Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M700229200 on August 8, 2007

J. Biol. Chem., Vol. 282, Issue 39, 28597-28608, September 28, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/39/28597    most recent
M700229200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dashti, N.
Right arrow Articles by Segrest, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dashti, N.
Right arrow Articles by Segrest, J. P.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Microsomal Triglyceride Transfer Protein Activity Is Not Required for the Initiation of Apolipoprotein B-containing Lipoprotein Assembly in McA-RH7777 Cells*

Nassrin Dashti{ddagger}§1, Medha Manchekar{ddagger}, Yanwen Liu{ddagger}, Zhihuan Sun{ddagger}, and Jere P. Segrest{ddagger}

From the {ddagger}Department of Medicine, Basic Sciences Section, Atherosclerosis Research Unit, §Department of Cell Biology, and Department of Biochemistry and Molecular Genetics, University of Alabama at Birmingham Medical Center, Birmingham, Alabama 35294

Received for publication, January 9, 2007 , and in revised form, July 18, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We previously demonstrated that the N-terminal 1000 amino acid residues of human apolipoprotein (apo) B (designated apoB:1000) are competent to fold into a three-sided lipovitellin-like lipid binding cavity to form the apoB "lipid pocket" without a structural requirement for microsomal triglyceride transfer protein (MTP). Our results established that this primordial apoB-containing particle is phospholipid-rich (Manchekar, M., Richardson, P. E., Forte, T. M., Datta, G., Segrest, J. P., and Dashti, N. (2004) J. Biol. Chem. 279, 39757-39766). In this study we have investigated the putative functional role of MTP in the initial lipidation of apoB:1000 in stable transformants of McA-RH7777 cells. Inhibition of MTP lipid transfer activity by 0.1 µM BMS-197636 and 5, 10, and 20 µM of BMS-200150 had no detectable effect on the synthesis, lipidation, and secretion of apoB:1000-containing particles. Under identical experimental conditions, the synthesis, lipidation, and secretion of endogenous apoB100-containing particles in HepG2 and parental untransfected McA-RH7777 cells were inhibited by 86-94%. BMS-200150 at 40 µM nearly abolished the secretion of endogenous apoB100-containing particles in HepG2 and parental McA-RH cells but caused only 15-20% inhibition in the secretion of apoB: 1000-containing particles. This modest decrease was attributable to the nonspecific effect of a high concentration of this compound on hepatic protein synthesis, as reflected in a similar (20-25%) reduction in albumin secretion. Suppression of MTP gene expression in stable transformants of McA-RH7777 cells by micro-interfering RNA led to 60-70% decrease in MTP mRNA and protein levels, but it had no detectable effect on the secretion of apoB:1000. Our results provide a compelling argument that the initial addition of phospholipids to apoB:1000 and initiation of apoB-containing lipoprotein assembly occur independently of MTP lipid transfer activity.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Apolipoprotein B (apoB)2 is synthesized primarily in hepatocytes and enterocytes and has a fundamental role in the transport and metabolism of plasma triacylglycerols (TAG) and cholesterol (1, 2). ApoB is a predominant protein component of very low density lipoproteins (VLDL) and intermediate density lipoproteins and is essentially the only apoprotein component of low density lipoproteins (LDL2) (3, 4). ApoB100 (the full-length protein) is one of the largest monomeric proteins known with 4536 amino acid residues (2). It is expressed primarily in mammalian liver, is an essential structural component for the formation and secretion of VLDL, and serves as a ligand for the LDL receptor (2). ApoB is present as a single molecule per lipoprotein particle (5); and therefore, its concentration in the plasma approximates the number of potential atherogenic lipoprotein particles.

The processes involved in the assembly of apoB-containing lipoproteins in the liver are complex and are regulated at multiple levels throughout the secretory pathway. The assembly of apoB-containing lipoproteins occurs co-translationally (1), i.e. while the C-terminal portion is still being synthesized on the ribosome of the endoplasmic reticulum (ER), the N-terminal portion is translocated across the ER and is assembled as a small lipoprotein particle. The addition of lipids to apoB is widely believed to occur in two steps (2, 6, 7). The first step involves the addition of small amounts of lipids to apoB, as it is translated and translocated into the lumen of ER preventing its degradation and formation of a partially lipidated small pre-VLDL particle in the high density lipoprotein (HDL) density range (2, 7, 8). In the second step, this pre-VLDL particle is believed to acquire the bulk of its core lipids and is converted to bona fide VLDL (2, 7, 9), presumably by fusing with a large, VLDL-sized, apoB-free TAG particle (9). Biochemical studies of VLDL assembly support the concept that the bulk of neutral lipids are added in the second step after apoB translation is completed (10).

One of the most important factors in the assembly and secretion of apoB-containing lipoproteins is microsomal triglyceride transfer protein (MTP), which predominantly resides in the ER of hepatocytes and enterocytes (11-14). A vital role of MTP in the formation and secretion of apoB-containing lipoprotein particles is further substantiated by the observation that patients with abetalipoproteinemia, an autosomal-recessive disorder caused by mutations in the MTP gene, have low levels of apoB in plasma (11). Although the obligatory role of MTP in the secretion of VLDL is well established, the precise mechanism by which MTP transfers lipids to the nascent apoB polypeptide during its synthesis and assembly into VLDL is not fully understood. Furthermore, the relative importance of MTP in the two steps of VLDL assembly remains unclear and controversial. Some studies indicate that MTP has a crucial role in the first step assembly of VLDL (15-20), but it is not required for the second-step core expansion during VLDL assembly (17, 19-21). Others support the concept that MTP is essential for transferring bulk TAG into the lumen of ER for the conversion of small apoB-containing lipoproteins to large VLDL-sized particle (22-24) and chylomicrons (25). The potential role of MTP in the initial lipidation of apoB and nucleation of the primordial apoB-containing particle has not been elucidated.

Previously, based on experimentally derived results (26, 27) and all atom molecular modeling of the beta{alpha}1 domain (amino acid residues 1-1000) of apoB100 (28), we proposed that initiation of apoB particle assembly occurs when the beta{alpha}1 domain, designated apoB:1000, folds into a three-sided lipovitellin (LV)-like lipid binding cavity to form the apoB "lipid pocket." Our results supported a model in which the first 1000 amino acid residues of apoB are competent to complete the lipid pocket without a structural requirement for MTP, and that this lipid pocket has a fixed lipid capacity on the order of 50 phospholipids (PL) for a total stoichiometry of 70 lipid molecules, a number in close agreement with that reported for the LV complex (29-31). We propose that the initiation complex in the assembly of apoB-containing lipoprotein particle is PL-rich suggesting a small bilayer type organization rather than a TAG-rich emulsion proposed by others (32). Although our results (27, 28) demonstrated that MTP is not a structural requirement for the formation of the lipid pocket, they did not rule out its potential functional role, i.e. transfer of lipids to the nascent apoB:1000, in this process.

Because MTP both binds to apoB and transfers lipids (33), this study was a logical continuation of our previous work and focused on the following important question: "is MTP involved in the initial addition of PL to nascent apoB:1000 and initiation of apoB-containing lipoprotein particle assembly?" To address this question, we tested the effects of two well characterized inhibitors of MTP lipid transfer activity, BMS-197636 and BMS-200150 (13, 34), on the de novo synthesis, lipidation, and secretion of apoB:1000 in stable transformants of McA-RH7777 cells. We also suppressed the MTP gene expression by miRNA and determined the subsequent effect on the secretion of apoB:1000. Our results provide a compelling argument that the initial addition of phospholipids to apoB:1000 and initiation of apoB-containing lipoprotein assembly occur independently of MTP lipid transfer activity.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Horse serum (HS) and antibiotic-antimycotic were obtained from Invitrogen. Tris/glycine gels were obtained from Invitrogen. Dulbecco's modified Eagle's medium (DMEM), minimum essential medium (MEM), trypsin, and G418 were purchased from Mediatech, Inc. (Herndon, VA). Fetal bovine serum (FBS), sodium deoxycholate, Triton X-100, dimethyl sulfoxide (Me2SO), phenylmethylsulfonyl fluoride, benzamidine, leupeptin, aprotinin, pepstatin A, fatty acid-free bovine serum albumin (BSA), and rabbit antibody to human albumin were from Sigma. Protein G-Sepharose CL-4B, [3H]glycine, [14C]oleic acid, and Amplify were from Amersham Biosciences.Tran35S-label[35S]methionine/cysteine([35S]Met/Cys) was from MP Biomedicals, Inc. (Irvine, CA). Immobilin polyvinylidene difluoride transfer membrane and Centriprep YM-30 centrifugal filter devices were purchased from Millipore Corp. (Bedford, MA). Affinity-purified polyclonal antibody to human apoB100 was prepared in our laboratory and biotinylated as described previously (26). MTP inhibitors, BMS-197636 and BMS-200150, and polyclonal antibody to bovine MTP 97-kDa large subunit (11) were kindly provided by Dr. David Gordon and Dr. J. R. Wetterau (Bristol-Myers Squibb Co.), and apoB100 cDNA was a gift from Dr. Zemin Yao (University of Ottawa Heart Institute, Ottawa, Ontario, Canada).

Construction of Truncated ApoB Expression Plasmid—Truncated apoB cDNA spanning nucleotides 1-3081 of the full-length apoB100 cDNA was prepared from pB100L-L (35) as a PCR template and appropriate primers as described previously in detail (26). The amplified PCR product was cloned into the TOPO TA cloning vector and used to transform cells. Clones harboring the vector were selected and identified by restriction enzyme digestion and nucleotide sequencing of the entire open reading frames. Only clones with 100% correct sequence were used in these studies. The 3081-bp fragment (apoB:1000) was excised from the vector, extracted, purified, and ligated into the mammalian expression vector, the Moloney murine leukemia virus-based retrovirus LNCX (36), containing the neomycin phosphotransferase gene, which confers G418 resistance for use as a selectable marker. The apoB expression vector pLNCB: 1000 was used to transform cells, and clones harboring plasmid-containing apoB gene with the correct orientation were identified by restriction enzyme digestion and confirmed by nucleotide sequencing as described previously (26).

Cell Culture and Transfection—McA-RH7777 cells (referred to as McA-RH here) were obtained from American Type Culture Collection (Manassas, VA). Clonal stable transformants of McA-RH cells expressing apoB:1000, denoting amino acid residues 1-1000 of the mature protein lacking the signal peptide, were generated as described previously in detail (26). Cells were grown in DMEM containing 20% HS, 5% FBS, and 0.2 mg/ml G418, and medium was changed every 48 h. All experiments were conducted with 4-5-day-old cells as described previously (26). The human hepatoblastoma HepG2 cell line (obtained from American Type Culture Collection) was seeded onto tissue culture dishes in MEM containing 10% (v/v) FBS and were incubated at 37 °C in a 95% air, 5% CO2 atmosphere as described previously (37). Medium was changed every 48 h, and all experiments were conducted with 4-5-day-old cells.

MTP Inhibition—The MTP inhibitors BMS-197636 and BMS-200150 (Bristol-Myers Squibb Co.) (13, 34) were dissolved in Me2SO at concentrations of 0.025 and 10 mM, respectively. Final Me2SO concentration was normalized to 0.4% in all experimental and control dishes.

De Novo Synthesis and Secretion of ApoB and Albumin—Clonal stable transformants of McA-RH cells expressing apoB: 1000 and HepG2 and parental McA-RH cells producing endogenous human and rat full-length apoB100, respectively, were grown for 4 days in 6-well dishes. At the start of experiments, maintenance media were removed; monolayers were washed twice with phosphate-buffered saline (PBS), and cells were preincubated for 45 min in serum-, methionine-, and cysteine-free DMEM. Fresh serum-, methionine-, and cysteine-free DMEM was added, and the incorporation of [35S]Met/Cys (100 µCi/ml of medium) into newly synthesized apoB:1000, apoB100, and albumin in the presence or absence of BMS-197636 and BMS-200150 was determined after 3.5 h of incubation. Control dishes received the same amount of Me2SO, i.e. 0.4% final concentration. In a separate experiment, the effects of MTP inhibitor, BMS-197636, on the synthesis and secretion of apoB:1000 was determined as a function of time. After the indicated incubation time, the 35S-labeled conditioned media were collected; preservative mixtures at final concentrations of 500 units/ml penicillin-G, 50 µg/ml streptomycin sulfate, 20 µg/ml chloramphenicol, 1.3 mg/ml {epsilon}-aminocaproic acid, 1 mg/ml EDTA, 1 mM benzamidine, 1 mM phenylmethylsulfonyl fluoride, and 100 kallikrein-inactivating units of aprotinin/ml was added to prevent oxidative and proteolytic damage. The media were centrifuged at 2,000 rpm for 30 min at 4 °C to remove broken cells and debris. Cell monolayers were washed with cold PBS, and lysis buffer containing preservative mixture described above plus leupeptin (50 µg/ml) and pepstatin A (50 µg/ml) was added, and cells were processed as described previously (26). The secreted 35S-labeled apoB and albumin in the media and 35S-labeled apoB in cell lysates were isolated by immunoprecipitation as described below.

Metabolic Labeling of the Lipid Content of ApoB-containing Lipoprotein Particles—Cells were grown in 6-well dishes as described above. At the start of experiments, maintenance media were removed; cells were washed twice with PBS and were incubated for 17 h in serum-free DMEM (for McA-RH cells) or MEM (for HepG2 cells) containing either [3H]glycerol (7 µCi/ml of medium) or [14C]oleic acid (0.4 mM) bound to 0.75% BSA. In experiments where the radiolabeled lipids associated with apoB-containing particles were determined by autoradiography, cells were labeled with both [3H]glycerol and [14C]oleic acid to enhance the signal. The labeled conditioned media were processed and supplemented with preservatives as described above. Cell monolayers were washed with PBS, scraped off the plate in 1.0 ml of PBS, and sonicated. The incorporation of [3H]glycerol or [14C]oleic acid into various lipid moieties of apoB-containing lipoproteins secreted into the medium and accumulated in the cells was determined by immunoprecipitation or by nondenaturing gradient gel electrophoresis (NDGGE) as described below. Cell protein content was measured by the method of Lowry et al. (38).

Immunoprecipitation—The 35S-labeled proteins secreted into the conditioned media and accumulated in the cells were immunoprecipitated using monospecific polyclonal antibody to human or rat apoB100 coupled to protein G-Sepharose CL-4B as described previously (27, 39). The 35S-labeled albumin in the conditioned media of HepG2 and McA-RH cells was determined as above using rabbit antibody to human and rat albumin, respectively. The 35S-labeled proteins were extracted from protein G as described previously (26) and resolved on 4-12% SDS-PAGE (40). After electrophoresis, the gels were analyzed by autoradiography, in conjunction with computer-assisted image processing, or by immunoblotting as described below and in the figure legends.

NDGGE—The [3H]glycerol-labeled apoB-containing lipoprotein particles in the conditioned media were separated on 4-20% NDGGE as described previously (26). Gels were stained, and the bands corresponding to apoB100 (in parental McA-RH and HepG2 cells) and apoB:1000 (in stably transfected McA-RH cells), identified by immunoblotting of a duplicate gel, were excised and analyzed for lipids as described below. Alternatively, the incorporation of [3H]glycerol and [14C]oleic acid into total lipids of intact apoB-containing lipoproteins was determined by NDGGE of the labeled conditioned media and autoradiography.

Immunoblot Analysis—The apoB-containing particles were separated on 4-12% SDS-PAGE (40) or on 4-20% NDGGE. After electrophoresis, proteins were detected by Western blot analysis (41) using biotinylated antibody to human apoB100 as described previously (26).

Lipid Analysis of Isolated Full-length and Truncated ApoB-containing Particles—The bands corresponding to labeled apoB100- or apoB:1000-containing particles were excised from NDGGE, and lipids were extracted with chloroform/methanol (2:1) as described previously in detail (27); complete extraction was assessed by liquid scintillation counting the final gel homogenate. Total labeled lipids extracted from gel-isolated apoB-containing lipoproteins were washed by the Folch method (42) and applied to a TLC plate as described previously (43). The bands corresponding to PL, diacylglycerols, and TAG, identified by comparison to known standards, were visualized with iodine; each band was scraped off the plate, placed in a counting vial, and quantified by liquid scintillation counting.

RT-PCR and Sequencing—Total RNA from parental untransfected McA-RH cells and apoB:1000-expressing stable transformants of McA-RH was isolated with TRIzol reagent (Invitrogen). MTP mRNA was determined by one-step semiquantitative reverse transcriptase (RT)-PCR using sense strand primer AGGCTGGGGAAGGGCCCGTC and antisense strand primer AATGTTCTTCACATCCATGT. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA level was used as internal control using sense strand primer GACAAGATGGTGAAGGTCGGT and antisense primer TTGGCCCCACCCTTCAGGTG.

Suppression of MTP Expression by miRNA—The pre-miRNA sequences were designed using RNAi designer on-line tool (Invitrogen). Seven different double-stranded oligo duplexes encoding desired miRNA target sequences were selected and cloned into pcDNATM6.2-GW, a BLOCK-iTTM pol II miR RNAi expression vector (Invitrogen). The BLOCK-iTTM pol II miR RNAi expression vectors are specifically designed to allow expression of miRNA sequences and contain specific miR flanking sequences that allow proper processing of the miRNA. The vectors also contain the spectinomycin resistance gene for selection in bacteria and the blasticidin resistance gene for selection in mammalian cells. The sequences of one of the most efficient oligo duplexes are as follows: top sequence 5'-GCTGTTTAAGATGACAGCAGCAGCCGTTTTGGCCACTGACTGACGGCTGCTGGTCATCTTAAA-3' and bottom sequence 5'-CCTGTTTAAGATGACCAGCAGCCGTCAGTCAGTGGCCAAAACGGCTGCTGCTGTCATCTTAAAC-3'. The sequences of the negative control oligo duplex are as follows: top sequence 5'-GCTGAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT-3' and bottom sequence 5'-CCTGAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTTC-3'. Escherichia coli DH5{alpha} cells were transformed using the vectors harboring the respective double-stranded oligo encoding the engineered pre-miRNAs. Plasmids were purified using standard techniques, analyzed to confirm correct sequence, and used to transfect apoB:1000-expressing stable transformants of McA-RH cells.

Transfecting miRNA into ApoB:1000-expressing McA-RH Cells—Cells were seeded onto 60-mm dishes and grown in DMEM containing 20% horse serum and 5% FBS as described above. After 24 h and at ~50-60% confluency, cells were transfected using TransIT®-LT1 transfection reagent (Mirus, Madison, WI) according to the manufacturer's instructions. The cells were trypsinized 48 h post-transfection and were grown in DMEM containing serum and 10 µg/ml blasticidin (Invitrogen) to select for clonal stable cells. Cells were then maintained in DMEM containing serum and 5 µg/ml blasticidin for 18-20 days; medium was changed twice weekly, and cells were expanded every 4 days as described previously (26). This approach was necessary to reduce the level of pre-existing MTP, which has a long half-life, i.e. 4.4 days in HepG2 cells (44). MTP mRNA level was determined by RT-PCR, and MTP protein level was assessed by immunoblotting (41) using polyclonal antibody to bovine MTP 97-kDa large subunit.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
MTP Inhibitors Have No Effect on the Secretion or Cellular Accumulation of 35S-Labeled ApoB:1000 Expressed in McA-RH Cells but Markedly Decrease Those of Endogenous Full-length ApoB100 in HepG2 and Parental Untransfected McA-RH Cells—The liver-derived McA-RH cells retain the ability to synthesize and secrete lipoproteins similar to those in primary hepatocytes (45). McA-RH cells secrete both rat apoB100 and apoB48 in the form of lipoprotein particle (45) and, unlike human-derived hepatoma HepG2 cells, secrete a large fraction of apoB100 in the form of VLDL particles (46). McA-RH cells have a high expression capacity (47) and have successfully been used in numerous studies (23, 26, 27, 48-50) as a model to investigate the mechanisms of apoB-containing lipoprotein assembly in the liver.


Figure 1
View larger version (31K):
[in this window]
[in a new window]

  		FIGURE 1.
MTP activity is not required for the synthesis and secretion of apoB:1000 in McA-RH cells but is required for the secretion of apoB100 in HepG2 cells. Stable transformants of McA-RH cells expressing human (h) apoB:1000 (the N-terminal 1000 residues of full-length apoB100) were grown for 4 days in DMEM containing 20% HS and 5% FBS. HepG2 cells, which secrete apoB100, were grown for 4 days in MEM containing 10% FBS. After removing the maintenance media, cells were washed with PBS and were preincubated for 45 min in serum-, methionine-, and cysteine-free DMEM. Fresh serum-, methionine-, and cysteine-free DMEM containing [35S]Met/Cys (100 µCi/ml) was added, and cells were incubated for 3.5 h in the presence or absence of 5 and 10 µM BMS-200150 (A) or 20 µM BMS-200150 (B). The 35S-labeled apoB in cell lysate and secreted into the medium was immunoprecipitated using monospecific polyclonal antibody to human apoB100, and proteins were separated by 4-12% SDS-PAGE and subjected to autoradiography. The autoradiogram is representative of three separate experiments.

 
Using stable transformants of McA-RH cells, we demonstrated previously that the first 1000 amino acid residues of apoB100 are competent to form the apoB lipid pocket and initiate apoB particle assembly without the structural requirement for MTP (27). This experimentally derived observation was supported by our all atom molecular model for apoB:1000 (28). In this study, we examined the putative functional role of MTP in the initial lipidation of nascent apoB:1000 and initiation of apoB assembly in stable transformants of McA-RH cells. We tested the effects of two known inhibitors of MTP lipid transfer activity, BMS-197636 and BMS-200150 (13, 17, 51), on the synthesis, lipidation, and secretion of apoB:1000-containing particles stably expressed in McA-RH cells. Because this class of inhibitors has been shown to markedly decrease the secretion of apoB100-containing particles in HepG2 cells (13) and McA-RH cells (23, 48), we included these cells as positive controls.

As the first step, we determined the dose-dependent effects of BMS-200150 on the de novo synthesis and secretion of apoB: 1000 in McA-RH cells and de novo synthesis and secretion of apoB100 in HepG2 cells. Cells were metabolically labeled with [35S]Met/Cys in the presence or absence of MTP inhibitor for 3.5 h. We initially used 5 and 10 µM of BMS-200150 that inhibit TAG transfer activity of MTP by 70 and 80%, respectively (13), and have been shown to inhibit apoB100 secretion in HepG2 cells by 65 and 90%, respectively (13). As shown in Fig. 1A, BMS-200150 at 5 or 10 µM had no detectable effect on the secretion or cellular accumulation of 35S-labeled apoB:1000 expressed in McA-RH cells. By contrast, the secretion of 35S-labeled apoB100 in HepG2 cells was decreased by 86 and 94% with 5 and 10 µM of BMS-200150, respectively, and its cellular accumulation was diminished by 65%. This resulted in 83% inhibition in the net de novo synthesis and secretion of apoB100 (Fig. 1A). Similar results were obtained after 17 h of incubation with the inhibitors (data not shown).


Figure 2
View larger version (46K):
[in this window]
[in a new window]

  		FIGURE 2.
Inhibition of MTP lipid transfer activity by BMS-197636 and high concentration of BMS-200150 does not affect the synthesis and secretion of apoB:1000 in McA-RH cells, but almost completely abolishes those of endogenous apoB100 in HepG2 and parental untransfected McA-RH cells. Stable transformants of McA-RH expressing human apoB:1000 and HepG2 and parental untransfected McA-RH cells secreting endogenous human and rat apoB100, respectively, were grown as described in the legend to Fig. 1. Cells were incubated for 3.5 h with serum-, methionine-, and cysteine-free DMEM containing [35S]Met/Cys (100 µCi/ml) in the presence or absence of the 0.1 µM BMS-197636 or 40 µM BMS-200150. 35S-Labeled apoB in cell lysates and media were immunoprecipitated with antibody to human apoB100 (hApoB100) in apoB:1000 expressing McA-RH and HepG2 cells or rat apoB100 (rApoB100) in parental untransfected McA-RH cells. Proteins were separated by 4-12% SDS-PAGE and subjected to autoradiography. The autoradiogram is representative of three separate experiments. DMSO, Me2SO.

 
We reasoned that perhaps higher concentrations of BMS-200150 might be necessary to inhibit the secretion of apoB: 1000-containing particles. As such, we used 20 µM BMS-200150, a concentration that inhibits the secretion of apoB100 in HepG2 cells by greater than 90% (13), but we observed no change in either the secretion or cellular accumulation of 35S-labeled apoB:1000 in McA-RH cells (Fig. 1B). Even at 40 µM BMS-200150, a concentration that almost completely abolished the secretion of human endogenous apoB100 in HepG2 cells (Fig. 2 and Fig. 3B) and rat endogenous apoB100 in parental untransfected McA-RH cells (Fig. 2 and Fig. 3C), there was no change in the cellular accumulation of 35S-labeled apoB: 1000, and only a modest 15-20% decrease in its secretion (Fig. 2 and Fig. 3A).

Another potent inhibitor of MTP lipid transfer activity, BMS-197636, which is effective at very low concentrations, i.e. 0.1 and 0.2 µM (48, 52), was also tested. BMS-197636 had no effect on the synthesis or secretion of 35S-labeled apoB:1000 in McA-RH cells at either 0.1 µM (Fig. 2 and Fig. 3A) or 0.2 µM (data not shown). The unchanged synthesis and secretion of 35S-labeled apoB:1000 in the presence of 0.1 µM BMS-197636 was sustained over the range of 2-24 h of incubation as compared with cells incubated with Me2SO control (Fig. 4). By contrast, 0.1 µM BMS-197636 inhibited the secretion and cellular accumulation of 35S-labeled endogenous apoB100 by 90 and 60%, respectively, in HepG2 cells (Fig. 2 and Fig. 3B) and by 87 and 56%, respectively, in parental untransfected McA-RH cells (Fig. 2 and Fig. 3C). To establish the specificity of the effects of MTP inhibitors on apoB production, their influence on the secretion of newly synthesized albumin, a marker of hepatic protein synthesis and secretion, was also determined in both cell lines. The secretion of 35S-labeled human albumin in HepG2 cells and rat albumin in McA-RH cells was not affected by either 0.1 µM BMS-197636 or 20 µM BMS-200150 (Fig. 3D). At 40 µM BMS-200150, the secretion of newly synthesized albumin was inhibited by ~20-25% in both cell lines (Fig. 3D). These results clearly showed that the inhibitory effect of 0.1 µM BMS-197363 and 5, 10, and 20 µM BMS-200150 on the synthesis and secretion of apoB100 in HepG2 and parental untransfected McA-RH cells was specific. Furthermore, results demonstrated that the moderate inhibition in the secretion of apoB: 1000 in stable transformants of McA-RH cells by 40 µM BMS-200150 was due, most likely, to the effect of a high concentration of this compound generally on cell metabolism. The MTP inhibitors did not have any significant effect on the cell protein content. In a series of 10 experiments, the total protein content of cells, expressed as mean ± S.E. (n = 20), in Me2SO control, 0.1 µM BMS-197636, and 40 µM BMS-200150 was 1.72 ± 0.06, 1.72 ± 0.08, and 1.69 ± 0.1 mg/dish, respectively, for apoB:1000-expressing McA-RH cells; 1.82 ± 0.11, 1.75 ± 0.10, and 1.78 ± 0.16 mg/dish, respectively, for HepG2 cells; and 1.50 ± 0.05, 1.60 ± 0.07, and 1.31 ± 0.13, respectively, for parental untransfected McA-RH cells. These results indicate that the inhibitors, at concentrations used in this study, were not cytotoxic.

MTP Lipid Transfer Activity Is Not Required for the Initial Lipidation of ApoB:1000 in Stable Transformants of McA-RH Cells—We next examined the effects of MTP inhibitors on the lipidation of apoB:1000. McA-RH cells stably expressing apoB: 1000, parental untransfected McA-RH cells, and HepG2 cells were incubated for 17 h with serum-free medium containing [3H]glycerol (7 µCi/ml of medium) and [14C]oleic acid (0.4 mM bound to 0.75% BSA) in the presence or absence of 0.1 µM BMS-197636 or 40 µM BMS-200150. The labeled conditioned media were concentrated and subjected to NDGGE followed by autoradiography as described previously (27) and under the "Experimental Procedures." Bands corresponding to apoB: 1000-containing particles in stable McA-RH cells, rat endogenous apoB100-containing particles in parental untransfected McA-RH cells, and human endogenous apoB100-containing particles in HepG2 cells, were identified by their Stokes diameter (Sd), immunoblotting with antibody to human or rat apoB100, and their co-mobility with control plasma LDL, when applicable, of a duplicate gel. The intensities of the labeled lipids associated with the apoB-containing particles were measured by computer-assisted image processing. We observed that compared with Me2SO control (Fig. 5, A-C, lane 1), 0.1 µM BMS-197636 had no effect on the 3H/14C-labeled lipid content of intact apoB:1000-containing particles in stable transformants of McA-RH cells (Fig. 5B, lane 2) but reduced that associated with intact endogenous apoB100-containing lipoproteins by 70% in both parental untransfected McA-RH cells (Fig. 5A, lane 2) and in HepG2 cells (Fig. 5C, lane 2). BMS-200150 at 40 µM caused only a modest 13% inhibition in the 3H/14C-labeled lipid content of apoB:1000-containing particles secreted by stable transformants of McA-RH cells (Fig. 5B, lane 3) but nearly abolished that of endogenous apoB100-containing particles secreted by both parental untransfected McA-RH cells (Fig. 5A, lane 3) and HepG2 cells (Fig. 5C, lane 3). The inefficacy of MTP inhibitors in decreasing the lipidation and secretion of apoB:1000-containing particles was not because of altered lipid metabolism in the transfected McA-RH cells. The rate of [14C]oleic acid (0.4 mM bound to 0.75% BSA) incorporation into secreted total lipids, expressed as nanomoles/mg cell protein, was 16.27 ± 0.52 and 18.81 ± 0.71 (mean ± S.E., n = 3) in parental untransfected and apoB:1000-expressing McA-RH cells, respectively. The corresponding values for cellular total lipids were 238.92 ± 0.68 and 203.97 ± 7.85, respectively.


Figure 3
View larger version (36K):
[in this window]
[in a new window]

  		FIGURE 3.
De novo synthesis and secretion of apoB lipid pocket formed by the N-terminal 1000 residues of apoB are independent of MTP lipid transfer activity. McA-RH cells stably expressing human apoB:1000 and HepG2 and parental untransfected McA-RH cells secreting human and rat endogenous apoB100, respectively, were grown under conditions described in the legend to Fig. 1. Cells were incubated with 35S-labeled methionine/cysteine (100 µCi/ml) in the presence or absence of the 0.1 µM BMS-197636 or 20 and 40 µM BMS-200150 as described in the legend to Fig. 1. 35S-Labeled apoB:1000 in cell lysate and secreted into the medium of stable transformant of McA-RH cells (A), 35S-labeled human endogenous apoB100 in cell lysate and secreted into the medium of HepG2 cells (B), and 35S-labeled rat endogenous apoB100 in cell lysate and secreted into the medium of parental untransfected McA-RH cells (C) were immunoprecipitated with antibody to human or rat apoB100 as described in the legend to Fig. 1. 35S-Labeled human and rat albumin secreted into the conditioned media of HepG2 and McA-RH cells, respectively (D), were immunoprecipitated using antibody to human and rat albumin, respectively, as described under "Experimental Procedures." The immunoprecipitated apoB and albumin were resolved by 4-12% SDS-PAGE and subjected to autoradiography. The intensity of the labeled proteins was determined by computer-assisted image processing. Each bar represents the mean ± S.E. of seven samples from three separate experiments normalized to cell protein and expressed as a percentage of values in Me2SO (DMSO)-treated cells.

 


Figure 4
View larger version (25K):
[in this window]
[in a new window]

  		FIGURE 4.
The inefficacy of BMS-197636 to inhibit the synthesis and secretion of apoB:1000 in stable transformants of McA-RH cells is sustained over a 24-h incubation time. McA-RH cells stably expressing human apoB:1000 were grown under conditions described in the legend to Fig. 1. Cells were incubated for the indicated time in serum-free DMEM containing [35S]Met/Cys (100 µCi/ml) in the presence or absence of the 0.1 µM BMS-197636. 35S-Labeled apoB:1000 in the cell lysate and secreted into the medium was immunoprecipitated with antibody to human apoB100, and proteins were separated by 4-12% SDS-PAGE and subjected to autoradiography as described in the legend to Fig. 1.

 
Inhibition of MTP Activity Has No Effect on the Concentration or Composition of Newly Synthesized Lipids Associated With ApoB: 1000-containing Particles Secreted by Stable Transformants of McA-RH Cells—To test if MTP inhibitors altered the composition of lipids associated with the secreted apoB: 1000-containing particles without affecting their concentrations, cells were metabolically labeled with [3H]glycerol for 17 h in the presence or absence of the MTP inhibitors. The labeled conditioned media were concentrated 10-fold and were subjected to NDGGE for 48 h. Gels were subsequently stained, and bands corresponding to secreted intact apoB:1000-containing particles were excised from the gels. Lipids were extracted from the excised bands and separated on TLC as described previously (27).

Results showed that compared with Me2SO control, BMS-197636 at 0.1 µM and BMS-200150 at 10 and 20 µM had no detectable effect on either the concentration or the composition of 3H-labeled lipids associated with apoB:1000-containing particles (Table 1), confirming the results obtained by autoradiography (Fig. 5B). BMS-200150 at 40 µM caused a modest 15% decrease in the 3H-labeled lipid content of secreted intact apoB:1000-containing particles without altering their lipid composition (Table 1). MTP inhibitors likewise had no effect on the concentration or composition of newly synthesized lipids accumulated in apoB:1000-expressing McA-RH cells (Table 1). Similar results were obtained when apoB: 1000-containing particles were isolated by immunoprecipitation using polyclonal antibody to human apoB100 (data not shown). These results corroborated the effects of these inhibitors of MTP lipid transfer activity on the newly synthesized and secreted 35S-labeled apoB:1000 (Figs. 1, 2, 3) and 3H/14C-labeled lipids in intact particles determined by autoradiography (Fig. 5B).


View this table:
[in this window]
[in a new window]

  		TABLE 1
Effects of MTP inhibitors on [3H]glycerol-labeled lipids accumulated in the cells and associated with secreted human apoB:1000-containing particles in stable transformant of McA-RH cells Cells were incubated with serum-free DMEM and 3H-labeled glycerol (7 µCi/ml medium) in the presence or absence of MTP inhibitors. Secreted particles were isolated by NDGGE and analyzed for lipids. Values are means ± S.E. of seven samples from three separate experiments normalized to cell protein. DAG indicates diacylglycerol.

 
Inhibition of MTP Lipid Transfer Activity Drastically Decreases the Concentration and Alters the Composition of Newly Synthesized Lipids Associated With Endogenous ApoB100-containing Particles Secreted by HepG2 and Parental Untransfected McA-RH Cells—HepG2 cells were incubated for 17 h with [3H]glycerol as described above. Labeled conditioned media were subjected to NDGGE, and apoB100-containing particles were identified by their co-mobility with human plasma LDL and immunoblotting with antibody to human apoB100. Intact particles were excised from the gels and analyzed for lipids as described above. In sharp contrast to the results obtained for apoB:1000 (Table 1), BMS-197636 (0.1 µM) and BMS-200150 at all concentrations tested decreased the 3H-labeled lipids associated with apoB100 by 75-90% (Table 2). Although MTP inhibitors decreased all lipid species associated with the intact apoB100-containing lipoproteins, this reduction was more pronounced in TAG, resulting in the secretion of particles that contained more PL and less TAG (Table 2). The MTP inhibitors had no significant effect on the cellular concentration or composition of newly synthesized lipids in HepG2 cells (Table 2). Similar results were obtained when apoB100-containing particles were isolated by immunoprecipitation using polyclonal antibody to human apoB100 (data not shown).


View this table:
[in this window]
[in a new window]

  		TABLE 2
Effects of MTP inhibitors on [3H]glycerol-labeled lipids accumulated in the cells and associated with secreted human endogenous apoB100-containing lipoproteins in HepG2 cells Cells were incubated with serum-free DMEM, and the incorporation of [3H]glycerol (7 µCi/ml of medium) into cellular lipids and secreted into the medium in the presence or absence of MTP inhibitors was determined. Values are mean ± S.E. of seven samples from three separate experiments normalized to cell protein. DAG indicates diacylglycerol.

 


Figure 5
View larger version (110K):
[in this window]
[in a new window]

  		FIGURE 5.
Lipidation, assembly, and secretion of intact apoB:1000-containing particles are independent of MTP lipid transfer activity. Parental untransfected McA-RH cells secreting rat endogenous apoB100 (A), McA-RH cells stably expressing human apoB:1000 (B), and HepG2 cells secreting human endogenous apoB100 (C) were grown under conditions described in the legend to Fig. 1. Cells were incubated for 17 h in serum-free DMEM containing 0.4 mM [14C]oleic acid bound to 0.75% BSA and [3H]glycerol (7 µCi/ml) in the absence (lane 1) or presence of 0.1 µM BMS-197636 (lane 2) or 40 µM BMS-200150 (lane 3). The labeled conditioned media were concentrated, and intact apoB-containing particles were separated by 4-20% NDGGE. Gels were stained, dried, subjected to autoradiography, and analyzed by computer-assisted image processing. Sd, Stokes diameter.

 
To assess the effects of MTP inhibitors on the lipid content and composition of the secreted rat endogenous apoB100-containing particles, parental untransfected McA-RH cells were metabolically labeled with [3H]glycerol in the presence or absence of MTP inhibitors, as described for apoB:1000-expressing McA-RH and HepG2 cells. The labeled conditioned media were concentrated and applied to NDGGE. Bands corresponding to LDL-sized endogenous apoB100-containing particles, identified by their apparent Sd, which was same as that of plasma LDL, and immunoblotting with antibody to rat apoB100, were excised, and lipids were extracted as described under "Experimental Procedures." As shown in Table 3, the total lipid content of rat apoB100-containing particles was decreased by 35 and 65% with BMS-197636 and BMS-200150, respectively. Similarly to that in HepG2 cells (Table 2), the decrease in the presence of 40 µM BMS-200150 was more pronounced in TAG, resulting in the secretion of particles that contained more PL and less TAG (Table 3). MTP inhibitors had no effect on the accumulation of lipids in the cells (Table 3). These results indicate that, as in HepG2 cells, the inhibitors of MTP lipid transfer activity decreased the number of secreted endogenous apoB100-containing particles in parental untransfected McA-RH cells and that these particles contained less TAG.


View this table:
[in this window]
[in a new window]

  		TABLE 3
Effects of MTP inhibitors on [3H]glycerol-labeled lipids accumulated in the cells and associated with secreted rat endogenous apoB100-containing particles in parental untransfected McA-RH cells Cells were incubated with serum-free DMEM and [3H]labeled glycerol (7 µCi/ml of medium) in the presence or absence of MTP inhibitors. Secreted particles were isolated by NDGGE and analyzed for lipids. Values are means ± S.E. of nine samples for total lipids and seven samples for lipid composition from three separate experiments normalized to cell protein. DAG indicates diacylglycerol.

 


Figure 6
View larger version (61K):
[in this window]
[in a new window]

  		FIGURE 6.
MTP mRNA and protein levels are not altered in McA-RH cells stably expressing apoB:1000. A, MTP mRNA and protein levels in the parental untransfected and stable transformants apoB:1000-expressing McA-RH cells were determined by RT-PCR and Western blot, respectively. B, McA-RH cells stably expressing apoB:1000 were transfected with MTP miRNA or negative control miRNA as described under "Experimental Procedures." The levels of MTP mRNA and GAPDH internal control were determined by RT-PCR.

 
MTP Level Is Not Altered in ApoB:1000-expressing Stable Transformants of McA-RH Cells—The unchanged synthesis and secretion of apoB:1000 in stable transformants of McA-RH cells in the presence of MTP inhibitors could be due to potential alteration in the MTP expression level in these cells. To test this possibility, we measured MTP mRNA and protein levels by RT-PCR and Western blot, respectively, in both the parental untransfected and apoB:1000-expressing McA-RH cells. As shown in Fig. 6A (representative of three individual dishes), we found equivalent levels of MTP mRNA and protein in both cell lines. These results validate the above observations and rule out the possibility that altered MTP expression in transfected McA-RH cells might be the reason for the ineffectiveness of MTP inhibitors to decrease the synthesis and secretion of apoB:1000.

Suppression of MTP Gene Expression in Stable Transformants of McA-RH Cells by miRNA Has No Effect on the Secretion of ApoB:1000—To further substantiate our hypothesis that addition of phospholipids to apoB:1000 and initiation of apoB particle assembly occur independently of MTP activity, we employed RNAi to suppress MTP gene expression. McA-RH cells stably expressing apoB:1000 were transfected with either MTP miRNA or negative control miRNA as described under "Experimental Procedures." As shown in Fig. 6B (representative of three individual dishes), transfection of cells with MTP miRNA resulted in ~60% decrease in MTP mRNA level as compared with cells transfected with negative control miRNA. The GAPDH mRNA level was the same in both cell lines establishing the specificity of MTP miRNA (Fig. 6B). After 18 days in DMEM-containing serum and blasticidin (5 µg/ml of medium), the secretion of 35S-labeled apoB:1000 in both cell lines was determined and was compared with the MTP protein levels. As shown in Fig. 7, transfection of cells with MTP miRNA led to an ~70% decrease in MTP protein level when compared with cells transfected with negative control miRNA. In contrast, there was no change in the secretion of 35S-labeled apoB:1000 in McA-RH cells transfected with MTP miRNA as compared with cells transfected with negative control miRNA (Fig. 7).


Figure 7
View larger version (42K):
[in this window]
[in a new window]

  		FIGURE 7.
Suppression of MTP gene expression does not affect the secretion of apoB:1000 in stable transformants of McA-RH cells. A, stable transformants of McA-RH cells expressing apoB:1000 were transfected with MTP miRNA or negative control miRNA, as described in the legend to Fig. 6. Cells were grown for 18 days in DMEM-containing serum and blasticidin (5 µg/ml of medium). Both cell lines were incubated for 3.5 h in serum-, methionine-, and cysteine-free DMEM containing [35S]Met/Cys (100 µCi/ml). The 35S-labeled apoB:1000 secreted into the medium was immunoprecipitated using monospecific polyclonal antibody to human apoB100, and proteins were separated by 4-12% SDS-PAGE and subjected to autoradiography. Cell monolayers from duplicate dishes were washed with PBS and analyzed for MTP protein level by Western blot. B, intensities of the MTP protein and 35S-labeled apoB:1000 bands were determined by computer-assisted image processing, normalized for cell protein, and plotted as mean ± S.E. of triplicate dishes.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
We previously suggested (53, 54), based on sequence homology between the beta{alpha}1 domain of apoB (N-terminal 1000-residue domain of apoB100) and LV (54-57), that this region is homologous to the proposed lipid binding cavity in LV, and therefore, this domain might be a lipid-binding pocket for apoB (54). We proposed that formation of an LV-like lipid pocket is necessary for lipid transfer to apoB-containing lipoprotein particles, and we suggested (53, 54) that initiation of particle assembly occurs when the beta{alpha}1 domain folds into a three-sided LV-like lipid binding cavity. Alternatively, the lipid pocket we propose is formed by association of the region of the beta{alpha}1 domain homologous to the betaA and betaB sheets of LV with betaD-like amphipathic beta-sheet from MTP (53, 54). In our initial studies (26), we provided evidence for the formation of a lipid pocket intermediate in the assembly of apoB-containing lipoproteins by the N-terminal 1000 amino acid residues of apoB100. We demonstrated that apoB:1000 is secreted by stable transformants of McA-RH cells as a monodisperse, relatively lipid-enriched particle in the HDL3-like density range (26). In subsequent studies, our experimentally derived results (27) and all atom molecular modeling of the beta{alpha}1 domain (28) demonstrated that the N-terminal 1000 amino acid residues of apoB100 are necessary and competent to form the lipid pocket without the structural requirement for MTP and that the lipid pocket is PL-rich (27). These results, however, did not exclude the putative functional role of MTP in the initial lipidation of apoB:1000.

To determine whether addition of phospholipids to apoB: 1000 and the formation of the PL-rich initiation complex in apoB assembly is dependent on MTP lipid transfer activity, we tested the effects of two well characterized (13, 34) and widely used (13, 17, 20, 23, 33, 48, 52) inhibitors of MTP lipid transfer activity, BMS-197636 and BMS-200150, on the de novo synthesis, lipidation, and secretion of apoB:1000 in stable transformants of McA-RH cells. To provide more definitive evidence for our hypothesis that the initial step in apoB particle assembly is independent of MTP activity, we suppressed MTP gene expression in apoB:1000-expressing McA-RH cells by miRNA, and we assessed potential correlation between MTP protein level and apoB:1000 secretion.

Results clearly and consistently demonstrated that BMS-200150 at 5, 10, or 20 µM and BMS-197636 at 0.1 or 0.2 µM had no detectable effect on either the synthesis and secretion of 35S-labeled apoB:1000 or the content and composition of lipids associated with the secreted intact apoB:1000-containing particles in stable transformants of McA-RH cells. In marked contrast, and consistent with previously reported studies in HepG2 cells (13, 51) and McA-RH cells stably expressing human apoB100 (23, 48), the secretion of 35S-labeled endogenous apoB100 in HepG2 and parental untransfected McA-RH cells was inhibited by 86-94% with 5-20 µM BMS-200150 and was almost completely abolished with 0.1 µM BMS-197636. Even at 40 µM of BMS-200150, a concentration that almost completely abolished the synthesis and secretion of 35S-labeled endogenous apoB100 in HepG2 and parental untransfected McA-RH7777 cells, we observed only a modest 15-20% inhibition in apoB:1000 lipidation and secretion in McA-RH cells. Because albumin secretion, a measure of hepatic function, was also decreased to the same extent, the observed inhibitory effect of 40 µM BMS-200150 on apoB:1000 could be attributed to the nonspecific effect of a high concentration of this compound on hepatic protein synthesis.

The lack of requirement of MTP lipid transfer activity for the synthesis and secretion of apoB:1000 was also evident in the unchanged lipid content and composition of the secreted intact apoB:1000-containing particles in the presence of BMS-197636 (0.1 µM) and BMS-200150 (5-20 µM). The moderate 18% reduction in total lipid content of apoB:1000 with 40 µM BMS-200150, which correlated with a similar decrease in the de novo synthesis and secretion of apoB:1000, was because of its apparent nonspecific effect on hepatic protein synthesis. Under identical experimental conditions, the labeled lipids associated with intact endogenous apoB100-containing particles secreted by HepG2 and parental untransfected McA-RH cells were either drastically decreased or almost completely abolished. These particles also had a lower content of TAG and higher level of PL as compared with those secreted by control Me2SO-treated cells. The MTP inhibitors, however, did not have any effect on either the concentration or composition of cellular lipids in either HepG2 cells or parental untransfected McA-RH cells, an observation similar to that reported by Wang et al. (23). The inability of MTP inhibitors to decrease the lipidation and secretion of apoB:1000-containing particles was not because of altered lipid metabolism in transfected McA-RH cells, as demonstrated by a similar rate of secretion of newly synthesized lipids into the conditioned media of parental untransfected and apoB:1000-expressing McA-RH cells. Thus, by careful dose-response (Figs. 1, 2, 3 and Table 1) and time course (Fig. 4) experiments, we have demonstrated that the synthesis, lipidation, and secretion of apoB:1000-containing particles are independent of MTP lipid transfer activity.

To further validate the results obtained with the inhibitors of MTP lipid transfer activity, we suppressed MTP gene expression in apoB:1000-expressing McA-RH cells by miRNA. First, we found equivalent levels of MTP mRNA and protein in parental untransfected and apoB:1000-expressing McA-RH7777 cells. These results established that the inefficacy of BMS-197636 and BMS-200150 to inhibit the synthesis and secretion of apoB:1000 in McA-RH cells was not because of altered expression level of MTP in these cells. Second, suppression of MTP gene expression in stable transformants of McA-RH cells by miRNA led to a 60-70% reduction in MTP mRNA and protein levels. However, MTP deficiency had no detectable effect on the secretion of 35S-labeled apoB:1000 in these cells, corroborating the results obtained with the inhibitors of MTP lipid transfer activity. Collectively, these results strongly support our hypothesis that the synthesis, PL addition, and secretion of apoB:1000-containing particles are independent of the lipid transfer activity of MTP.

MTP has a distinct preference for TAG transfer and its lipid transport rate decreases in the order of TAG > cholesteryl esters > diacylglycerol > cholesterol > PL (11, 52, 58, 59). In a recent study, Rava et al. (60) have supported our previous studies demonstrating that the primordial apoB-containing particles are PL-rich (26-28) and have proposed that the PL transfer activity of MTP is sufficient for the assembly and secretion of primordial apoB lipoproteins. This conclusion was based mainly on the observations derived from the effect of Drosophila MTP on the secretion of truncated forms of human apoB in COS cells (60). These investigators showed that Drosophila MTP, which is defective in TAG transfer activity but has PL transfer activity equal to that of human MTP, supports the secretion of human apoB48, apoB53, and apoB72 in COS cells (60). Our results, indicating that MTP activity is not required for the initiation of apoB assembly, are at variance with the conclusion reached by Rava et al. (60). Although we do not know the exact reason for this discrepancy, we speculate that the inconsistency in the results arise, most likely, from the use of cell lines with distinctly different tissue origins. Several differences between the two cell lines, with regard to lipoprotein metabolism, are noteworthy and are outlined below.

First, in our study, we used lipoprotein producing rat hepatoma McA-RH cells, whereas Rava et al. (60) used COS cells, transformed African green monkey kidney fibroblast cells, which normally do not produce lipoproteins. Second, in the study by Rava et al. (60), the secretion of apoB18 in COS cells was considerably higher than that of apoB48 and especially apoB53, whereas in McA-RH cells, apoB18 was secreted much more slowly than apoB48 and apoB53 (47). Third, Rava et al. (60) demonstrated that MTP is not required for the secretion of apoB18. Relevant to this finding are studies demonstrating that apoB17 readily associates with phospholipids (61-63). Assuming that PL transfer activity of MTP is sufficient for the formation of primordial apoB particles, it is reasonable to expect that the secretion of apoB18 in COS cells would increase, at least partially, by the expression of Drosophila MTP; this was not observed by Rava et al. (60). Fourth, Rava et al. (60) were unable to measure any significant PL transfer activity in cell lysates of COS cells expressing either human or Drosophila MTP. In addition, these investigators (60) observed 72% decrease in TAG transfer activity in mouse Mttp gene-deleted liver homogenates but did not detect any change in PL transfer activity, indicating the presence of other PL transfer activities. In our studies, we found similar levels of MTP mRNA and protein in parental untransfected and apoB:1000-expressing McA-RH cells (Fig. 6), and we demonstrated that miRNA-mediated 70% decrease in MTP protein level had no effect on the secretion of 35S-labeled apoB:1000 (Fig. 7). Fifth, in the study by Rava et al. (60), the secretion of apoB48 in COS cells was shown to be dependent on MTP expression. In contrast, studies by Wang et al. (23) demonstrated that in McA-RH cells, the assembly/secretion of apoB48 HDL was relatively unaffected by the MTP inhibitor, suggesting that secretion of apoB48 in liver-derived cells may not depend on MTP activity. Considering the complexity of apoB-containing lipoprotein assembly, COS cells may not have the full complement of numerous factors and chaperons known to be necessary for apoB-containing particle maturation (2). This possibility is supported by studies demonstrating that nonhepatic cell lines synthesize apoB but cannot process it into lipoproteins (64).

Several lines of evidence support our results and conclusion. First, the PL transfer activity of MTP, which is ~5% of its TAG transfer activity, is inhibited by 60% in the presence of 0.1 µM of BMS-197636 (52). Our results demonstrated that 0.1 µM of BMS-197636 had no detectable effect on either the synthesis and secretion of 35S-labeled apoB:1000 (Figs. 2, 3, 4) or the concentration and composition of 3H-labeled lipids associated with intact apoB:1000-containing particles secreted by stable McA-RH cells (Fig. 5 and Table 1). Second, BMS-200150 at 5-20 µM inhibits PL transfer activity of human (13) and rat (60) MTP by 30-40%, MTP lipid transfer activity in HepG2 cells by 80-90% (51), and the synthesis, lipidation, and secretion of endogenous apoB100-containing particles in HepG2 and parental untransfected McA-RH cells by 70-95%, as shown in this study (Figs. 1 and 3 and Tables 2 and 3). Our results clearly demonstrated that these concentrations of BMS-200150 had no detectable effect on the de novo synthesis, lipidation, and secretion of apoB:1000-containing particles in McA-RH cells (Figs. 1, 2, 3 and Table 1). Third, although MTP has been proposed to be crucial for the proper folding and lipidation of apoB during translocation into the lumen of ER (15, 18, 19), in vitro translation studies have shown that apoB48 is efficiently translocated into the lumen of dog pancreas microsomes in which the activity of MTP is not detectable (65). Fourth, in McA-RH cells, the secretion of human apoB29 and apoB18 was not affected by the MTP inhibitor 4'-bromo-3'-methylmetaqualone (66). In mouse primary hepatocytes, BMS-197636 inhibited the secretion of apoB100 by 90%, whereas apoB48 secretion was only slightly decreased (21). In mouse hepatocyte-like cell line MhAT3F, which produces both apoB100 and apoB48, MTP inhibitor preferentially blocked the secretion of apoB100 (66). In HepG2 cells, synthesis of apoB polypeptides the size of 100-200 kDa was insensitive to MTP inhibitors, suggesting that MTP inhibitors did not affect the initiation of apoB100 translation (16). In human-derived differentiated intestinal Caco-2 cells, BMS-200150 impaired the secretion of apoB100, whereas apoB48 secretion was relatively unaffected (67). Fifth, the liver-specific inactivation of the Mttp gene in the mouse lowered apoB100 levels in plasma by >95% but reduced plasma apoB48 levels by only 20% (24), and MTP-deficient mouse hepatocytes secreted apoB-containing lipoproteins of HDL and LDL sizes but not VLDL-sized lipoproteins (68).

In summary, we investigated the putative functional role of MTP in the initiation of apoB assembly relying on the use of two inhibitors of MTP lipid transfer activity, BMS-197636 and BMS-200150, and suppression of MTP gene expression by miRNA. Both inhibitors consistently failed to affect the synthesis, lipidation, assembly, and secretion of apoB:1000-containing particles in stable transformants of McA-RH cells indicating that MTP activity is not required for the initial addition of PL to the growing polypeptide. The miRNA-mediated suppression of MTP gene expression led to a 60-70% reduction in MTP mRNA and protein levels but had no detectable effect on the secretion of apoB:1000 in McA-RH cells. From the perspective of apoB assembly, our results do not rule out the role of MTP in the first step assembly of apoB-containing particles. At present, the structural elements within the apoB polypeptide that govern requirement for MTP are not known. Available evidence suggest the following: (i) segments equal to or greater than apoB48 containing the N-terminal 17% of the protein respond to MTP activity (14); (ii) sequences in the C terminus of apoB29 bind PL (69); (iii) sequences between apoB29 and apoB32.5 augment TAG binding (69); (iv) sequences between apoB32.5 and apoB41 account for the marked incorporation of TAG (69); and (v) the domain between apoB51 and apoB53 has a high requirement for MTP (66), and this region is within the {alpha}2 domain of apoB100 (53). Our results provide a compelling argument that the addition of phospholipids to apoB:1000 (apoB22.05), initiation of apoB particle assembly, and the formation of the primordial PL-rich apoB-containing lipoproteins are independent of MTP lipid transfer activity. We propose that factor(s) other than MTP mediate this early stage of apoB lipoprotein particle assembly. Identification of this factor would render it an efficacious pharmacological target to reduce the formation of atherogenic apoB-containing lipoproteins at the very early stage.


   FOOTNOTES
 
* This work was supported by the National Institutes of Health Grants HL084685 and PO1 HL34343. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Dept. of Medicine, University of Alabama at Birmingham, 1808 7th Ave. South, BDB-D680, Birmingham, AL 35292-0012. Tel.: 205-975-2159; Fax: 205-975-8079; E-mail: ndashti{at}uab.edu.

2 The abbreviations used are: apoB, apolipoprotein B; apoB:1000, N-terminal 22.05% (residues 1-1000) of the mature protein; BSA, bovine serum albumin; DMEM, Dulbecco's modified Eagle's medium; Me2SO, dimethyl sulfoxide; ER, endoplasmic reticulum; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HDL, high density lipoprotein; HS, horse serum; LDL, low density lipoprotein; LV, lipovitellin; MTP, microsomal triglyceride transfer protein; NDGGE, nondenaturing gradient gel electrophoresis; PL, phospholipids; PBS, phosphate-buffered saline; TAG, triacylglycerol; VLDL, very low density lipoprotein; miRNA, micro-interfering RNA; RNAi, RNA interference; oligo, oligonucleotide. Back


   ACKNOWLEDGMENTS
 
We thank Dr. David Gordon and Dr. J. R. Wetterau (Bristol-Myers Squibb Co.) for providing BMS-197636, BMS-200150, and the antibody to MTP. We thank Dr. Zemin Yao (University of Ottawa Heart Institute, Ottawa, Ontario) for providing apoB100 cDNA.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Schumaker, V. N., Phillips, M. L., and Chatterton, J. E. (1994) Adv. Protein Chem. 45, 205-248[Medline] [Order article via Infotrieve]
  2. Fisher, E. A., and Ginsberg, H. N. (2002) J. Biol. Chem. 277, 17377-17380[Free Full Text]
  3. Knott, T. J., Pease, R. J., Powell, L. M., Wallis, S. C., Rall, S. C., Jr., Innerarity, T. L., Blackhart, B., Taylor, W. H., Marcel, Y., Milne, R., Johnson, D., Fuller, M., Lusis, A. J., McCarthy, B. J., Mahley, R. W., Levy-Wilson, B., and Scott, J. (1986) Nature 323, 734-738[CrossRef][Medline] [Order article via Infotrieve]
  4. Yang, C. Y., Chen, S. H., Gianturco, S. H., Bradley, W. A., Sparrow, J. T., Tanimura, M., Li, W. H., Sparrow, D. A., DeLoof, H., Rosseneu, M., Lee, F. S., Gu, Z. W., Gotto, A. M., Jr., and Chan, L. (1986) Nature 323, 738-742[CrossRef][Medline] [Order article via Infotrieve]
  5. Elovson, J., Chatterton, J. E., Bell, G. T., Schumaker, V. N., Reuben, M. A., Puppione, D. L., Reeve, J. R., Jr., and Young, N. L. (1988) J. Lipid Res. 29, 1461-1473[Abstract]
  6. Alexander, C. A., Hamilton, R. L., and Havel, R. J. (1976) J. Cell Biol. 69, 241-263[Abstract/Free Full Text]
  7. Olofsson, S. O., Stillemark-Billton, P., and Asp, L. (2000) Trends Cardiovasc. Med. 10, 338-345[CrossRef][Medline] [Order article via Infotrieve]
  8. Davis, R. A. (1999) Biochim. Biophys. Acta 1440, 1-31[Medline] [Order article via Infotrieve]
  9. Hamilton, R. L., Wong, J. S., Cham, C. M., Nielsen, L. B., and Young, S. G. (1998) J. Lipid Res. 39, 1543-1557[Abstract/Free Full Text]
  10. Boren, J., Rustaeus, S., and Olofsson, S. O. (1994) J. Biol. Chem. 269, 25879-25888[Abstract/Free Full Text]
  11. Wetterau, J. R., Aggerbeck, L. P., Bouma, M. E., Eisenberg, C., Munck, A., Hermier, M., Schmitz, J., Gay, G., Rader, D. J., and Gregg, R. E. (1992) Science 258, 999-1001[Abstract/Free Full Text]
  12. Gordon, D. A., Jamil, H., Sharp, D., Mullaney, D., Yao, Z., Gregg, R. E., and Wetterau, J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 7628-7632[Abstract/Free Full Text]
  13. Jamil, H., Gordon, D. A., Eustice, D. C., Brooks, C. M., Dickson, J. K., Jr., Chen, Y., Ricci, B., Chu, C. H., Harrity, T. W., Ciosek, C. P., Jr., Biller, S. A., Gregg, R. E., and Wetterau, J. R. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 11991-11995[Abstract/Free Full Text]
  14. Gretch, D. G., Sturley, S. L., Wang, L., Lipton, B. A., Dunning, A., Grunwald, K. A., Wetterau, J. R., Yao, Z., Talmud, P., and Attie, A. D. (1996) J. Biol. Chem. 271, 8682-8691[Abstract/Free Full Text]
  15. Du, E. Z., Wang, S. L., Kayden, H. J., Sokol, R., Curtiss, L. K., and Davis, R. A. (1996) J. Lipid Res. 37, 1309-1315[Abstract]
  16. Benoist, F., and Grand-Perret, T. (1997) J. Biol. Chem. 272, 20435-20442[Abstract/Free Full Text]
  17. Gordon, D. A., Jamil, H., Gregg, R. E., Olofsson, S. O., and Boren, J. (1996) J. Biol. Chem. 271, 33047-33053[Abstract/Free Full Text]
  18. Rustaeus, S., Stillemark, P., Lindberg, K., Gordon, D., and Olofsson, S. O. (1998) J. Biol. Chem. 273, 5196-5203[Abstract/Free Full Text]
  19. Mitchell, D. M., Zhou, M., Pariyarath, R., Wang, H., Aitchison, J. D., Ginsberg, H. N., and Fisher, E. A. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 14733-14738[Abstract/Free Full Text]
  20. Pan, M., Liang, J. S., Fisher, E. A., and Ginsberg, H. N. (2002) J. Biol. Chem. 277, 4413-4421[Abstract/Free Full Text]
  21. Kulinski, A., Rustaeus, S., and Vance, J. E. (2002) J. Biol. Chem. 277, 31516-31525[Abstract/Free Full Text]
  22. Wang, Y., McLeod, R. S., and Yao, Z. (1997) J. Biol. Chem. 272, 12272-12278[Abstract/Free Full Text]
  23. Wang, Y., Tran, K., and Yao, Z. (1999) J. Biol. Chem. 274, 27793-27800[Abstract/Free Full Text]
  24. Raabe, M., Veniant, M. M., Sullivan, M. A., Zlot, C. H., Bjorkegren, J., Nielsen, L. B., Wong, J. S., Hamilton, R. L., and Young, S. G. (1999) J. Clin. Investig. 103, 1287-1298[Medline] [Order article via Infotrieve]
  25. Levy, E., Stan, S., Delvin, E., Menard, D., Shoulders, C., Garofalo, C., Slight, I., Seidman, E., Mayer, G., and Bendayan, M. (2002) J. Biol. Chem. 277, 16470-16477[Abstract/Free Full Text]
  26. Dashti, N., Gandhi, M., Liu, X., Lin, X., and Segrest, J. P. (2002) Biochemistry 41, 6978-6987[CrossRef][Medline] [Order article via Infotrieve]
  27. Manchekar, M., Richardson, P. E., Forte, T. M., Datta, G., Segrest, J. P., and Dashti, N. (2004) J. Biol. Chem. 279, 39757-39766[Abstract/Free Full Text]
  28. Richardson, P. E., Manchekar, M., Dashti, N., Jones, M. K., Beigneux, A., Young, S. G., Harvey, S. C., and Segrest, J. P. (2005) Biophys. J. 88, 2789-2800[CrossRef][Medline] [Order article via Infotrieve]
  29. Ohlendorf, D. H., Barbarash, G. R., Trout, A., Kent, C., and Banaszak, L. J. (1977) J. Biol. Chem. 252, 7922-8001
  30. de Chaffoy de Courcelles, D., and Kondo, M. (1980) J. Biol. Chem. 255, 6727-6733[Abstract/Free Full Text]
  31. Anderson, T. A., Levitt, D. G., and Banaszak, L. J. (1998) Structure (Lond.) 6, 895-909[Medline] [Order article via Infotrieve]
  32. Shelness, G. S., Hou, L., Ledford, A. S., Parks, J. S., and Weinberg, R. B. (2003) J. Biol. Chem. 278, 44702-44707[Abstract/Free Full Text]
  33. Hussain, M. M., Shi, J., and Dreizen, P. (2003) J. Lipid Res. 44, 22-32[Abstract/Free Full Text]
  34. Wetterau, J. R., Gregg, R. E., Harrity, T. W., Arbeeny, C., Cap, M., Connolly, F., Chu, C. H., George, R. J., Gordon, D. A., Jamil, H., Jolibois, K. G., Kunselman, L. K., Lan, S. J., Maccagnan, T. J., Ricci, B., Yan, M., Young, D., Chen, Y., Fryszman, O. M., Logan, J. V., Musial, C. L., Poss, M. A., Robl, J. A., Simpkins, L. M., and Biller, S. A. (1998) Science 282, 751-754[Abstract/Free Full Text]
  35. Yao, Z. M., Blackhart, B. D., Johnson, D. F., Taylor, S. M., Haubold, K. W., and McCarthy, B. J. (1992) J. Biol. Chem. 267, 1175-1182[Abstract/Free Full Text]
  36. Miller, A. D., Miller, D. G., Garcia, J. V., and Lynch, C. M. (1993) Methods Enzymol. 217, 581-599[Medline] [Order article via Infotrieve]
  37. Dashti, N., Datta, G., Manchekar, M., Chaddha, M., and Anantharamaiah, G. M. (2004) J. Lipid Res. 45, 1919-1928[Abstract/Free Full Text]
  38. Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) J. Biol. Chem. 193, 265-275[Free Full Text]
  39. Dashti, N. (1992) J. Biol. Chem. 267, 7160-7169[Abstract/Free Full Text]
  40. Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve]
  41. Burnette, W. N. (1981) Anal. Biochem. 112, 195-203[CrossRef][Medline] [Order article via Infotrieve]
  42. Folch, J., Lees, M., and Sloane Stanley, G. H. (1957) J. Biol. Chem. 226, 497-509[Free Full Text]
  43. Dashti, N., Feng, Q., Freeman, M. R., Gandhi, M., and Franklin, F. A. (2002) J. Nutr. 132, 2651-2659[Abstract/Free Full Text]
  44. Lin, M. C., Gordon, D., and Wetterau, J. R. (1995) J. Lipid Res. 36, 1073-1081[Abstract]
  45. Tanabe, S., Sherman, H., Smith, L., Yang, L. A., Fleming, R., and Hay, R. (1989) In Vitro Cell. Dev. Biol. 25, 1129-1140[Medline] [Order article via Infotrieve]
  46. Yao, Z., Lauer, S. J., Sanan, D. A., and Fazio, S. (1993) Arterioscler. Thromb. 13, 1476-1486[Abstract/Free Full Text]
  47. Yao, Z. M., Blackhart, B. D., Linton, M. F., Taylor, S. M., Young, S. G., and McCarthy, B. J. (1991) J. Biol. Chem. 266, 3300-3308[Abstract/Free Full Text]
  48. Tran, K., Thorne-Tjomsland, G., DeLong, C. J., Cui, Z., Shan, J., Burton, L., Jamieson, J. C., and Yao, Z. (2002) J. Biol. Chem. 277, 31187-31200[Abstract/Free Full Text]
  49. Stillemark-Billton, P., Beck, C., Boren, J., and Olofsson, S. O. (2005) J. Lipid Res. 46, 104-114[Abstract/Free Full Text]
  50. Yamaguchi, J., Conlon, D. M., Liang, J. J., Fisher, E. A., and Ginsberg, H. N. (2006) J. Biol. Chem. 281, 27063-27071[Abstract/Free Full Text]
  51. Athar, H., Iqbal, J., Jiang, X. C., and Hussain, M. M. (2004) J. Lipid Res. 45, 764-772[Abstract/Free Full Text]
  52. Rava, P., Athar, H., Johnson, C., and Hussain, M. M. (2005) J. Lipid Res. 46, 1779-1785[Abstract/Free Full Text]
  53. Segrest, J. P., Jones, M. K., De Loof, H., and Dashti, N. (2001) J. Lipid Res. 42, 1346-1367[Abstract/Free Full Text]
  54. Segrest, J. P., Jones, M. K., and Dashti, N. (1999) J. Lipid Res. 40, 1401-1416[Abstract/Free Full Text]
  55. Steyrer, E., Barber, D. L., and Schneider, W. J. (1990) J. Biol. Chem. 265, 19575-19581[Abstract/Free Full Text]
  56. Perez, L. E., Fenton, M. J., and Callard, I. P. (1991) Comp. Biochem. Physiol. B 100, 821-826[CrossRef][Medline] [Order article via Infotrieve]
  57. Mann, C. J., Anderson, T. A., Read, J., Chester, S. A., Harrison, G. B., Kochl, S., Ritchie, P. J., Bradbury, P., Hussain, F. S., Amey, J., Vanloo, B., Rosseneu, M., Infante, R., Hancock, J. M., Levitt, D. G., Banaszak, L. J., Scott, J., and Shoulders, C. C. (1999) J. Mol. Biol. 285, 391-408[CrossRef][Medline] [Order article via Infotrieve]
  58. Atzel, A., and Wetterau, J. R. (1993) Biochemistry 32, 10444-10450[CrossRef][Medline] [Order article via Infotrieve]
  59. Jamil, H., Dickson, J. K., Jr., Chu, C. H., Lago, M. W., Rinehart, J. K., Biller, S. A., Gregg, R. E., and Wetterau, J. R. (1995) J. Biol. Chem. 270, 6549-6554[Abstract/Free Full Text]
  60. Rava, P., Ojakian, G. K., Shelness, G. S., and Hussain, M. M. (2006) J. Biol. Chem. 281, 11019-11027[Abstract/Free Full Text]
  61. Herscovitz, H., Hadzopoulou-Cladaras, M., Walsh, M. T., Cladaras, C., Zannis, V. I., and Small, D. M. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7313-7317[Abstract/Free Full Text]
  62. Herscovitz, H., Derksen, A., Walsh, M. T., McKnight, C. J., Gantz, D. L., Hadzopoulou-Cladaras, M., Zannis, V., Curry, C., and Small, D. M. (2001) J. Lipid Res. 42, 51-59[Abstract/Free Full Text]
  63. Jiang, Z. G., Gantz, D., Bullitt, E., and McKnight, C. J. (2006) Biochemistry 45, 11799-11808[CrossRef][Medline] [Order article via Infotrieve]
  64. Dixon, J. L., Biddle, J., Lo, C. M., Stoops, J. D., Li, H., Sakata, N., and Phillips, T. E. (2002) J. Histochem. Cytochem. 50, 629-640[Abstract/Free Full Text]
  65. Rusinol, A. E., Jamil, H., and Vance, J. E. (1997) J. Biol. Chem. 272, 8019-8025[Abstract/Free Full Text]
  66. Nicodeme, E., Benoist, F., McLeod, R., Yao, Z., Scott, J., Shoulders, C. C., and Grand-Perret, T. (1999) J. Biol. Chem. 274, 1986-1993[Abstract/Free Full Text]
  67. van Greevenbroek, M. M., Robertus-Teunissen, M. G., Erkelens, D. W., and de Bruin, T. W. (1998) J. Lipid Res. 39, 173-185[Abstract/Free Full Text]
  68. Larsson, S. L., Skogsberg, J., and Bjorkegren, J. (2004) J. Biol. Chem. 279, 831-836[Abstract/Free Full Text]
  69. Carraway, M., Herscovitz, H., Zannis, V., and Small, D. M. (2000) Biochemistry 39, 9737-9745[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Lipid Res.Home page
L. Wang, D. D. O. Martin, E. Genter, J. Wang, R. S. McLeod, and D. M. Small
Surface study of apoB1694-1880, a sequence that can anchor apoB to lipoproteins and make it nonexchangeable
J. Lipid Res., July 1, 2009; 50(7): 1340 - 1352.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
H. N. Ginsberg and E. A. Fisher
The ever-expanding role of degradation in the regulation of apolipoprotein B metabolism
J. Lipid Res., April 1, 2009; 50(Supplement): S162 - S166.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
A. S. Ledford, V. A. Cook, G. S. Shelness, and R. B. Weinberg
Structural and dynamic interfacial properties of the lipoprotein initiating domain of apolipoprotein B
J. Lipid Res., January 1, 2009; 50(1): 108 - 115.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Manchekar, P. E. Richardson, Z. Sun, Y. Liu, J. P. Segrest, and N. Dashti
Charged Amino Acid Residues 997-1000 of Human Apolipoprotein B100 Are Critical for the Initiation of Lipoprotein Assembly and the Formation of a Stable Lipidated Primordial Particle in McA-RH7777 Cells
J. Biol. Chem., October 24, 2008; 283(43): 29251 - 29265.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/39/28597    most recent
M700229200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dashti, N.
Right arrow Articles by Segrest, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dashti, N.
Right arrow Articles by Segrest, J. P.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement