Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M700577200 on August 3, 2007

J. Biol. Chem., Vol. 282, Issue 40, 29089-29100, October 5, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/40/29089    most recent
M700577200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hamdan, F. F.
Right arrow Articles by Bouvier, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hamdan, F. F.
Right arrow Articles by Bouvier, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Unraveling G Protein-coupled Receptor Endocytosis Pathways Using Real-time Monitoring of Agonist-promoted Interaction between beta-Arrestins and AP-2*

Fadi F. Hamdan{ddagger}123, Moulay Driss Rochdi{ddagger}13, Billy Breton{ddagger}, Delphine Fessart§, Douce E. Michaud{ddagger}, Pascale G. Charest{ddagger}4, Stéphane A. Laporte§5, and Michel Bouvier{ddagger}6

From the {ddagger}Department of Biochemistry and Groupe de Recherche Universitaire sur le Médicament, Institute for Research in Immunology and Cancer, Université de Montréal, Montréal, Québec H3C 3J7 and the §Department of Medicine, McGill University, Montréal, Québec H3A 1A1, Canada

Received for publication, January 19, 2007 , and in revised form, July 3, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The most widely studied pathway underlying agonist-promoted internalization of G protein-coupled receptors (GPCRs) involves beta-arrestin and clathrin-coated pits. However, both beta-arrestin- and clathrin-independent processes have also been reported. Classically, the endocytic routes are characterized using pharmacological inhibitors and various dominant negative mutants, resulting sometimes in conflicting results and interpretational difficulties. Here, taking advantage of the fact that beta-arrestin binding to the beta2 subunit of the clathrin adaptor AP-2 (beta2-adaptin) is needed for the beta-arrestin-mediated targeting of GPCRs to clathrin-coated pits, we developed a bioluminescence resonance energy transfer-based approach directly assessing the molecular steps involved in the endocytosis of GPCRs in living cells. For 10 of the 12 receptors tested, including some that were previously suggested to internalize via clathrin-independent pathways, agonist stimulation promoted beta-arrestin 1 and 2 interaction with beta2-adaptin, indicating a beta-arrestin- and clathrin-dependent endocytic process. Detailed analyses of beta-arrestin interactions with both the receptor and beta2-adaptin also allowed us to demonstrate that recruitment of beta-arrestins to the receptor and the ensuing conformational changes are the leading events preceding AP-2 engagement and subsequent clathrin-mediated endocytosis. Among the receptors tested, only the endothelin A and B receptors failed to promote interaction between beta-arrestins and beta2-adaptin. However, both receptors recruited beta-arrestins upon agonist stimulation, suggesting a beta-arrestin-dependent but clathrin-independent route of internalization for these two receptors. In addition to providing a new tool to dissect the molecular events involved in GPCR endocytosis, the bioluminescence resonance energy transfer-based beta-arrestin/beta2-adaptin interaction assay represents a novel biosensor to assess receptor activation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
G protein-coupled receptors (GPCRs)7 are seven transmembrane domain receptors that constitute the largest family of cell surface proteins involved in signal transduction. In humans, it is estimated that GPCRs are encoded by ~800 distinct genes that control a variety of important physiological responses (1). Following agonist binding, GPCRs undergo conformational changes that regulate the activity of downstream effector systems to mediate various cellular responses. The extent and duration of GPCR signaling is tightly regulated by mechanisms that terminate the initial signaling and later re-establish the capacity of the receptors to respond to new agonist exposure. The removal of GPCRs from the cell surface, also known as internalization or endocytosis, plays an important role in these processes (2, 3). For most GPCRs, rapid feedback desensitization is initiated by G protein-coupled receptor kinases that phosphorylate agonist-occupied GPCRs to create high affinity binding sites for beta-arrestins, which in turn uncouple the receptor from its cognate G protein (reviewed in Ref. 4). beta-Arrestins also target receptors for endocytosis by linking them to the endocytic machinery, including clathrin and the clathrin adaptor AP-2 (5–11). By controlling receptor recycling following endocytosis, beta-arrestins have also been shown to regulate the rate of receptor resensitization (12). Based on their interaction with beta-arrestins, GPCRs are divided into two main classes. Class A, which includes receptors such as the beta2-adrenergic (beta2AR), endothelin A (ETAR), and V1a vasopressin (V1aR), interacts transiently with beta-arrestins and can rapidly recycle back from the endosomes to the cell surface (13, 14). Class B receptors, such as vasopressin V2 (V2R), CC-chemokine 5 (CCR5), prostaglandin EP4 (EP4R), and vasoactive intestinal peptide 1 (VIP1R), interact more stably with beta-arrestins, leading to a complex that resides for extended periods of time into endosomes. Receptors tightly associated with beta-arrestins in endosomes are only poorly recycled to the cell surface and eventually targeted for lysosomal degradation (13–17). The two classes of receptors also differ by their binding preference toward beta-arrestin1 and beta-arrestin2. Indeed, whereas class A receptors binds with greater affinity to beta-arrestin2, class B receptors do not show preference between the two beta-arrestins (13). More recently, it was suggested that some receptors may not be easily classified in class A or B. For example, the bradykinin B2 receptor (B2R) was found to internalize with beta-arrestins into endosomes but can then dissociate from beta-arrestin and efficiently recycle to the plasma membrane after agonist removal (18). The authors suggested that receptors with such hybrid features could be referred to as class C.

Although the roles of beta-arrestins and clathrin-coated vesicles in GPCR endocytosis have been well characterized, alternative pathways involving non-coated vesicles, such as caveolae, or other non-clathrin and non-caveolae mediated routes, have also been described for several receptors (reviewed in Refs. 2, 3, 19). Also, the requirement for beta-arrestin does not seem to be universal, and endocytosis of some GPCRs through either clathrin-coated vesicles or caveolae was proposed to be beta-arrestin-independent (20). To characterize the various endocytic routes used by different receptors, several pharmacological and biochemical tools have been used. These include blockers that do not discriminate between clathrin-dependent or caveolae-mediated endocytosis (e.g. hypertonic sucrose, low temperature, concanavalin-A, and dominant negative mutants of dynamin) as well as inhibitors that are believed to selectively inhibit clathrin-coated vesicle (e.g. monodansylcadaverine, chlorpromazine, as well as dominant negative mutants of beta-arrestin and Eps-15) or caveolae-mediated endocytosis (e.g. filpin and nystatin) (3, 19, 21, 22). Although these approaches have been useful, the interpretation of their data was sometimes difficult and generated some controversies on the exact mechanism underlying the endocytosis of certain GPCRs. For example, inhibition of endocytosis by dominant negative mutants of beta-arrestins (beta-arrestin1(V53D), beta-arrestin1-(319–418), and beta-arrestin2({Delta}LIELD/F391A) (7, 23, 24)) or a dominant negative of the AP-2 interacting protein Eps15 (25) has often been used to suggest the involvement of a clathrin-mediated process. However, in the case of the ETAR, endocytosis through caveolae was also inhibited by a dominant negative mutant of beta-arrestin (20). Similarly, inhibiting Eps15 has been recently found to prevent caveolae-mediated endocytosis of the epidermal growth factor receptor (26). Off-target effects of dominant negative mutants can also complicate interpretation of the results. For instance, whereas it was initially believed that beta-arrestins were specific regulators for GPCRs, growing evidences demonstrate its role in the regulation of non-GPCRs membrane proteins endocytosis (27). Although this may reflect direct interaction of beta-arrestins with non-GPCR proteins (28), it could also result from the interference with components of the endocytic machinery that could be shared by clathrin- and caveolae-mediated routes.

The above discussion illustrates the importance of developing new tools that will allow the direct assessment of the molecular steps involved in the endocytosis of specific GPCRs. To generate one such tool, we took advantage of the fact that, for internalization, the beta-arrestins binding to the beta2-adaptin subunit of the clathrin adaptor AP-2 are needed for the beta-arrestin-mediated targeting of GPCRs to clathrin-coated pits (7, 8, 10, 29). Specifically, we designed a bioluminescence resonance energy transfer (BRET)-based assay that allows real-time monitoring of the interaction between beta-arrestins and beta2-adaptin as a biosensor for beta-arrestin-promoted clathrin-mediated endocytosis. BRET is a non-radiative energy transfer that occurs between the energy donor Renilla luciferase (Rluc) and variants of the green fluorescent proteins (EYFP for BRET1 and GFP, GFP2, or Tsapphire for BRET2) as the energy acceptor only when the two proteins are within 100 Å from one another and situated in favorable orientation, making it an attractive assay for studying both inducible and constitutive protein-protein interactions (30, 31). Thus, in response to the activation of 12 different GPCRs, previously suggested to internalize via different endocytic routes, BRET1 was assessed between beta-arrestin-Rluc and beta2-adaptin-EYFP and used as an indicator of clathrin-mediated endocytosis involving beta-arrestins. By combining the spectrally resolved BRET1 and BRET2 technologies, we could simultaneously assess the recruitment of beta-arrestin to GPCR and beta-arrestin/AP-2 interaction, which allowed us to monitor the kinetics of the two events. The data obtained herein show that some of the GPCRs previously suggested to internalize via a clathrin-independent pathway were capable of promoting beta-arrestin interaction with AP-2. Thus, contrary to what was deduced from indirect methods, these receptors internalize via a beta-arrestin- and clathrin-dependent mechanism. Other receptors, such as ETAR and ETBR, which are capable of recruiting beta-arrestins but were shown to internalize via caveolae, did not promote beta-arrestin interaction with beta2-adaptin, indicating a beta-arrestin-dependent but clathrin-independent endocytic process. In addition to providing a new tool to dissect the molecular events involved in GPCR endocytosis, the BRET-based beta-arrestin/beta2-adaptin interaction assay can also be used to detect constitutive receptor internalization and quantify receptor activation in a pharmacologically relevant manner.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum, Geneticin (G418), L-glutamine, and penicillin-streptomycin were purchased from Wisent. Fugene6 was obtained from Roche Diagnostics. Coelenterazine-h was from Prolume, and DeepBlueC was from Biotium. Recombinant human RANTES (regulated on activation normal T cell expressed and secreted) was from PeproTech. Poly-D-lysine, 8-arginine-vasopressin (AVP), isoproterenol, bradykinin, human recombinant C5a, prostaglandin E2, vasoactive intestinal peptide, endothelin-1 (ET1), and carbachol were from Sigma-Aldrich Canada. Antibodies against beta2-adaptin, {alpha}-adaptin, and clathrin were obtained from BD Biosciences. The anti-GFP was from Molecular Probes. White opaque and clear bottom 96-well plates were from Corning. Linear polyethyleneimine (25 kDa) was from Polysciences. Plate readers used to measure BRET in this study were the Mithras LB940 from Berthold for BRET1 and a modified TopCount from Packard for BRET2.

Expression Plasmids—The constructs presented herein were made using standard molecular biology techniques employing PCR and fragment replacement strategies. beta-Arrestin2-Rluc and beta-arrestin1-Rluc were generated by PCR amplification of the coding sequences of the rat beta-arrestin2 (kindly provided by S. Marullo, Institute Cochin, Paris) and the rat beta-arrestin1 (a gift from Kathryn DeFea, University of California, Riverside) without their stop codons that were ligated upstream of a humanized Renilla reniformis luciferase (Rluc, originally PCR-amplified from phRluc-N1 from PerkinElmer Life Sciences) in pcDAN3.1zeo+ (Invitrogen); both beta-arrestin1 and beta-arrestin2 were fused to Rluc via the same 6-amino acid linker (GSGTAT). Rluc-beta-arrestin2-EYFP construct was made as described by Charest et al. (42). beta-Arrestin2-(R393E,R395E)-Rluc DNA was obtained by subcloning the mutant beta-arrestin2 into pcDNA3.1. V2R-EYFP construct was generated by amplifying V2R coding sequences by PCR without its stop codon and cloned upstream of EYFP in pRK5. beta2-Adaptin-EYFP was generated by subcloning the coding region, minus the stop codon, and coming from a human beta2-adaptin plasmid template (10) into pEYFP-N1 (Clontech). To construct V2R-Tsapphire, the coding sequence of Turbo Sapphire (32) was PCR-amplified and fused, in-frame, downstream of the V2R coding sequence lacking its stop codon (which was removed from V2R-VENUS-pIRESpuro3 (33)) and ligated into pcDNA3.1/zeo(+). EP4R and the complement component C5a receptor (C5aR) in pcDNA3.1(+) were from UMR cDNA Resource Center. The angiotensin II receptor (HA-AT1aR-pRc) expression construct was a gift from Dr. Sylvain Meloche (Université de Montréal, Montréal, Canada). The V2R-FKBP and FRB-beta-arrestin2-Rluc (34), Myc-V2R(R137H) (35), HA-beta2AR (36), dynI(K44A) (37), Myc-V2R, Myc-V1aR (38), M2 muscarinic receptor (HA-M2R) (21), vasoactive peptide 1 receptor (FLAG-VIP1R) (21), endothelin receptor subtypes A and B (HA-ETAR and FLAG-ETBR (39)), CCR5 (18), and bradykinin receptor subtype 2 (HA-B2R) (40) expression constructs were previously described. Except for CCR5, EP4R, and C5aR, all GPCRs used in this study contained an N-terminal epitope tag (e.g. Myc, HA, or FLAG) that was previously shown not to compromise the activity of these receptors. For the purpose of brevity, unless stated otherwise, GPCRs used here will be identified by their names only without indicating their N-terminal epitope tag. All GPCRs used herein were from human cDNAs, except for the VIP1R, which was from rat.

Cell Culture, Plasmid Transfections, and Stable Cell Line Production—Unless otherwise stated, human embryonic kidney (HEK) 293T cells were cultured in high glucose DMEM supplemented with 10% fetal bovine serum, 100 units/ml penicillin-streptomycin, and 2 mML-glutamine at 37 °C in a humidified chamber at 95% air and 5% CO2. For transient transfections in 6-well plates, 400,000 HEK293T cells were seeded and transfected the next day using Fugene6 according to manufacturer's recommendations. For transfections in 100-mm plates, cells were seeded at a density of 2.5 million cells/plate in DMEM containing 5% fetal bovine serum and transfected the next day using polyethyleneimine (PEI, 25-kDa molecular mass, linear form prepared at 1 mg/ml in sterile distilled H2O) at a DNA:PEI ratio of 1:3. Plasmid DNA and PEI were diluted, each in separate tubes, with 500 µl of NaCl solution (150 mM). The PEI solution was then added onto the DNA solution, vortexed at maximum speed for 5 s, and incubated at room temperature for 20 min prior to addition to the cells. To generate cells stably expressing beta2-adaptin-EYFP (HEK293T/beta2-adaptin-EYFP), transfected cells were selected with 1 mg/ml G418. Clonal cells expressing beta2-adaptin-EYFP were obtained by limited dilution and were tested for expression of beta2-adaptin-EYFP by fluorescence measurements and Western blotting. HEK293T cells stably expressing MycV2R (HEK293T/V2R) were generated by selection with 0.45 mg/ml G418, and a clonal cell line (41) expressing ~8 pmol/mg of V2R was used for transient cotransfection of beta2-adaptin-EYFP and beta-arrestin2-Rluc.

Immunoprecipitation and Western Blotting—Immunoprecipitation experiments were carried out as described previously (65). Immunoprecipitated proteins were separated on 6% SDS-PAGE, whereas proteins from total cell lysates were separated on 10% SDS-PAGE before transfer onto nitrocellulose membranes. Protein immunodetection on membranes was assessed using either anti-beta2-adaptin (0.2 µg/ml), anti-{alpha}-adaptin (0.25 µg/ml), anti-clathrin (0.25 µg/ml), or anti-GFP (2 µg/ml) (65) antibodies.

Total Fluorescence Measurements—To measure total fluorescence, cells were washed once with PBS-Mg (PBS containing 0.5 mM MgCl2), gently detached by pipetting in PBS-Mg, and seeded at a density of ~100,000 cells/well in 96-well plates (white wall with clear bottom plates). All throughout this study, cell number quantification was based on measuring the A600 of the cell suspension and correlating it to a pre-established standard curve (A600 versus cell number). The fluorescence level was measured using a FlexStation II (Molecular Devices). For measuring fluorescence of V2R-Tsapphire, transfected cells were excited at 400 nm, and the emission was recorded at 511 nm (cut-off at 490 nm), whereas measurements of beta2-adaptin-EYFP fluorescence were done at an excitation wavelength of 470 nm and emission wavelength of 535 nm (cut-off at 500 nm).

Monitoring Protein-Protein Interaction Using BRET1—Approximately 18 h after transfection, cells were detached by trypsinization and seeded (~50,000 cells/well) into 96-well (white wall, clear bottom) tissue culture plates previously treated with poly-D-lysine, and re-incubated at 37 °C for another 18 h. On the day of the experiment, the culture medium was replaced by PBS-Mg and incubated with or without various concentrations of the tested agonist for the specified time at room temperature. To measure the BRET1 signal, the transparent bottom of the 96-well plate was covered with a white-backed tape adhesive (PerkinElmer Life Sciences), and the BRET1 substrate for Rluc, coelenterazine-h, was added to all wells (5 µM final concentration), followed by BRET1 measurement on the Mithras LB940 plate reader, which allows the sequential integration of signals detected in the 480 ± 20 nm and 530 ± 20 nm windows. The BRET1 signal was calculated as a ratio of the light emitted by EYFP (530 ± 20 nm) over the light emitted by Rluc (480 ± 20 nm). Unless otherwise stated, BRET1 ratios were corrected by subtracting the background signal detected when beta-arrestin-Rluc constructs were expressed in the absence of the EYFP fusion protein or the tested GPCR (in the case of the stable beta2-adaptin-EYFP cell line) to generate BRETnet values. Agonist-promoted BRET1 was calculated by subtracting the BRET1 ratio obtained in the absence of agonist addition from the one obtained in the presence of an agonist. In the case of kinetic measurements, coelenterazine-h was added simultaneously with the agonist, followed by BRET1 measurements. Receptor agonists used herein were: AVP for V2R and V1aR, isoproterenol for beta2AR, bradykinin for B2R, vasoactive intestinal peptide for VIP1R, ET1 for ETAR and ETBR, carbachol for M2R, RANTES for CCR5, recombinant C5a for C5aR, prostaglandin E2 for EP4R, and angiotensin II for AT1AR.

Heterodimerizer-promoted beta-Arrestin2 Interaction with V2R— HEK293T/beta2-adaptin-EYFP cells were transfected with V2R-FKBP and FRB-beta-arrestin2-Rluc (34) or with V2R and beta-arrestin2-Rluc. Heterodimerization of V2R-FKBP and FRB-beta-arrestin2-Rluc was initiated by cell treatment with the heterodimerizer AP-21967 (20 min at room temperature), a chemically modified derivative of rapamycin. AP-21967 is a cell-permeable organic molecule with two separate motifs binding with high affinity to FKBP and FRB fragments, respectively (for details see Ariad on the web).

Concomitant Monitoring of beta-Arrestin2 Interactions with V2R and with AP-2 by Combining BRET1 and BRET2— HEK293T/beta2-adaptin-EYFP cells were seeded in 100-mm dishes at a density of 2.5 million cells per plate. The next day, cells were co-transfected with different concentrations of the V2R-Tsapphire plasmid (0.25, 0.5, and 1 µg) and 0.25 µgof beta-arrestin2-Rluc plasmid. Forty-eight hours post-transfection, cells were washed with PBS-Mg and then gently detached. Total fluorescence measurements were taken in 96-well plates containing ~100,000 cells/well, as described above. Cells were then dispensed into 96-well white opaque plates, and BRET1 or BRET2 kinetic measurements were done after the co-addition of 100 nM AVP and either 5 µM coelenterazine-h (Rluc substrate for BRET1) or coelenterazine DeepBlueC (Rluc substrate for BRET2). BRET2 measurements were done using a modified TopCount plate reader that sequentially incorporates emission signals in the 370–450 nm and 500–530 nm ranges. The BRET2 signal was determined by calculating the ratio of the light emitted by the V2R-Tsapphire (500–530 nm) over the light emitted by the beta-arrestin2-Rluc (370–450 nm). Agonist-promoted BRET2 was calculated by subtracting the BRET2 ratio obtained in the absence from the one obtained in the presence of agonist. Agonist-promoted BRET1 was calculated as described above.

Measurement of Cell Surface Receptor Expression by ELISA— Agonist-promoted internalization was assessed as described previously (37). Briefly, the culture medium was removed and replaced with DMEM/0.5% bovine serum albumin/20 mM HEPES in the presence or absence of the specific agonist. After 30-min incubation at 37 °C, the medium was removed and cells were fixed with Tris-buffered saline/3.7% formaldehyde for 5 min at room temperature. Cell surface expression was measured using anti-HA (Santa Cruz Biotechnology, Santa Cruz, CA, for ETAR), anti-Myc (for V1aR, V2R wt, and V2R(R137H)), or anti-FLAG M2 (Sigma, for ETBR) monoclonal antibodies. The percentage of agonist-promoted receptor internalization was determined as follows: (1 – stimulated/unstimulated) x 100.

beta-Arrestin Knock-down—HEK293T cells were transfected with ETAR or ETBR plasmids along with minimal amount of beta-arrestin1-Rluc and beta-arrestin2-Rluc and either a specific siRNA targeting both beta-arrestin1 and beta-arrestin2 (AAAGCCTTCTGCGCGGAGAAT) or a control siRNA (Santa Cruz Biotechnology). 18 h post-transfection, cells were seeded in 24-well plates and incubated at 37 °C for an additional 18–24 h. siRNA efficacy for beta-arrestins knock-down expression was assessed by measuring the luminescence obtained from the co-expressed beta-arrestin1-Rluc and beta-arrestin2-Rluc and expressed as the percentage of luminescence obtained in cells transfected with the control siRNA.

Confocal Microscopy—HEK293T cells were transfected with beta-arrestin2-GFP and either ETAR or ETBR constructs and treated with ET1 (10 nM) for the indicated time. beta-Arrestin2-GFP images were collected on a Zeiss LSM-510 Meta laser scanning microscope.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Generation and Expression of beta2-Adaptin-EYFP—This study was designed to monitor agonist-induced interaction between beta-arrestins and AP-2 in living cells, thus, providing a sensitive detection for the early events of beta-arrestin-promoted clathrin-mediated endocytosis of GPCRs. For this, we used a beta2-adaptin-EYFP fusion construct as a suitable BRET1 partner (EYFP as energy acceptor) for beta-arrestins fused to the energy donor Rluc (beta-arrestin2-Rluc or beta-arrestin1-Rluc). Western blot analyses of HEK293T cells transfected with the beta2-adaptin-EYFP construct confirmed that the protein was efficiently expressed. Indeed, a band migrating at ~130 kDa, corresponding to the expected molecular mass of the beta2-adaptin-EYFP fusion protein was recognized by antibodies raised against either beta2-adaptin (Fig. 1A, lane 2) or GFP (that recognizes EYFP; Fig. 1A, lane 5). A lower band of ~105 kDa, corresponding to the molecular weight of the endogenous beta2-adaptin, was recognized only by the anti-beta2-adaptin antibody (compare lanes 1, 2, and 5 in Fig. 1A), in both transfected and untransfected cells. Transfection of wild-type beta2-adaptin increased the immunoreactivity of the 105-kDa band (Fig. 1A, lane 3), confirming that this band corresponds to the native protein. To confirm the ability of beta2-adaptin-EYFP to associate with its functional partners (43), co-immunoprecipitation experiments were carried out. As shown in Fig. 1B, immunoprecipitation of the fusion protein, using anti-GFP antibody, led to co-sedimentation of {alpha}-adaptin and clathrin, indicating that the fusion of beta2-adaptin with EYFP did not prevent its association with the native AP-2/clathrin complex (Fig. 1B).

Monitoring Agonist-promoted Interaction between beta2-Adaptin/EYFP and beta-Arrestin-Rluc in Living Cells by BRET1—To determine whether GPCR-promoted interaction between beta-arrestin and beta2-adaptin could be detected by BRET in living cells, we initially measured BRET1 between beta-arrestin2-Rluc and beta2-adaptin-EYFP that were transiently co-transfected into HEK293T/V2R cells. The BRET1 signal was measured in the absence and presence of increasing concentrations of the V2R agonist AVP. Fig. 1C shows that AVP promoted a concentration-dependent increase in BRET1, indicative of an association between beta-arrestin2-Rluc and beta2-adaptin-EYFP. The EC50 calculated for this agonist-promoted interaction was 1.2 nM, a value in good agreement with the published affinity of AVP for V2R (38). These data validate the use of the beta2-adaptin-EYFP/beta-arrestin-Rluc pair as a biosensor to monitor the early event in the receptor-promoted formation of the endocytic complex involving beta-arrestin and AP-2.


Figure 1
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 1.
Characterization of beta2-adaptin-EYFP. A, HEK293T cells were transiently transfected or not (Ctrl) with beta2-adaptin wild-type (WT) or beta2-adaptin-EYFP. Expression level of beta2-adaptin in cell lysates was assessed by Western blot using anti-beta2-adaptin (left panel) or anti-GFP (right panel) antibodies. B, cell lysates from HEK293T expressing (+) or not (–) beta2-adaptin-EYFP were immunoprecipitated (IP) using an anti-GFP antibody, and the immunoprecipitates were analyzed by Western blot (WB) using either anti-GFP, anti-beta2-adaptin, anti-{alpha}-adaptin, or anti-clathrin antibodies. C, HEK293T/V2R cells were co-transfected with beta2-adaptin-EYFP and beta-arrestin2-Rluc, and BRET1 measurements were done after 20-min incubation with the indicated concentration of the V2R agonist AVP. Data shown are representative of two to three experiments (A and B) or are the mean ± S.E. of three independent experiments (C).

 
To develop a robust system that allows monitoring of beta-arrestin/AP-2 interaction by distinct receptors, we generated a HEK293T/beta2-adaptin-EYFP cells in which constant amounts of GPCR and beta-arrestin-Rluc constructs could then be co-transfected. Twelve GPCRs were selected for this study (Table 1). The GPCRs were chosen to include receptors belonging to classes A, B, and C, as defined by their beta-arrestin interaction profile (13, 18). The list also included receptors that were previously proposed to undergo clathrin-dependent or -independent pathways. Agonist activation of VIP1R, V2R, V1aR, B2R, beta2AR, CCR5, EP4, C5aR, AT1aR, and M2R resulted in an increase in agonist-promoted BRET1, indicative of association between beta-arrestin2-Rluc and beta2-adaptin-EYFP. This effect was selective, because agonist-promoted BRET1 was detected only when GPCRs were incubated with their respective agonist and not with irrelevant agonists (data not shown). The time and the concentration dependence of the agonist-promoted association are illustrated in Fig. 2 (A and B) for representative receptors and the parameters (t1/2, EC50, and maximal BRET1 values) of the curves obtained for all tested receptors are presented in Table 1. Although the t1/2 varied from 1.7 to 8.9 min between individual receptors, in all cases the BRET1 signal reached a plateau after 12 min of stimulation with saturating concentration of their respective agonists and remained constant for at least an additional 12 min. Therefore, for subsequent experiments, the BRET1 signal was measured 20 min after agonist stimulation. For all GPCRs tested, the EC50 values obtained for the concentration-dependent increase in BRET1 agreed well with the known affinities of the agonists used for each receptor (Fig. 2B and Table 1). The maximal BRET1 signals (BRET1max) reached varied between 0.05 and 0.13 for the different receptors, with a tendency for class B receptors to promote higher BRET1max values. Although consistent with the greater propensity of Class B receptors to interact stably with beta-arrestin2, it is difficult to directly interpret this difference, because the expression levels between receptors may have differed. However, in experiments where receptor expression levels were controlled by surface ELISA (using anti-Myc antibodies) for the class A (MycV2R) and class B (MycV1aR), significantly higher BRET1max signals were promoted by V2R as compared with V1aR. This indicates that the greater affinity of beta-arrestin2 to interact with class B receptors can be reflected in the BRET-based beta-arrestin/AP-2 interaction assay (Fig. 2C and inset).


View this table:
[in this window]
[in a new window]

  		TABLE 1
BRET1 kinetics of association and comparison of generated EC50 with agonist affinity values obtained from other established assays

Receptor classification with respect to interaction with beta-arrestins is indicated under "class" (Refs. 13-17, 51). The half-time (t1/2) of the maximal association between beta-arrestin2-Rluc and beta2-adaptin-EYFP in response to treatment with agonists (100 µM for M2R and 100 nM for all other receptors) was calculated from non-linear regression analysis of BRET1 association kinetics curves. BRET1max represents the agonist-promoted BRET1 ratio obtained at maximum agonist stimulation. The BRET1EC50 values were determined from non-linear regression of dose-response BRET1 curves. BRET1EC50 values were compared to previously published affinity values for the same agonists. Data are the mean ± S.E. of 3-5 independent experiments.

 


Figure 2
View larger version (27K):
[in this window]
[in a new window]

  		FIGURE 2.
Kinetics and dose dependence of agonist-promoted interaction between beta2-adaptin-EYFP and beta-arrestin-Rluc. HEK293T/beta2-adaptin-EYFP cells were co-transfected with beta-arrestin2-Rluc and the indicated GPCRs. A, real-time BRET1 measurements were taken at regular intervals for the indicated time period directly after the addition of coelenterazine-h and receptor specific agonists. B, cells were stimulated with the indicated concentrations of the receptor-specific agonists for 20 min at room temperature followed by BRET1 measurements. For the agonist list, see Table 1. C, cells were stimulated with 100 nM AVP for 20 min followed by BRET1 measurement. Inset, total cell surface expression of each receptor was assessed by cell surface ELISA assay using anti-Myc antibody.

 


Figure 3
View larger version (21K):
[in this window]
[in a new window]

  		FIGURE 3.
Agonist-induced interactions of beta-arrestin2-Rluc and beta-arrestin2-(R393–395E)-Rluc with beta2-adaptin-EYFP and V2R-EYFP. A, HEK293T/beta2-adaptin-EYFP cells were transiently co-transfected with V2R and either beta-arrestin2-Rluc or beta-arrestin2-(R393–395E)-Rluc. B, HEK293T cells were co-transfected with V2R-EYFP and either beta-arrestin2-Rluc or beta-arrestin2-(R393–395E)-Rluc. A and B, BRET1 measurements were done after 20-min incubation with the indicated concentrations of AVP. Data are the mean ± S.E. of three to five independent experiments.

 
To confirm that the BRET1 signal observed truly reflects the association between beta-arrestin and beta2-adaptin, we took advantage of a mutant form of beta-arrestin2, beta-arrestin2-(R393E,R395E), which is unable to associate with beta2-adaptin but can still undergo recruitment to the agonist-stimulated receptor (7, 44). For this purpose, HEK293T/beta2-adaptin-EYFP cells were co-transfected with the V2R construct and either beta-arrestin2-(R393E,R395E)-Rluc or WT beta-arrestin2-Rluc. As can be seen in Fig. 3A, AVP promoted a robust increase in BRET1 between beta2-adaptin-EYFP and WT beta-arrestin2-Rluc but not beta-arrestin2-(R393E,R395E)-Rluc. The ability of beta-arrestin2-(R393E,R395E)-Rluc to be recruited to the receptor was confirmed in independent experiments monitoring the agonist-promoted BRET1 between V2R-EYFP and both WT beta-arrestin2-Rluc and beta-arrestin2-(R393E,R395E)-Rluc (Fig. 3B). The detection of similar BRET1 signals for the two beta-arrestin2 constructs confirmed that the lack of signal between beta2-adaptin-EYFP and beta-arrestin2-(R393E,R395E)-Rluc reflected the loss of association between these two proteins and not an impairment of beta-arrestin translocation to the receptor, thus validating the beta2-adaptin-EYFP/beta-arrestin2-Rluc pair as a specific biosensor for the receptor promoted beta-arrestin/AP-2 interaction.

Although beta-arrestin2 has been studied more extensively than other non-visual arrestins, beta-arrestin1 has also been shown to interact with AP-2 upon activation of certain GPCRs (7, 10). Thus, we assessed the ability of the BRET-based assay to detect this interaction on a representative subset of the GPCRs tested above. As shown in Fig. 4, agonist activation of the V1aR, beta2AR, B2R, V2R, and VIP1R resulted in an increase in BRET1 between beta-arrestin1-Rluc and beta2-adaptin-EYFP, confirming that these receptors can promote the interaction between AP-2 and either beta-arrestin1 or -2. Interestingly, the extent of signal generated by beta-arrestin1 and beta-arrestin2 was identical when promoted by the maximal activation of V2R and VIP1R, two prototypical class B receptors that display identical ability to interact with the two beta-arrestins (13). In contrast, maximal activation of the class A receptors, V1aR and beta2AR, led to weaker signals with beta-arrestin1 than beta-arrestin2, consistent with their reported lower propensity to associate stably with beta-arrestin1 (13). For the B2R, although its propensity to colocalize in endosomes with beta-arrestin2 (18) suggest a class B receptor, the weaker signal observed between beta2-adaptin-EYFP and beta-arrestin1-Rluc as compared with beta-arrestin2-Rluc would be more consistent with a class A. This hybrid behavior is consistent with the observation by Simaan et al. (18) that, in contrast with prototypical class B receptors, the B2R once in the endosomes can dissociate from beta-arrestin2 upon removal of the agonist, allowing the recycling of the receptor to the cell surface. The direct comparison of the interaction profile between beta2-adaptin and the two beta-arrestins promoted by different receptors is made possible by the fact that energy donor/acceptor ratio (Rluc/EYFP) can be maintained constant independently of the receptor being expressed. In that respect, the present assay provides an advantage over the direct monitoring of beta-arrestins to the receptor, because the identities of the BRET partners used are the same, independently of the receptor being studied. Thus, the beta-arrestin-Rluc/beta2-adaptin-EYFP BRET assay provides a useful tool to classify GPCRs according to their profile of interaction with the beta-arrestin/AP-2 complex.


Figure 4
View larger version (32K):
[in this window]
[in a new window]

  		FIGURE 4.
Agonist-induced interactions of beta-arrestin2-Rluc and beta-arrestin1-Rluc with beta2-adaptin-EYFP. HEK293T/beta2-adaptin-EYFP cells were co-transfected with either beta-arrestin1-Rluc or beta-arrestin2-Rluc and the indicated GPCRs. BRET1 measurements were done after 20-min incubation with 100 nM receptor-specific agonists. Data are the mean ± S.E. of three to five independent experiments. Statistical significance of the difference was assessed using paired Student's t test. ***, p < 0.0001; **, p < 0.005.

 
Among the receptors tested, only two, ETAR and ETBR, failed to promote the interaction between either beta-arrestin2-Rluc or beta-arrestin1-Rluc and beta2-adaptin-EYFP (Figs. 2A and 4). No BRET1 signal could be detected even when agonist stimulation was maintained for 60 min (data not shown). To determine whether the lack of signal could result from the inability of these receptors to recruit beta-arrestin, we used Double-Brilliance-beta-arrestin (Rluc-beta-arrestin2-EYFP), a biosensor that allows monitoring of conformational changes of beta-arrestin2 by intramolecular BRET1 upon translocation to the receptor (42). As can be seen in Fig. 5A, agonist (ET1) activation of HEK293T cells co-transfected with ETAR or ETBR and Double-Brilliance-beta-arrestin induced an increase in intramolecular BRET1, indicating that these receptors recruited beta-arrestin2 but failed to promote interaction between beta-arrestin and AP-2. In addition, ET1-promoted translocation of beta-arrestin2 to the plasma membrane was observed by fluorescence microscopy in HEK293T cells transfected with ETAR or ETBR (Fig. 5B). This is consistent with a previous report indicating that ETAR recruits beta-arrestin2 following agonist activation (45). Also consistent with previous observations, ET1 stimulation led to the endocytosis of both ETAR and ETBR, as evidenced by the decrease in the receptor cell surface expression detected by ELISA following agonist treatment (Fig. 5C). Moreover, involvement of beta-arrestins in ETAR and ETBR agonist-induced internalization could be demonstrated by interfering with beta-arrestins expression by the use of siRNAs targeting beta-arrestin1 and beta-arrestin2. Indeed, transfection of these siRNAs, which led to a significant reduction in both beta-arrestin1 and beta-arrestin2 levels, significantly blocked ETAR and ETBR agonist-promoted internalization (Fig. 5C). Selective knock-down of beta-arrestin2 led to a similar inhibition of the endocytosis (data not shown), indicating a predominant role for beta-arrestin2. Taken together these data indicate that ETAR and ETBR can be endocytosed by a beta-arrestin-dependent but AP-2-independent pathway, suggesting a non-clathrin-mediated endocytosis for these receptors.

Agonist-independent Association between beta-Arrestin and beta2-Adaptin Reveals Receptor Constitutive Internalization—Recently, mutations leading to constitutive endocytosis in the absence of ligand stimulation have been described for several GPCRs (46). Among those, substitution of arginine 137 by a histidine residue within the V2R has been found to promote the constitutive recruitment of beta-arrestin to the receptor and the ensuing endocytosis of the complex (35, 47). To investigate whether constitutive internalization of GPCRs also involves beta-arrestin/AP-2 interaction, we performed BRET1 experiments on HEK293T/beta2-adaptin-EYFP cells transiently co-transfected with beta-arrestin2-Rluc and either the wild-type or a constitutively internalizing V2R mutant, V2R(R137H). In the absence of agonist stimulation, V2R(R137H) promoted a slightly higher basal BRET1 signal between beta-arrestin2-Rluc and beta2-adaptin-EYFP than the wild-type V2R, and this, despite a lower cell surface expression, is consistent with its constitutive endocytosis (Fig. 6). Co-expression of the dominant negative mutant of dynamin I, dynI(K44A), that prevents the pinching off of endocytic vesicles from the plasma membrane further revealed the difference in BRET1 signal promoted by V2R(R137H) versus WT (Fig. 6). The increase in the V2R(R137H)-promoted BRET1 observed in the presence of dynI(K44A) most likely results from the accumulation of the receptor in the clathrin-coated pits at the cell surface (as illustrated by the increase in cell surface receptor detected by ELISA, Fig. 6, inset) where the constitutive formation of the V2R(R137H)/beta-arrestin2/AP-2 complex can be detected. This is consistent with the role of dynamin that promotes severing of the clathrin-coated pits but is not involved in the assembly of the early endocytic machinery. The observation, that the BRET1 signal promoted by V2R(R137H) in the presence of dynI(K44A) is of the same magnitude as that observed following agonist activation of the wild-type receptor by AVP, suggests that the R137H mutation can promote the formation of the receptor/beta-arrestin/AP-2 complex as efficiently as the activated wild-type receptor. Taken together, these results confirm that constitutive endocytosis of V2R(R137H) and agonist-promoted internalization of the wild-type receptor involve the same initial steps of the clathrin-dependent pathway involving the interaction between beta-arrestin and AP-2.


Figure 5
View larger version (46K):
[in this window]
[in a new window]

  		FIGURE 5.
Agonist-induced beta-arrestin2 recruitment to ETAR and ETBR and receptor internalization. A, HEK293T cells were co-transfected with ETAR or ETBR and Rluc-beta-arrestin2-EYFP (Double-Brilliance), and BRET1 was measured after 20 min of agonist (+ET1, 10 nM) or vehicle treatment (Ctrl). B, HEK293T cells were transfected with beta-arrestin2-GFP and either ETAR or ETBR and treated with 10 nM of ET1 for the indicated time period. beta-Arrestin2-GFP translocation to the plasma membrane was observed using confocal fluorescence microscopy. C, HEK293T cells were transfected with HA-ETAR or FLAG-ETBR and either a control siRNA (Ctrl) or a siRNA targeting both beta-arrestin1 and beta-arrestin2 (siRNA-beta-arrestins). Surface expression of each receptor was assessed by ELISA, in the absence or presence of 10 nM ET1, using anti-Ha (for ETAR) or anti-FLAG (for ETBR) antibodies, and the percentage of agonist-promoted receptor internalization was determined. The effect of siRNA on beta-arrestin1 and beta-arrestin2 expression levelswasassessedbymeasuringthereductionofluminescenceactivityoriginatingfromlowlevelofco-transfected beta-arrestin1-Rluc and beta-arrestin2-Rluc. Data are the mean ± S.E. (A and C) of four independent experiments or are representative (B) of two independent experiments.

 
Receptor Activity-independent Recruitment of beta-Arrestin2 Promotes Interaction between beta-Arrestin2 and AP-2—Because it was previously shown that agonist stimulation of the {alpha}1A-adrenergic receptor (48) could directly promote the recruitment of AP-2 (through its µ subunit) to the receptor, one could envisage that the interaction between beta-arrestin and AP-2 could follow their independent recruitment to the activated receptor. Alternatively, the interaction between beta-arrestin and AP-2 may reflect a direct recruitment of AP-2 to beta-arrestin following the translocation of beta-arrestin to the receptor. To distinguish between these two possibilities, we assessed whether the recruitment of beta-arrestin to the receptor, independently of agonist-promoted receptor activation, is sufficient to promote the interaction between beta-arrestin and AP-2. For this purpose, we took advantage of a cyclophilin-based approach developed on the ability of a synthetic bivalent heterodimerizer compound, AP-21967, to function as a high affinity adaptor to link the cyclophilin FRB and FKBP protein domains. The fusion of FRB to the N terminus of beta-arrestin2-Rluc and FKBP to the C terminus of V2R was previously shown to allow the recruitment of beta-arrestin to the receptor upon AP-21967 treatment, in the absence of AVP. Such agonist-independent beta-arrestin recruitment did not result in G protein activation but induced the internalization of the V2R-FKBP (34). Fusions with the cyclophilin domains were also shown not to affect the functionality of either beta-arrestin2 or V2R (34). As shown in Fig. 7, treatment with AP-21967 induced a concentration-dependent BRET1 between beta2-adaptin-EYFP and FRB-beta-arrestin2-Rluc in cells co-expressing V2R-FKBP. No such BRET1 was observed in cells expressing V2R and beta-arrestin2-Rluc not fused to FKBP and FRB, respectively. These data clearly indicate that recruitment of beta-arrestin to the receptor, even in the absence of agonist activation, is sufficient to induce beta-arrestin/AP-2 association. It has previously been suggested that the interaction between a phosphate sensor within beta-arrestin and the phosphorylated tail of the receptor contributes to the conformational rearrangements leading to the engagement of AP-2 (7). Given that the agonist-independent recruitment of beta-arrestin promoted by AP-21967 should not promote receptor phosphorylation, our data suggest that beta-arrestin conformational rearrangements promoted by its interaction with the receptor, even in the absence of the phosphorylation, may be sufficient to trigger the interaction between beta-arrestin and AP-2.


Figure 6
View larger version (18K):
[in this window]
[in a new window]

  		FIGURE 6.
V2R(R137H) promoted interaction between beta-arrestin2-Rluc and beta2-adaptin-EYFP. HEK293T/beta2-adaptin-EYFP cells were co-transfected with wild type (WT) or mutant (R137H) V2R and beta-arrestin2-Rluc, with or without dynI(K44A). BRET1 was measured in the absence or presence of 100 nM AVP (20-min treatment at room temperature). Inset: cell surface expressions of Myc-V2R and Myc-V2R(R137H) were assessed by cell surface ELISA assay using anti-Myc antibody. Data are the mean ± S.E. of three independent experiments. Statistical significance of the difference was assessed using paired Student's t test. ***, p < 0.0001.

 
Association Kinetics between V2R/beta-Arrestin2 versus beta-Arrestin2/beta2-Adaptin as Measured by Combining BRET1 and BRET2—From the above discussion, one would predict that beta-arrestin translocation to the receptor would precede beta-arrestin/AP-2 interaction. To directly test this prediction, we took advantage of the availability of two different coelenterazine substrates whose oxidation by Rluc results in resolved light emission spectra, allowing differential energy transfer to two different derivatives of GFP (49). Oxidation of DeepBlueC by Rluc (used in BRET2) results in a maximal light emission at 400 nm, thus allowing efficient energy transfer to GFP variants such as GFP2 or Tsapphire, whose maximum excitation wavelengths are ~400 nm, but permits only marginal energy transfer to EYFP (maximum excitation wavelength: ~511 nm). Conversely, Rluc-catalyzed oxidation of coelenterazine-h (used in BRET1), which emits light with a peak emission at ~480 nm, allows energy transfer to EYFP but fails to excite Tsapphire. Therefore, it is possible to combine BRET1 and BRET2 in the same cells to follow two different protein-protein interaction events (49). For this, HEK293T/beta2-adaptin-EYFP cells transiently co-transfected with V2R-Tsapphire and beta-arrestin2-Rluc were stimulated with AVP. BRET1 and BRET2 were then used to monitor kinetics of interaction for the beta-arrestin2-Rluc/beta2-adaptin-EYFP and beta-arrestin2-Rluc/V2R-Tsapphire pairs, respectively. As shown in Fig. 8, the apparent association of beta-arrestin2 to the receptor (t1/2: 4.2 min) is faster than its interaction with AP-2 (t1/2: 10 min). Because association kinetics may vary with different expression levels of the studied interactors, we further calculated the association halftimes (t1/2) from BRET1 and BRET2 under conditions where we varied the expression levels of V2R-Tsapphire in the presence of fixed levels of beta-arrestin2-Rluc and beta2-adaptin-EYFP (Table 2). Under all conditions, AVP stimulation resulted in beta-arrestin2-Rluc/V2R-Tsapphire association that was in average 2.5 ± 0.1 times faster than the interaction between beta-arrestin2-Rluc and beta2-adaptin-EYFP. Taken together, these results are consistent with the notion that the formation of the receptor/beta-arrestin/AP-2 complex is initiated by the recruitment of beta-arrestin to the receptor, resulting in conformational changes leading to the association with AP-2.


View this table:
[in this window]
[in a new window]

  		TABLE 2
Association kinetics determined by combining BRET1 and BRET2

The different receptor expression levels were determined by fluorescence measurements (excitation 400 nm, emission 511 nm). BRET1 ratio represents the interaction between beta2-adaptin-EYFP and beta-arrestin2-Rluc, while BRET2 ratio corresponds to the recruitment of beta-arrestin2-Rluc to V2R-Tsapphire. Apparent t1/2 (half-time) of maximal association is indicated. Data are the means ± S.E. of three independent experiments.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
This study was aimed at the development of a live cell approach that makes possible direct detection of the early events leading to beta-arrestin- and clathrin-dependent internalization of GPCRs. For this purpose, we developed a BRET-based biosensor to monitor the agonist-induced interaction between beta-arrestin-Rluc and beta2-adaptin-EYFP, a needed step for the beta-arrestin-mediated targeting of GPCRs to clathrincoated pits for internalization (7, 8, 10).

Out of the 12 different GPCRs tested, only the ETAR and ETBR were unable to promote beta-arrestin association with AP-2 upon agonist-stimulated receptor internalization, indicating an alternative endocytic route for these two receptors. Among the receptors promoting beta-arrestin/beta2-adaptin interactions, those displaying lower and higher affinity for beta-arrestins (class A and B, respectively) could be readily differentiated based on the strength of the BRET1 signals detected between beta2-adaptin-EYFP and both of beta-arrestin2-Rluc and beta-arrestin1-Rluc. The comparison of the kinetics of association of beta-arrestin with the receptor and AP-2, made possible by combining BRET1 and BRET2 in living cells, respectively, indicated that beta-arrestin association with the activated receptors precedes and probably triggers the recruitment of AP-2 to the beta-arrestin/receptor complex. Consistent with this notion, the recruitment of beta-arrestin to a constitutively internalizing mutant of the V2R or forcing its binding to the wild-type receptor in the absence of agonist stimulation (using a cyclophilin-based approach) was sufficient for promoting the interaction of AP-2 with the complex.


Figure 7
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 7.
AP-21967-induced interaction between beta-arrestin2-Rluc and beta2-adaptin-EYFP in the absence of receptor activation. HEK293T/beta2-adaptin-EYFP cells were co-transfected with either FRB-beta-arrestin2-Rluc and V2R-FKBP or with beta-arrestin2 and V2R. BRET1 measurements were performed 20 min following the addition of increasing concentrations of AP-21967. Data are the mean ± S.E. of three independent experiments.

 
The list of receptors tested in this study included GPCRs that were previously proposed to undergo clathrin-dependent or -independent pathways. Agonist activation of VIP1R, V2R, V1aR, B2R, beta2AR, CCR5, EP4R, M2R, AT1aR, and C5aR resulted in an increase in agonist-promoted BRET1 between beta-arrestin and beta2-adaptin, indicative that internalization of these receptors occurs via a beta-arrestin- and clathrin-dependent pathway. Studies using pharmacological and biochemical inhibitors previously reported that VIP1R, V2R, V1aR, B2R, beta2AR, CCR5, and EP4R undergo clathrin-dependent endocytosis (6, 17, 50–54). However, the internalization route previously proposed for M2R, AT1aR, and C5aR were more controversial. Indeed, it has been previously reported that the internalization of the M2R is atypical in being both non-clathrin and non-caveolae mediated, because it was not significantly affected by the co-expression of dominant negative mutants of beta-arrestin1 (beta-arrestin1(V53D)), dynamin (dynI(K44A)), or the heavy chain of clathrin (Hub) (55, 56). These results were surprising, considering that treatment with hypertonic sucrose, a classic inhibitor of clathrin-mediated endocytosis (57), was reported to strongly inhibit M2R internalization (55). Recently, by monitoring the trafficking of an M2R fused to GFP, it was reported that the M2R appeared to internalize initially via a clathrin-independent pathway but then quickly merged with the clathrin-endocytic pathway at the level of early endosomes (58). Our BRET1 data clearly support the involvement of the clathrin pathway in M2R internalization and demonstrate that the M2R can promote the formation of the beta-arrestin/AP-2 complex involved in the early steps of clathrin-mediated endocytosis. For the AT1aR and C5aR, dominant negative mutants of beta-arrestin1 (beta-arrestin1(V53D) or beta-arrestin2-(319–418)) and dynamin (dynI(K44A)) were initially reported not to inhibit receptor internalization (59, 60). However, later studies showed that the internalization of both AT1aR and C5aR can be inhibited by dominant negative mutants of both dynamin and beta-arrestins (51, 61, 62). The results obtained in the present study using the direct BRET1-based monitoring of the beta-arrestin/AP-2 interaction are consistent with the latter studies, indicating that AT1aR and C5aR can undergo beta-arrestin- and clathrin-mediated endocytosis.


Figure 8
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 8.
Simultaneous detection of agonist-promoted interactions between beta-arrestin2-Rluc and both V2R-Tsaphire and beta2-adaptin-EYFP by combining BRET1 and BRET2. HEK293T/beta2-adaptin-EYFP cells, co-transfected with beta-arrestin2-Rluc and V2R-Tsapphire, were stimulated with 100 nM AVP or vehicle alone in the presence of coelenterazine-h (BRET1) or Deep-BlueC (BRET2), and the kinetics of the agonist-promoted BRET signals were measured. BRET values presented are the percentage of maximum response obtained from cells expressing the highest tested concentration of V2R-Tsapphire (2931 ± 81 fluorescence units). The BRET1 ratio represents the interaction between beta2-adaptin-EYFP and beta-arrestin2-Rluc, whereas the BRET2 ratio corresponds to the recruitment of beta-arrestin2-Rluc to V2R-Tsapphire. Apparent t1/2 (half-time) of maximal association is indicated. Data are the mean ± S.E. of three independent experiments.

 
Taken together, the conflicting results obtained in some studies illustrate the difficulties of interpretations associated with the exclusive use of dominant negative mutants to define the endocytic route used by specific receptors. The expression level of the mutant used and the endogenous levels of the proteins involved in the pathway are among the factors that can explain the contradictory results obtained. In this context, the BRET-based assays, directly monitoring the interactions between components of specific endocytic pathway, offer several advantages. For instance, the behavior of each receptor can be examined in an identical cellular background where the expression level of the components assayed can be selected and monitored in the course of the assay by measuring fluorescence and luminescence levels. Also, the biosensor system used to monitor the endocytic process is kept constant, independently of the receptor studied, allowing direct comparison between receptors that are not modified. The assay is thus a direct readout of the ability of each receptor to engage specific components of the endocytic machinery and to evaluate the potential of the receptor to use specific internalization pathways in a given cell type.

As discussed above, the detection of receptor promoted BRET1 between beta-arrestin and beta2-adaptin is a clear demonstration that this receptor can be internalized via clathrin-coated endosomes. However, a lack of BRET1, although ruling out a beta-arrestin-mediated clathrin-dependent process, does not exclude the possibility of a beta-arrestin-independent/clathrin-dependent or a beta-arrestin-mediated/clathrin-independent pathway. beta-Arrestin-independent/clathrin-dependent endocytosis of GPCRs has been previously suggested for the HCMV-encoded chemokine US28 and 5-hydroxytryptamine 2A receptors (63, 64). Interestingly, direct interaction between a subunit of AP-2 (µ2-adaptin) and both the {alpha}1b-adrenergic receptor and the protease-activated receptor 1 (48, 72) has been documented. Whether such direct interactions between AP-2 and certain GPCRs could be responsible for the beta-arrestin-independent clathrin-mediated endocytosis remains to be investigated.

For ETAR and ETBR, our data strongly suggest abeta-arrestin-dependent but clathrin-independent endocytic pathway. This is consistent with previous data suggesting an internalization process involving both caveolae and beta-arrestin for ETAR (20). In addition to providing additional support to the hypothesis that beta-arrestin could be involved in nonclathrin-mediated endocytosis, these results reinforce the notion that inhibition of endocytosis by beta-arrestin dominant negative mutants cannot be used as a marker of clathrin-dependent internalization.

When considering the beta-arrestin/clathrin-dependent pathway, our data are consistent with the notion that the recruitment of beta-arrestin to the receptor and the ensuing conformational changes are needed for the subsequent association with AP-2 leading to clathrin-mediated endocytosis. In particular, BRET1 and BRET2 clearly indicated that the beta-arrestin/AP-2 complexes did not exist in the absence of receptor activation and that the recruitment of beta-arrestin to the receptor precedes the association of beta2-adaptin to the complex. Consistent with this notion, the recruitment of beta-arrestin to the V2R using the cyclophilin-based recruitment system was sufficient to promote beta-arrestin/AP-2 interaction and the consequent endocytosis, suggesting that GPCR/beta-arrestin interaction may be the triggering signal for the recruitment of AP-2 to the complex. However, for ETAR and ETBR receptors, recruitment of beta-arrestin was not sufficient for directing these receptors to the AP-2- and clathrindependent endocytic pathway. Thus, it is likely that AP-2 association with beta-arrestin is determined by specific motifs or conformational rearrangements that are intrinsic to specific GPCR/beta-arrestin complexes.

In addition to allowing detailed analysis of the molecular events involved in GPCR endocytosis, the BRET-based assay developed herein provides a robust tool to monitor the activation of receptors that internalize via the betaarrestin- and clathrin-dependent process. Interestingly, the calculated EC50 values for the agonist-promoted interaction between beta-arrestins and beta2-adaptin correlated very well with the agonist affinities reported for GPCR functional assays. The beta-arrestin/beta2-adaptin BRET assay also presents the advantage of being independent of the G protein-coupling preference of the receptor (Gi/o-, Gs-, and Gq/11-coupled receptors) and does not require modification of the receptor, thus offering a universal functional assay for native GPCRs that internalize via the beta-arrestin- and clathrin-mediated pathway. Finally, the present study opens the way to the development of similar BRET-based assays directly assessing the interaction between other partners of the endocytic machineries that will provide useful tools to dissect alternative pathways for GPCR endocytosis.


   FOOTNOTES
 
* This work was supported in part by research grants from the Canadian Institute of Health Research (CIHR) (to M. B. and S. A. L.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Both authors contributed equally to this work. Back

2 Current address: Saint-Justine Hospital Research Center, Dept. of Genetics, Université de Montréal. Back

3 Recipients of CIHR postdoctoral fellowships. Back

4 Current address: Biological Sciences Dept., University of California, San Diego. Back

5 Holds a Canada research chair in molecular endocrinology. Back

6 Michel Bouvier holds a Canada research chair in signal transduction/molecular pharmacology. To whom correspondence should be addressed: Institute for Research in Immunology and Cancer, Université de Montréal, C.P. 6128, succursale Center-Ville, Montréal, Québec H3C 3J7, Canada. Tel.: 514-343-6319; Fax: 514-343-6843; E-mail: michel.bouvier{at}umontreal.ca.

7 The abbreviations used are: GPCR, G protein-coupled receptor; AVP, 8-arginine-vasopressin; AP-21967, synthetic heterodimerizer binding with high affinity to both cyclophilin FKBP and FRB fragments; AT1aR, angiotensin II receptor;beta2AR,beta2-adrenergic receptor; B2R, bradykinin B2 receptor; BRET, bioluminescence resonance energy transfer; C5a, complement component 5a; C5aR, the complement component C5a receptor; CCR5, CC-chemokine 5 receptor; DMEM, Dulbecco's modified Eagle's medium; dynI(K44A), dominant negative mutant of dynamin I; EP4R, prostaglandin EP4 receptor; ET1, endothelin; ETAR, endothelin A receptor; ETBR, endothelin B receptor; FKBP, cyclophilin fragments; FRB, cyclophilin fragment; G418, Geneticin; GFP, green fluorescent protein; HEK, human embryonic kidney cells; HRP, horseradish peroxidase; M2R, M2 muscarinic receptor; PEI, polyethyleneimine; Rluc, Renilla reniformis luciferase; V1aR, V1a vasopressin receptor; V2R, vasopressin V2 receptor; VIP, vasoactive intestinal peptide 1; VIP1R, vasoactive intestinal peptide 1 receptor; EYFP, enhanced yellow fluorescent protein; PBS, phosphate-buffered saline; ELISA, enzyme-linked immunosorbent assay; HA, hemagglutinin; siRNA, small interference RNA. Back


   ACKNOWLEDGMENTS
 
We are grateful to Drs. Audrey Claing and Stefano Marullo for providing some GPCR and beta-arrestin2 constructs, respectively, and for their helpful discussions regarding the manuscript. We thank Drs. Joseph Sodroski, Oliver Griesbeck, Kathryn DeFea, and Sylvain Meloche for providing the CCR5, Tsapphire-GFP, beta-arrestin1, and the AT1aR plasmids, respectively. We also thank Dr. Christian Le Gouill for his critical reading of the manuscript. We are grateful to Dr. Victor Rivera from Pharmaceuticals Ariad for the gift of the expression vectors pC4EN-F1 (FKBP) and pC4-RHE vectors (FRB) and for kindly providing the heterodimerizer AP-21967.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Foord, S. M., Bonner, T. I., Neubig, R. R., Rosser, E. M., Pin, J. P., Davenport, A. P., Spedding, M., and Harmar, A. J. (2005) Pharmacol. Rev. 57, 279–288[Abstract/Free Full Text]
  2. Claing, A., Laporte, S. A., Caron, M. G., and Lefkowitz, R. J. (2002) Prog. Neurobiol. 66, 61–79[CrossRef][Medline] [Order article via Infotrieve]
  3. Marchese, A., Chen, C., Kim, Y. M., and Benovic, J. L. (2003) Trends Biochem. Sci. 28, 369–376[CrossRef][Medline] [Order article via Infotrieve]
  4. Lefkowitz, R. J., and Shenoy, S. K. (2005) Science 308, 512–517[Abstract/Free Full Text]
  5. Edeling, M. A., Mishra, S. K., Keyel, P. A., Steinhauser, A. L., Collins, B. M., Roth, R., Heuser, J. E., Owen, D. J., and Traub, L. M. (2006) Dev Cell 10, 329–342[CrossRef][Medline] [Order article via Infotrieve]
  6. Goodman, O. B., Jr., Krupnick, J. G., Santini, F., Gurevich, V. V., Penn, R. B., Gagnon, A. W., Keen, J. H., and Benovic, J. L. (1996) Nature 383, 447–450[CrossRef][Medline] [Order article via Infotrieve]
  7. Kim, Y. M., and Benovic, J. L. (2002) J. Biol. Chem. 277, 30760–30768[Abstract/Free Full Text]
  8. Laporte, S. A., Miller, W. E., Kim, K. M., and Caron, M. G. (2002) J. Biol. Chem. 277, 9247–9254[Abstract/Free Full Text]
  9. Laporte, S. A., Oakley, R. H., Holt, J. A., Barak, L. S., and Caron, M. G. (2000) J. Biol. Chem. 275, 23120–23126[Abstract/Free Full Text]
  10. Laporte, S. A., Oakley, R. H., Zhang, J., Holt, J. A., Ferguson, S. S., Caron, M. G., and Barak, L. S. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 3712–3717[Abstract/Free Full Text]
  11. Santini, F., Gaidarov, I., and Keen, J. H. (2002) J. Cell Biol. 156, 665–676[Abstract/Free Full Text]
  12. Prossnitz, E. R. (2004) Life Sci. 75, 893–899[CrossRef][Medline] [Order article via Infotrieve]
  13. Oakley, R. H., Laporte, S. A., Holt, J. A., Caron, M. G., and Barak, L. S. (2000) J. Biol. Chem. 275, 17201–17210[Abstract/Free Full Text]
  14. Terrillon, S., Barberis, C., and Bouvier, M. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 1548–1553[Abstract/Free Full Text]
  15. Fraile-Ramos, A., Kohout, T. A., Waldhoer, M., and Marsh, M. (2003) Traffic 4, 243–253[Medline] [Order article via Infotrieve]
  16. Neuschafer-Rube, F., Hermosilla, R., Rehwald, M., Ronnstrand, L., Schulein, R., Wernstedt, C., and Puschel, G. P. (2004) Biochem. J. 379, 573–585[CrossRef][Medline] [Order article via Infotrieve]
  17. Shetzline, M. A., Walker, J. K., Valenzano, K. J., and Premont, R. T. (2002) J. Biol. Chem. 277, 25519–25526[Abstract/Free Full Text]
  18. Simaan, M., Bedard-Goulet, S., Fessart, D., Gratton, J. P., and Laporte, S. A. (2005) Cell Signal. 17, 1074–1083[CrossRef][Medline] [Order article via Infotrieve]
  19. Chini, B., and Parenti, M. (2004) J. Mol. Endocrinol. 32, 325–338[Abstract]
  20. Okamoto, Y., Ninomiya, H., Miwa, S., and Masaki, T. (2000) J. Biol. Chem. 275, 6439–6446[Abstract/Free Full Text]
  21. Claing, A., Perry, S. J., Achiriloaie, M., Walker, J. K., Albanesi, J. P., Lefkowitz, R. J., and Premont, R. T. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 1119–1124[Abstract/Free Full Text]
  22. Heuser, J. E., and Anderson, R. G. (1989) J. Cell Biol. 108, 389–400[Abstract/Free Full Text]
  23. Ferguson, S. S., Downey, W. E., 3rd, Colapietro, A. M., Barak, L. S., Menard, L., and Caron, M. G. (1996) Science 271, 363–366[Abstract]
  24. Krupnick, J. G., Santini, F., Gagnon, A. W., Keen, J. H., and Benovic, J. L. (1997) J. Biol. Chem. 272, 32507–32512[Abstract/Free Full Text]
  25. Benmerah, A., Bayrou, M., Cerf-Bensussan, N., and Dautry-Varsat, A. (1999) J. Cell Sci. 112, 1303–1311[Abstract]
  26. Sigismund, S., Woelk, T., Puri, C., Maspero, E., Tacchetti, C., Transidico, P., Di Fiore, P. P., and Polo, S. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 2760–2765[Abstract/Free Full Text]
  27. Chen, W., Kirkbride, K. C., How, T., Nelson, C. D., Mo, J., Frederick, J. P., Wang, X. F., Lefkowitz, R. J., and Blobe, G. C. (2003) Science 301, 1394–1397[Abstract/Free Full Text]
  28. Dalle, S., Ricketts, W., Imamura, T., Vollenweider, P., and Olefsky, J. M. (2001) J. Biol. Chem. 276, 15688–15695[Abstract/Free Full Text]
  29. Orem, N. R., Xia, L., and Dolph, P. J. (2006) J. Cell Sci. 119, 3141–3148[Abstract/Free Full Text]
  30. Hamdan, F. F., Percherancier, Y., Breton, B., and Bouvier, M. (2006) Curr. Prot. Neurosci. John Wiley & Sons, Inc., New York
  31. Pfleger, K. D., and Eidne, K. A. (2004) Biochem. J. 85, 625–637
  32. Zapata-Hommer, O., and Griesbeck, O. (2003) BMC Biotechnol. 3, 5[CrossRef][Medline] [Order article via Infotrieve]
  33. Hamdan, F. F., Audet, M., Garneau, P., Pelletier, J., and Bouvier, M. (2005) J. Biomol. Screen. 10, 463–475[Abstract/Free Full Text]
  34. Terrillon, S., and Bouvier, M. (2004) EMBO J. 23, 3950–3961[CrossRef][Medline] [Order article via Infotrieve]
  35. Barak, L. S., Oakley, R. H., Laporte, S. A., and Caron, M. G. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 93–98[Abstract/Free Full Text]
  36. Hebert, T. E., Moffett, S., Morello, J. P., Loisel, T. P., Bichet, D. G., Barret, C., and Bouvier, M. (1996) J. Biol. Chem. 271, 16384–16392[Abstract/Free Full Text]
  37. Rochdi, M. D., and Parent, J. L. (2003) J. Biol. Chem. 278, 17827–17837[Abstract/Free Full Text]
  38. Terrillon, S., Durroux, T., Mouillac, B., Breit, A., Ayoub, M. A., Taulan, M., Jockers, R., Barberis, C., and Bouvier, M. (2003) Mol. Endocrinol. 17, 677–691[Abstract/Free Full Text]
  39. Freedman, N. J., Ament, A. S., Oppermann, M., Stoffel, R. H., Exum, S. T., and Lefkowitz, R. J. (1997) J. Biol. Chem. 272, 17734–17743[Abstract/Free Full Text]
  40. Mirzabekov, T., Bannert, N., Farzan, M., Hofmann, W., Kolchinsky, P., Wu, L., Wyatt, R., and Sodroski, J. (1999) J. Biol. Chem. 274, 28745–28750[Abstract/Free Full Text]
  41. Charest, P. G., Oligny-Longpre, G., Bonin, H., Azzi, M., and Bouvier, M. (2006) Cell Signal. 19, 32–41[Medline] [Order article via Infotrieve]
  42. Charest, P. G., Terrillon, S., and Bouvier, M. (2005) EMBO Rep. 6, 334–340[CrossRef][Medline] [Order article via Infotrieve]
  43. Collins, B. M., McCoy, A. J., Kent, H. M., Evans, P. R., and Owen, D. J. (2002) Cell 109, 523–535[CrossRef][Medline] [Order article via Infotrieve]
  44. Milano, S. K., Pace, H. C., Kim, Y. M., Brenner, C., and Benovic, J. L. (2002) Biochemistry 41, 3321–3328[CrossRef][Medline] [Order article via Infotrieve]
  45. Zhang, J., Barak, L. S., Anborgh, P. H., Laporte, S. A., Caron, M. G., and Ferguson, S. S. (1999) J. Biol. Chem. 274, 10999–11006[Abstract/Free Full Text]
  46. Parnot, C., Miserey-Lenkei, S., Bardin, S., Corvol, P., and Clauser, E. (2002) Trends Endocrinol. Metab. 13, 336–343[CrossRef][Medline] [Order article via Infotrieve]
  47. Bernier, V., Lagace, M., Lonergan, M., Arthus, M. F., Bichet, D. G., and Bouvier, M. (2004) Mol. Endocrinol. 18, 2074–2084[Abstract/Free Full Text]
  48. Diviani, D., Lattion, A. L., Abuin, L., Staub, O., and Cotecchia, S. (2003) J. Biol. Chem. 278, 19331–19340[Abstract/Free Full Text]
  49. Perroy, J., Pontier, S., Charest, P. G., Aubry, M., and Bouvier, M. (2004) Nat. Methods 1, 203–208[CrossRef][Medline] [Order article via Infotrieve]
  50. Bowen-Pidgeon, D., Innamorati, G., Sadeghi, H. M., and Birnbaumer, M. (2001) Mol. Pharmacol. 59, 1395–1401[Abstract/Free Full Text]
  51. Braun, L., Christophe, T., and Boulay, F. (2003) J. Biol. Chem. 278, 4277–4285[Abstract/Free Full Text]
  52. Desai, S., and Ashby, B. (2001) FEBS Lett. 501, 156–160[CrossRef][Medline] [Order article via Infotrieve]
  53. Mueller, A., Kelly, E., and Strange, P. G. (2002) Blood 99, 785–791[Abstract/Free Full Text]
  54. Pizard, A., Blaukat, A., Muller-Esterl, W., Alhenc-Gelas, F., and Rajerison, R. M. (1999) J. Biol. Chem. 274, 12738–12747[Abstract/Free Full Text]
  55. Roseberry, A. G., and Hosey, M. M. (2001) J. Cell Sci. 114(Pt 4), 739–746[Abstract]
  56. Vogler, O., Nolte, B., Voss, M., Schmidt, M., Jakobs, K. H., and van Koppen, C. J. (1999) J. Biol. Chem. 274, 12333–12338[Abstract/Free Full Text]
  57. Hansen, S. H., Sandvig, K., and van Deurs, B. (1993) J. Cell Biol. 121, 61–72[Abstract/Free Full Text]
  58. Delaney, K. A., Murph, M. M., Brown, L. M., and Radhakrishna, H. (2002) J. Biol. Chem. 277, 33439–33446[Abstract/Free Full Text]
  59. Gilbert, T. L., Bennett, T. A., Maestas, D. C., Cimino, D. F., and Prossnitz, E. R. (2001) Biochemistry 40, 3467–3475[CrossRef][Medline] [Order article via Infotrieve]
  60. Zhang, J., Ferguson, S. S., Barak, L. S., Menard, L., and Caron, M. G. (1996) J. Biol. Chem. 271, 18302–18305[Abstract/Free Full Text]
  61. Gaborik, Z., Szaszak, M., Szidonya, L., Balla, B., Paku, S., Catt, K. J., Clark, A. J., and Hunyady, L. (2001) Mol. Pharmacol. 59, 239–247[Abstract/Free Full Text]
  62. Suvorova, E. S., Gripentrog, J. M., and Miettinen, H. M. (2005) Traffic 6, 100–115[CrossRef][Medline] [Order article via Infotrieve]
  63. Bhatnagar, A., Willins, D. L., Gray, J. A., Woods, J., Benovic, J. L., and Roth, B. L. (2001) J. Biol. Chem. 276, 8269–8277[Abstract/Free Full Text]
  64. Droese, J., Mokros, T., Hermosilla, R., Schulein, R., Lipp, M., Hopken, U. E., and Rehm, A. (2004) Biochem. Biophys. Res. Commun. 322, 42–49[CrossRef][Medline] [Order article via Infotrieve]
  65. Fessart, D., Simaan, M., Zimmerman, B., Comeau, J., Hamdan, F. F., Wiseman, P. W., Bouvier, M., and Laporte, S. A. (2007) J. Cell Sci. 120, 1723–1732[Abstract/Free Full Text]
  66. Breit, A., Lagace, M., and Bouvier, M. (2004) J. Biol. Chem. 279, 28756–28765[Abstract/Free Full Text]
  67. Williams, D. L., Jr., Jones, K. L., Alves, K., Chan, C. P., Hollis, G. F., and Tung, J. S. (1993) Life Sci. 53, 407–414[CrossRef][Medline] [Order article via Infotrieve]
  68. Laporte, S. A., Servant, G., Richard, D. E., Escher, E., Guillemette, G., and Leduc, R. (1996) Mol. Pharmacol. 49, 89–95[Abstract]
  69. Crass, T., Ames, R. S., Sarau, H. M., Tornetta, M. A., Foley, J. J., Kohl, J., Klos, A., and Bautsch, W. (1999) J. Biol. Chem. 274, 8367–8370[Abstract/Free Full Text]
  70. Raport, C. J., Gosling, J., Schweickart, V. L., Gray, P. W., and Charo, I. F. (1996) J. Biol. Chem. 271, 17161–17166[Abstract/Free Full Text]
  71. van Koppen, C. J., and Nathanson, N. M. (1990) J. Biol. Chem. 265, 20887–20892[Abstract/Free Full Text]
  72. Paing, M. M., Johnston, C. A., Siderovski, D. P., and Trejo, J. (2006) Mol. Cell. Biol. 26, 3231–3242[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
J. J. Linderman
Modeling of G-protein-coupled Receptor Signaling Pathways
J. Biol. Chem., February 27, 2009; 284(9): 5427 - 5431.
[Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Scarselli and J. G. Donaldson
Constitutive Internalization of G Protein-coupled Receptors and G Proteins via Clathrin-independent Endocytosis
J. Biol. Chem., February 6, 2009; 284(6): 3577 - 3585.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
P. A. Keyel, J. R. Thieman, R. Roth, E. Erkan, E. T. Everett, S. C. Watkins, J. E. Heuser, and L. M. Traub
The AP-2 Adaptor {beta}2 Appendage Scaffolds Alternate Cargo Endocytosis
Mol. Biol. Cell, December 1, 2008; 19(12): 5309 - 5326.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
S. K. Mishra, A. Jha, A. L. Steinhauser, V. A. Kokoza, C. H. Washabaugh, A. S. Raikhel, W. A. Foster, and L. M. Traub
Internalization of LDL-receptor superfamily yolk-protein receptors during mosquito oogenesis involves transcriptional regulation of PTB-domain adaptors
J. Cell Sci., April 15, 2008; 121(8): 1264 - 1274.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/40/29089    most recent
M700577200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hamdan, F. F.
Right arrow Articles by Bouvier, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hamdan, F. F.
Right arrow Articles by Bouvier, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement