be localized in neuronal tissue and in the mesodermal sections of the developing kidney in 5-day-old embryonic quail. In addition, it has been detected in as early as 2-day-old embryonic tissue sections by Northern blot analysis (62). Homozygous mBrn1-deficient mice die within 24 h of birth due to renal complications. Dissection of 2-h-old mice revealed that mBrn1-/- mice had significantly lower volumes of urine compared with their wild-type counterparts. mBrn-1 was observed to be localized to the macula densa, the distal convoluted tubule, and the Loop of Henle. Closer inspection of these tissues revealed a shortened loop of Henle and suppressed differentiation in all three tissues (63). The CEH-6 ortholog in the crustacean Artemia franciscana, APH-1, is expressed in the salt gland, which like the C. elegans excretory cell and mammalian kidney, is an osmoregulatory organ. Reverse transcription-PCR analysis of APH-1 reveals that, like CEH-6, the transcription factor is expressed predominantly during development (64). Because the excretory cell phenotype of ceh-6(mg60) manifests early in development (44), and due to the general role of POU homeobox TFs in modulating gene expression in early development, we presume that many of the genes transcriptionally regulated by CEH-6 are required for morphogenesis of renal and neuronal tissues.
To determine genes that may be co-regulated with aqp-8, we searched for genes in which the octamer motif was perfectly conserved in the upstream region of three nematode species (C. elegans, C. briggsae, and C. remanei), and, using publicly available expression pattern data (29), we determined the frequency that the motif arises in the upstream region of excretory cellexpressing genes. We did not observe a high level of significance when determining whether these genes were more likely than not to be expressed in the excretory cell. The low significance was likely caused by the lack of expression data for many of the genes predicted providing a small sample size. We expect that the significance level of the data would increase if the expression pattern for a larger group of the bioinformatically predicted candidates was available. Upon pattern analysis of other genes in the most relaxed set (Table 2, all) we found 10 of the 19 expressing genes show expression in neuronal cells, a tissue that also expresses CEH-6 (Table 2).
Studies pertaining to transcriptional regulation in vertebrates can be difficult due to the lack of sequenced genomes, the tissue and physiological complexity of the systems, and problems with determining complete expression patterns due to long developmental time courses. The intergenic spacing in the C. elegans genome is relatively compact; therefore, studies of long range regulation are usually not required for the identification of single-gene cis-regulatory elements, although long range studies may identify islands of co-regulated gene clusters due to factors such as higher order chromatin structure. In addition, many studies rely on expression profile correlations and/or determining over-representative motifs in the promoter-containing regions using whole genome approaches. One of the problems of these expression pattern correlation studies is that tissue co-expression does not always imply gene co-regulation as we have shown in our study.
Although the experimentally identified octamer sequence was perfectly conserved and functional in the upstream regulatory region of aqp-8, the octamer motif did not necessarily drive excretory cell expression. Due to these results, we have concluded that the octamer motif, although probably a functional DNA region in the many cases in which it is perfectly conserved between nematode species, is not sufficient in all cases to drive expression in the excretory cell. We intend to study the expression pattern of the other candidate promoter regions to develop a better understanding of which tissues and at what frequencies the octamer motif modulates expression.
Because this work and the previous study by Zhao et al. (51) were not exhaustive searches for cis-regulatory elements that modulate gene expression in the excretory cell, there are still other transcription factor binding sites that affect excretory cell expression. In this study, we have revealed a conserved relationship between a transcription factor and its cognate DNA binding locus, which is relevant to both renal and neuronal development in nematodes and in other higher organisms.
| FOOTNOTES |
|---|
The on-line version of this article (available at http://www.jbc.org) contains supplemental Tables S1-S3. ![]()
2 Supported by a Weyerhauser-Molecular Biology and Biochemistry fellowship and a Hemingway Nelson Architects Graduate Scholarship. ![]()
3 Supported by a grant from NSERC Canada and a Faculty start-up fund provided by Simon Fraser University. ![]()
4 Supported by National Science Foundation Grant IOB-0516554. ![]()
5 A Canada Research Chair in Genomics and supported by grants from NSERC and the Canadian Institutes of Health Research. ![]()
1 Supported by a Natural Sciences and Engineering Reserach Council of Canada doctoral scholarship. To whom correspondence should be addressed: Dept. of Molecular Biology and Biochemistry, Simon Fraser University, 8888 University Drive, Burnaby, British Columbia V5A 1S6, Canada. Tel.: 604-291-4597; Fax: 604-291-5583; E-mail: amaha{at}sfu.ca.
6 The abbreviations used are: AQP, aquaporin; GFP, green fluorescent protein; TESS, Transcriptional Element Search System; EMSA, electrophoretic mobility shift assay; PEST, degradation signal consisting of a Pro-Glu-Ser-Thr rich sequence; SAGE, serial analysis of gene expression; POU, pit, oct, and unc; RNAi, RNA interference; dsRNA, double strand RNA; EST, expressed sequence tag; TF, transcription factor. ![]()
7 Hunt-Newbury, R., Vivieros, R., Johnsen, R., Mah, A., Anastis, D., Fang, L., Halfknight, E., Lee, D., Lin, J., Lorch, A., McKay, S., Okada, H., Pan, J., Schultz, A., Tu, D., Wong, K., Zhao, Z., Alexeyenkor, A., Burglin, T., Sonnhammer, E., Schnabel, R., Jones, S., Marra, M., Baillie, D., and Moerman, D. PLOS Biol., in press. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |