Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M610623200 on August 14, 2007

J. Biol. Chem., Vol. 282, Issue 40, 29211-29221, October 5, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/40/29211    most recent
M610623200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheng, X.
Right arrow Articles by Jaggar, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, X.
Right arrow Articles by Jaggar, J. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Novel CaV1.2 N Terminus Expressed in Smooth Muscle Cells of Resistance Size Arteries Modifies Channel Regulation by Auxiliary Subunits*Formula

Xiaoyang Cheng{ddagger}1, Jianxi Liu{ddagger}, Maria Asuncion-Chin§, Eva Blaskova{ddagger}, John P. Bannister{ddagger}, Alejandro M. Dopico§, and Jonathan H. Jaggar{ddagger}2

From the Departments of {ddagger}Physiology and §Pharmacology, University of Tennessee Health Science Center, Memphis, Tennessee 38163

Received for publication, November 15, 2006 , and in revised form, June 20, 2007.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Voltage-dependent L-type Ca2+ (CaV1.2) channels are the principal Ca2+ entry pathway in arterial myocytes. CaV1.2 channels regulate multiple vascular functions and are implicated in the pathogenesis of human disease, including hypertension. However, the molecular identity of CaV1.2 channels expressed in myocytes of myogenic arteries that regulate vascular pressure and blood flow is unknown. Here, we cloned CaV1.2 subunits from resistance size cerebral arteries and demonstrate that myocytes contain a novel, cysteine rich N terminus that is derived from exon 1 (termed "exon 1c"), which is located within CACNA1C, the CaV1.2 gene. Quantitative PCR revealed that exon 1c was predominant in arterial myocytes, but rare in cardiac myocytes, where exon 1a prevailed. When co-expressed with {alpha}2{delta} subunits, CaV1.2 channels containing the novel exon 1c-derived N terminus exhibited: 1) smaller whole cell current density, 2) more negative voltages of half activation (V1/2,act) and half-inactivation (V1/2,inact), and 3) reduced plasma membrane insertion, when compared with channels containing exon 1b. beta1b and beta2a subunits caused negative shifts in the V1/2,act and V1/2,inact of exon 1b-containing CaV1.2{alpha}1/{alpha}2{delta} currents that were larger than those in exon 1c-containing CaV1.2{alpha}1/{alpha}2{delta} currents. In contrast, beta3 similarly shifted V1/2,act and V1/2,inact of currents generated by exon 1b- and exon 1c-containing channels. beta subunits isoform-dependent differences in current inactivation rates were also detected between N-terminal variants. Data indicate that through novel alternative splicing at exon 1, the CaV1.2 N terminus modifies regulation by auxiliary subunits. The novel exon 1c should generate distinct voltage-dependent Ca2+ entry in arterial myocytes, resulting in tissue-specific Ca2+ signaling.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Voltage-dependent L-type Ca2+ (CaV1.2)3 channels are the primary Ca2+ entry pathway in arterial myocytes (1). Ca2+ entry through CaV1.2 channels regulates multiple physiological functions, including cell contractility and gene expression (2). In small resistance arteries and arterioles, CaV1.2 channels play a dominant role in myogenic tone development and blood pressure regulation (3, 4). Smooth muscle-specific inactivation of the CaV1.2 gene (CACNA1C) dramatically reduces mean arterial blood pressure in mice, and arterial myocytes from hypertensive subjects exhibit increased L-type Ca2+ channel {alpha}1 subunit expression (3, 5). Moreover, a variety of agents that selectively block L-type Ca2+ channels are widely used to treat hypertension because of their ability to reduce arterial myocyte contractility (6). However, despite the central role of CaV1.2 channels in cardiovascular physiology and pathology, the molecular identity of these channels in myocytes of small myogenic arteries that regulate blood pressure and flow is unknown.

In most tissues, native voltage-dependent Ca2+ channels consist of a pore-forming {alpha}1 (CaV1.2) subunit and auxiliary beta and {alpha}2{delta} subunits (7). CaV1.2 subunits contain the voltage sensor and several regulatory sites that determine the basic biophysical and pharmacological properties of the Ca2+ channel complex, whereas beta and {alpha}2{delta} subunits regulate channel trafficking and gating kinetics (8). The human CaV1.2 gene can undergo alternative splicing at 19 out of 55 exons, leading to structural and functional CaV1.2 diversity (9). Vascular CaV1.2 subunits identified so far were cloned either from a whole organ, the rat aorta, or from a smooth muscle layer isolated by laser-capture microdissection from carotid or femoral arteries (10, 11). In each of these studies, clones were derived from conduit vessels that do not develop myogenic tone or critically influence systemic or organ blood pressure (GenBankTM accession numbers: M59786 [GenBank] , AY830711 [GenBank] -AY830713 [GenBank] , Z34811 [GenBank] , and Z34812 [GenBank] ; Refs. 10 and 11). To better understand Ca2+-dependent regulation of arterial smooth muscle physiology and to design more effective interventions for vascular pathologies associated with dysfunctional Ca2+ signaling, it is imperative to determine the molecular identity of CaV1.2 subunits expressed in myocytes of resistance size arteries. Conceivably, myocytes of myogenic arteries may express distinct subunit isoforms that confer tissue-specific physiology.

Here, we cloned full-length CaV1.2 subunits from small, myogenic cerebral arteries. Through the use of 5'-RACE, we found that CaV1.2 subunits expressed in myocytes of these arteries predominantly contain a novel, cysteine-rich N terminus encoded by alternative splicing of the CaV1.2 gene at exon 1. Electrophysiological studies indicate that the novel exon 1-derived N terminus modifies both CaV1.2 subunit current density and regulation by auxiliary subunits. Our study suggests that CaV1.2 exon 1, through alternative splicing, contributes to auxiliary subunit-mediated regulation of arterial myocyte voltage-dependent Ca2+ channels. Thus, splicing of the arterial myocyte CaV1.2 N terminus may contribute to tissue-specific Ca2+ entry and intracellular Ca2+ signaling.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissue Preparation—Procedures involving animals were approved by the Animal Care and Use Committee at the University of Tennessee. Sprague-Dawley rats (~250 g) were euthanized by peritoneal injection of sodium pentobarbital solution (150 mg/kg). For total RNA extraction, small (<200 µm) cerebral arteries, isolated cerebral artery myocytes, cardiac myocytes, aorta, heart, and brain, were prepared and placed immediately in TRIzol reagent (Invitrogen). Myocytes were enzymatically dissociated from rat cerebral arteries (~150 µm diameter) using a procedure similar to that previously described (12). Cardiac myocytes were prepared as previously described (13) and kindly provided by Dr. P. A. Hofmann in the Department of Physiology at UTHSC.

Reverse Transcription—First-strand cDNA was synthesized from ~3 µg of total RNA using oligo d(T) and reverse transcriptase (SuperScriptTM III, Invitrogen).

Rapid Amplification of CaV1.2 5'-End (5'-RACE) and Cloning of Full-length CaV1.2 Subunits—Primer sequences are provided in Table S1 of supplemental information. 5'-Ends of CaV1.2 subunits were generated using the BD SMART RACE cDNA amplification kit using gene-specific primer 1 (GSP1). Nested PCR was performed using GSP2 and UPM primers. Nested PCR products were purified and ligated into the pGEM-T easy vector (Promega) and transformed in JM109 cells. Plasmids containing inserts were sequenced using a T7 promoter primer (Promega), which revealed two different CaV1.2 5'-end sequences. Full-length CaV1.2 subunits were amplified from cerebral artery cDNA with primers designed to recognize the two different 5'-ends (sense 6 and antisense 4 for the exon 1b-containing subunit, termed CaV1.2e1b, and sense 5 and antisense 4 for the exon 1c-containing subunit, termed CaV1.2e1c) using the Expand Long Template PCR System (Roche Applied Science). Antisense 4 was designed according to the highly conserved 3'-untranslated region of known Ca 1.2 sequences (GenBankTMV accession number: rat brain, M67515 [GenBank] , M67516 [GenBank] ; rat aorta, M59786 [GenBank] ). PCR products were ligated into pGEM-T easy vector (Promega) for selection. Plasmids containing DNA inserts were sequenced at the University of Tennessee Molecular Resource Center.

Polymerase Chain Reaction—To identify the presence of exon 1a, exon 1b, exon 1c, beta1b, beta2a, and beta3, two consecutive rounds of PCR were performed. The first PCR round was 20 cycles, and the second PCR round was 40 cycles. PCR reactions were started with a 2-min initial denaturation at 94 °C, then thermocycled at 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 30 s in the first round of PCR, or 60 s in the second round of PCR, followed by 72 °C for 3 or 5 min. PCR products were separated in 2% agarose gels. Primer pairs of the first round PCR were: exon 1c-176S1 and exon2-A1 for CaV1.2e1c; exon 1b-97S1 and exon 2-A1 for CaV1.2e1b; actin-2794S1 and actin-3337A1 for beta actin. Primer pairs of the second round PCR were: exon 1c-201S2 and exon 1c-382A2 for CaV1.2e1c; exon 1b-137S2 and exon 1b-287A2 for CaV1.2e1b; actin-2901S2 and actin-3037A2 for beta actin. A similar procedure was used to identify CaVbeta subunits in arterial myocytes. Primers used for amplification of beta1b (X61394 [GenBank] , Ref. 14), beta2a (M80545 [GenBank] , Ref. 15), and beta3 (M88751 [GenBank] , Ref. 16) are listed in supplemental Table S1. pGW-beta1b, pcDNA3-beta2a, and pcDNA3-beta3 were used as positive controls.

Identification of Exons 1a, 1b, 1c, and CaVbeta Subunits in Rat Cerebral Artery Myocytes and Cardiac Myocytes—Individual arterial myocytes or cardiac myocytes were visualized using an inverted microscope (Nikon, TS100) and aspirated individually into a small glass pipette, as described previously (17). Reverse transcription was performed with 2–10 myocytes using Super-Script III reverse transcriptase (Invitrogen). Two consecutive PCR rounds were performed to identify the presence of exon 1a, 1b, 1c, beta1b, beta2a, and beta3. PCR products were verified by sequencing.

Quantitative Real Time PCR—CaV1.2 cDNA was synthesized from 2–10 rat arterial myocytes that were collected as described above. One initial 20-cycle round of PCR was performed, and the PCR products were used as templates for realtime PCR using the QuantiTect SYBR Green PCR kit (Qiagen). The primer pairs used in identification experiments were also used for real time PCR of exon 1b and 1c, except that Exon 1c-201S2 was replaced with Exon 1c-230S2. For exon 1a, Exon 1a-134S1 and Exon 2-A1 were used in initial PCR, and Exon 1a-188S2 and Exon 1a-340A2 were used in real time PCR. Amplification efficiency was evaluated from the slope of the regression curve obtained with several dilutions of cardiac cDNA, and the specificity of primers was tested by melting curve analysis. A mean amplification efficiency of 1.92 was used for calculating the relative percentage of exon 1a, 1b, and 1c mRNA in cerebral artery myocytes and cardiac myocytes.

Construction of Expression Vectors for L-type Ca2+ Channel {alpha}1 Subunits—For electrophysiological characterization, full length CaV1.2e1b and CaV1.2e1c were subcloned from the pGEM-T easy vector into the pIRES-hrGFP II vector (Stratagene) using NotI and T4 ligase for expression. EcoRV was used to examine the ligation direction. Constructs with correct nucleotide sequences were transformed into DH5{alpha} cells, purified with the HiSpeed plasmid maxi kit (Qiagen), and stored at –20 °C. For generation of EGFP-tagged CaV1.2, CaV1.2e1b and CaV1.2e1c coding sequences were amplified from pIRES-CaV1.2e1b-hrGFP II and pIRES-CaV1.2e1c-hrGFP II, respectively, using PfuUltra II fusion HS DNA polymerase (Stratagene) with the following primers: forward, CACCGTCGACCTGCAGATATCCATCACACTGG; reverse, CACCCCGCGGCCAGGTTGCTGACATAGGACC. cDNAs were purified and ligated into pEGFP-N3 vector using SalI and SacII. The reading frames of pEGFP-CaV1.2e1c-N3 and pEGFP-CaV1.2e1b-N3 vectors were confirmed by sequence analysis.

Cell Culture and Transient Transfection—COS-1 and HEK 293 cells (ATCC) were maintained in DMEM-F12 (Cellgro) supplemented with 10% FBS under standard tissue culture conditions (5% CO2, 37 °C). Endogenous CaV1.2 subunits are not present in significant amounts in COS-1 and HEK 293 cells (18, 19). Cells for transfection were grown in 35-mm Petri dishes and transiently transfected using FuGENE6 (Roche Applied Science). COS-1 cells were used for patch clamp electrophysiology experiments following transfection with different combinations of pIRES-CaV1.2e1c-hrGFP II, pIRES-CaV1.2e1b-hrGFP II, pGW-beta1b, pcDNA3-beta2a, pcDNA3-beta3, and pcDNA3-{alpha}2{delta}-1 (1 µg of each). HEK 293 cells were used for channel localization measurements because plasma membrane fluorescence originating from EGFP-tagged CaV1.2 channels could be more effectively differentiated from that in intracellular compartments than with COS-1 cells. HEK 293 cells were transfected with different combinations of pEGFP-CaV1.2e1b-N3 or pEGFP-CaV1.2e1c-N3 (0.5 µg) and pcDNA3-{alpha}2{delta}-1 and pGW-beta1b (1 µg of each). Cells were maintained in a 95% O2/5% CO2 atmosphere at 37 °C and used for electrophysiological and fluorescence experiments between 36 and 72 h after transfection. pGW-beta1b was kindly provided by Dr. Henry Colecraft (Johns Hopkins University School of Medicine), pcDNA3-beta2a by Dr. Timothy J. Kamp (University of Wisconsin Medical School), and pcDNA3-beta3 and pcDNA3-{alpha}2{delta}-1 by Dr. Diane Lipscombe (Brown University).

Patch Clamp Electrophysiology—Whole cell patch clamp recordings were acquired at room temperature using an Axopatch 200B amplifier (Axon Instruments, Foster City, CA) and pCLAMP 8.2 or 9.2. Borosilicate glass electrodes of resistance 1–3 M{Omega} were filled with pipette solution containing (in mmol/liter): for COS-1 cells, Cs-MeSO3 135, CsCl 5, EGTA 5, MgATP 4, Na2GTP 0.25, HEPES 10, and glucose 10 (pH 7.2, adjusted with CsOH); for arterial myocytes, CsCl 140, EGTA 5, MgATP 4, HEPES 10, and glucose 10 (pH 7.2, with CsOH). The extra-cellular bath solution contained (in mmol/liter): for COS-1 cells, NaCl 80, TEACl 60, MgCl2 1, HEPES 10, BaCl2 5, and glucose 10 (pH 7.4, adjusted with NaOH), for myocytes, TEACl 140, MgCl2 1, HEPES 10, BaCl2 20, and glucose 10 (pH 7.4, adjusted with TEAOH). Myocyte voltage-dependent Ba2+ currents were isolated by subtracting Cd2+ (250 µM)-insensitive currents from whole cell currents. Solutions were ~300 mOsm, as measured using a Vapor Pressure Osmometer. Isolated cells that were not visibly attached to neighboring cells were used for patch clamp. Cell capacitance was measured by applying a 5-mV test pulse and correcting the capacitance transients with series resistance compensation. For measurement of current-voltage (I-V) relationships, cells were clamped at –80 mV and whole cell currents were evoked every 5 s by 300-ms step depolarizations to between –60 and +60 mV in 10-mV increments. Steady-state inactivation was measured every 15 s by providing 1-s conditioning pulses to between –80 and +60 mV (+30 mV for {alpha}1/beta3/{alpha}2{delta}) in 10-mV increments before a 200-ms test pulse to 0 mV. A 15-ms return to –80 mV was applied after the conditioning pulse and prior to the test pulse. Tail currents were generated by repolarization to –80 mV after a series of 20-ms test pulses to between –60 mV and +60 mV in 10-mV increments. Whole cell currents were filtered at 1–2 kHz and digitized at 4–10 kHz. P/4 protocols were used to subtract leak and capacitive transients. Steady-state inactivation curves and tail currents were fit with the Boltzmann function in Equation 1,

Formula 1(Eq. 1)
where I/Imax is the normalized peak current, V is the conditioning pre-pulse voltage, V1/2 is the voltage for half-inactivation for steady-state inactivation or half-activation for tail currents, k is the slope factor, Rin is the proportion of non-inactivating current, Rmax is the maximal current. Inactivation time constants ({tau}) were obtained using Equation 2,

Formula 2(Eq. 2)
where It is the inward current at time t, and I{theta} is the residual current.

Confocal Microscopy—HEK 293 cells transfected with EGFP-tagged CaV1.2 {alpha}1 subunits and either {alpha}2{delta} or {alpha}2{delta} + beta1b were visualized using a Zeiss LSM 5 Pascal laser-scanning confocal microscope. EGFP was excited using 488 nm light, and >510 nm light was collected. Analysis methodology similar to that previously described was used to calculate plasma membrane localized fluorescence originating from EGFP-tagged CaV1.2 {alpha}1 subunits containing either the exon 1b or exon 1c-derived N terminus (20). Briefly, membrane boundaries were established by visualizing DIC images using a membrane thickness of 0.55 µm. Using these boundaries, membrane localized fluorescence was calculated from back-ground subtracted fluorescence images. For each cell, total membrane-localized fluorescence was calculated by subtracting cytoplasmic fluorescence from total cellular fluorescence. Total membrane fluorescence was then divided by membrane area (in µm2) to establish average membrane fluorescence. Image analysis was performed using Image J software (NIH).

Data Analysis—Electrophysiological data were analyzed using Clampfit 8.2 and 9.2 and Origin 7.5. Values are expressed as means ± S.E. Student's t-tests were used for comparing paired or unpaired data, and one-way analysis of variance and Student-Newman-Keuls or Dunn posthoc tests were used for comparing multiple data sets. p < 0.05 was considered significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
To identify voltage-dependent Ca2+ channels present in myocytes of small cerebral arteries, we first measured currents in these cells using patch clamp electrophysiology. Fig. 1A illustrates Cd2+ (250 µM)-sensitive, voltage-dependent Ba2+ currents characteristic of CaV1.2 that were recorded in cerebral artery myocytes (Fig. 1A). To proceed to clone full-length CaV1.2 subunits from small cerebral artery myocytes using PCR, we first sought to identify the CaV1.2 5'-end sequence(s) expressed in these cells. Two different CaV1.2 N termini have previously been described (21). Exon 1a encodes the CaV1.2 subunit N terminus found in whole heart (22) and whole aorta (10), and exon 1b (also referred to as exon 1) encodes the N terminus detected in whole brain (23), lung (24), and jejunum CaV1.2 subunits (25). CaV1.2 5'-ends expressed in resistance size (<200 µm diameter) cerebral arteries were amplified using 5'-RACE and ligated into pGEM-T easy vector (Fig. 1B). Sequencing analysis of 11 plasmids revealed two different CaV1.2 subunit 5'-ends (Fig. 1C). One did not match any sequence previously described, but was mapped within CACNA1C of the rat genome. The second sequence was identical to the previously described exon 1b. Exon 1a was not detected by 5'-RACE. According to their relative location within the rat genome, the sequence previously described in brain, lung and jejunum (exon 1) was termed "exon 1b", and the novel 5'-end was termed "exon 1c" (Fig. 1, C and D). Exon 1c is responsible for encoding a 9 amino acid peptide, and substituting glycine at the exon 1/2 junction for cysteine (Fig. 1E). This substitution generates the cysteine-rich N-terminal sequence: MLCCALDCAC.


Figure 1
View larger version (71K):
[in this window]
[in a new window]

 
FIGURE 1.
Identification of the CaV1.2 exon 1c in rat cerebral arteries, relative location of exon 1c in the rat genome, and sequence comparison with exons 1a and 1b. A, voltage-dependent Ba2+ currents recorded in an isolated myocyte by depolarizing voltage steps (left panel) and a mean I-V relationship obtained from 10 cells (right panel). B,5'-RACE products from cerebral arteries run in 0.8% agarose gel (left panel) with nested PCR products illustrating a band at ~500 bp (right panel). C, homology of exons 1a, 1b, and 1c compared with CaV1.2 nucleotide sequences from rat brain (M67515), rabbit lung (X55763), and rat aorta (M59786). The initiation sites of exon 1a, 1b, and 1c are indicated by {triangleup}, {blacktriangleup}, and {blacktriangledown}, respectively. Part of exon 2 is also illustrated in purple. D, schematic diagram depicting the relative locations of exon 1b, 1c, and 2 within the rat genome. E, alignment of amino acid sequences encoded by CaV1.2 exon 1a, 1b, and 1c with part of the exon 2-encoded sequence shown in purple. * indicates identical nucleotides or amino acids.

 


Figure 2
View larger version (35K):
[in this window]
[in a new window]

 
FIGURE 2.
A, RT-PCR revealed the presence of exons 1b and 1c in dissociated cerebral artery myocytes. beta Actin is shown as a positive control. B, real-time PCR indicated the relative percentage of exons 1a, 1b, and 1c message in isolated rat cerebral artery myocytes and cardiac myocytes. Exon 1a was not detected in arterial myocytes.

 
To examine whether exon 1b and 1c were expressed in arterial myocytes, RT-PCR was performed using small groups (~10) of manually selected cerebral artery myocytes (see "Experimental Procedures"). Critically, this methodology avoids contamination from other vascular wall cell types, including fibroblasts and perivascular neurons that express voltage-dependent Ca2+ channel subunits, including CaV1.2 (26, 27). Both exons 1b and 1c were detected in cerebral artery myocytes (Fig. 2A). Next, to examine whether exon 1c exhibits arterial myocyte-specific expression, real-time PCR was performed on dissociated arterial and cardiac myocytes. Data indicated that exon 1c was predominant (~96%) in cerebral artery myocytes (Fig. 2B) Exons 1a, 1b, and 1c were all detected in cardiac myocytes, with exon 1a prevalent (~82%) and exons 1b and 1c each less than 15% of total message (Fig. 2B). Together, these data indicate that in the cardiovascular system, exon 1c message is predominant in arterial myocytes and scarce in cardiac myocytes.

Using 5'-end primers specific to either exon 1b or exon 1c, full length CaV1.2 cDNAs were amplified (forward primers: sense6 for exon 1b, sense5 for exon 1c; reverse primer: anti-sense4), and termed "CaV1.2e1b" (GenBankTM accession number: DQ538522 [GenBank] ) and "CaV1.2e1c" (AY974797 [GenBank] ), according to their exon 1 sequences (Fig. 3, A and B). The coding region of the CaV1.2e1c subunit contains 6,477 nucleotides (including the stop codon) and encodes a 2,158-amino acid protein, whereas CaV1.2e1b contains 6,498 nucleotides and encodes a 2,165-amino acid protein. CaV1.2e1b and CaV1.2e1c are identical except for their exon 1-derived N termini. Each variant contains exon 8, 9 + 9a, 21, and 32 + 33, consistent with CaV1.2 subunits identified in large, conduit arteries (11, 28).


Figure 3
View larger version (75K):
[in this window]
[in a new window]

 
FIGURE 3.
Full-length CaV1.2 cDNAs cloned from rat small cerebral arteries. A, full-length CaV1.2e1b and CaV1.2e1c were cloned by RT-PCR and subcloned into pGEM-T Easy vector. Lane 1, CaV1.2e1b; lane 2, CaV1.2e1c; lane 3, CaV1.2e1c was released from pGEM-T easy vector by NotI digestion; lane 4, pGEM-T easy-CaV1.2e1c. B, CaV1.2e1b and CaV1.2e1c were subcloned into pIRES-hrGFP II vector, and the orientation direction of CaV1.2 in the expression vector was revealed by EcoRV digestion. Lane 1, pIRES-CaV1.2e1c-hrGFP II; lanes 2 and 3, pIRES-CaV1.2e1b-hrGFP II; lane 4, EcoRV digestion product of pIRES-CaV1.2e1b(+)-hrGFP II; and lane 5, EcoRV digestion product of pIRES-CaV1.2e1b(–)-hrGFP II.

 
To investigate whether exon 1 splicing imprints a distinct functionality to the voltage-dependent Ca2+ channel in arterial myocytes, CaV1.2e1b or CaV1.2e1c were subcloned into pIRES-hrGFP II vector and transfected in COS-1 cells for electrophysiological characterization. Voltage-dependent Ba2+ currents (IBa) were absent in non-transfected cells (data not shown). When co-expressed with {alpha}2{delta}, maximal IBa for both CaV1.2e1b and CaV1.2e1c occurred at +10 mV (Fig. 4, A and B, Table 1). However, the mean peak current density of CaV1.2e1b/{alpha}2{delta} currents was ~2-fold larger than for CaV1.2e1c/{alpha}2{delta} currents (Fig. 4, B and C, Table 1). Voltages of steady-state half-inactivation (V1/2,inact) and half-activation (V1/2,act) of CaV1.2e1c/{alpha}2{delta} currents were also ~7 and ~5 mV more negative than those of CaV1.2e1b/{alpha}2{delta} currents, respectively (Fig. 4, B and C, Table 1). In contrast, inactivation rate constants of CaV1.2e1c/{alpha}2{delta} and CaV1.2e1b/{alpha}2{delta} currents were similar (Fig. 4D). These data indicate that when co-expressed with {alpha}2{delta}, the novel exon 1c-derived CaV1.2 N terminus attenuates membrane current density and induces a negative shift in both V1/2,act and V1/2,inact, when compared with currents mediated by channels containing the CaV1.2 exon 1b-derived N terminus.


View this table:
[in this window]
[in a new window]

 
TABLE 1
Electrophysiological properties of Cav1.2 channels containing e1b or e1c when expressed alone or co-expressed with auxiliary subunits

 


Figure 4
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 4.
Current-voltage (I-V) relationships of CaV1.2e1b and CaV1.2e1c channels when expressed with auxiliary subunits. Ba2 currents were normalized to facilitate comparison. A, I-V relationships of CaV1.2e1b and CaV1.2e1c when co-expressed with {alpha}2{delta}. B, steady-state inactivation of CaV1.2e1c and CaV1.2e1b currents when co-expressed with {alpha}2{delta}. Exemplar current traces of 1-s conditioning depolarizing pulses evoked at –80, +10, and +30 mV followed by 200-ms test pulses to 0 mV (left panel). Cell capacitances for original recordings were: CaV1.2e1c + {alpha}2{delta}, 90 pF; CaV1.2e1b + {alpha}2{delta}, 66 pF. Mean steady-state inactivation fit with a Boltzmann function (right panel). C, voltage-dependent activation of CaV1.2e1c and CaV1.2e1b currents when co-expressed with {alpha}2{delta}. Exemplar tail currents evoked by repolarization to –80 mV after depolarizing test pulses to –20, 0, 20, and 40 mV (left panel). Cell capacitances for original recordings were: CaV1.2e1c + {alpha}2{delta}, 98 pF; CaV1.2e1b + {alpha}2{delta}, 66 pF. Mean voltage-dependent current activation (right panel). D, inactivation of CaV1.2e1b/{alpha}2{delta} and CaV1.2e1c/{alpha}2{delta} currents were best fit with a single exponential function. Tau was similar for CaV1.2e1b/{alpha}2{delta} and CaV1.2e1c/{alpha}2{delta} currents.

 
Ca2+ channel beta subunits regulate CaV1.2 channel voltage-dependence in an isoform-specific manner. For example, beta2a causes slow inactivation when compared with other beta subunits (29, 30). Expression of beta subunits has been investigated in whole aorta (31), but not in myocytes of small, resistance size arteries. Here, we investigated the transcription of three different beta subunits. Using RT-PCR, we studied beta1b and beta2a, which are membrane associated, and beta3, which is cytosolic (8). beta1b and beta3 were detected in dissociated cerebral artery myocytes, whole aorta, and brain (Fig. 5, A and C). Although beta2a was present in whole cerebral artery, aorta, and brain, message was not detected in isolated cerebral artery myocytes (Fig. 5B). Data suggest that beta2a expression in arterial myocytes is either very low, or that beta2a is expressed predominantly in cerebral artery wall cell types other than myocytes (e.g. neurons).


Figure 5
View larger version (42K):
[in this window]
[in a new window]

 
FIGURE 5.
RT-PCR of CaVbeta subunits expressed in dissociated rat cerebral arterial myocytes. A, beta1b subunit. B, beta2a subunit. C, beta3 subunit. CA indicates cerebral artery.

 
We sought to explore the functional effects of N-terminal splicing on beta subunit regulation of CaV1.2. Although beta2a was not detected in cerebral artery myocytes, beta2a may be expressed in other cell types that contain the exon 1c CaV1.2 variant. Thus, beta1b, beta2a, or beta3 regulation of CaV1.2e1b and CaV1.2e1c currents was investigated. Fig. 6 illustrates raw current traces for CaV1.2e1c and mean data obtained with CaV1.2e1b and CaV1.2e1c when co-expressed with {alpha}2{delta} and each beta subunit isoform. Co-expression of beta1b, beta2a, or beta3 with {alpha}2{delta} increased CaV1.2e1b and CaV1.2e1c current density and eliminated the current density difference that occurred between CaV1.2e1b/{alpha}2{delta} and CaV1.2e1c/{alpha}2{delta} (Table 1). beta subunits also shifted I-V relationships further to the left, with maximal IBa occurring at ~0 mV. However, beta1b shifted the V1/2,inact of CaV1.2e1b/{alpha}2{delta} currents by ~–16 mV, compared with only an ~–5 mV shift in the V1/2,inact of CaV1.2e1c/{alpha}2{delta} currents. At 0 and +10 mV, the slow component of inactivation ({tau}slow) decayed more rapidly for CaV1.2e1b/{alpha}2{delta}/beta1b currents than for CaV1.2e1c/{alpha}2{delta}/beta1b currents, whereas the fast component ({tau}fast) was similar (Fig. 6G). beta2a caused an ~–12 mV shift in the V1/2,inact of CaV1.2e1b/{alpha}2{delta} currents, but had no effect on the V1/2,inact of CaV1.2e1c/{alpha}2{delta} currents. Current inactivation rate was similar for CaV1.2e1b/{alpha}2{delta}/beta2a and CaV1.2e1c/{alpha}2{delta}/beta2a (Fig. 6H). beta3 similarly shifted the V1/2,inact of CaV1.2e1b/{alpha}2{delta} and CaV1.2e1c/ {alpha}2{delta} currents; by –14 and –10 mV, respectively (Table 1). In contrast to effects with beta1b, between –10 and +10 mV {tau}slow decayed more slowly for CaV1.2e1b/{alpha}2{delta}/beta3 currents than for CaV1.2e1c/{alpha}2{delta}/beta3 currents, although {tau}fast was similar (Fig. 6I).

A similar pattern was observed with beta subunit-mediated regulation of voltage-dependent activation. beta1b and beta2a caused a larger negative shift in the V1/2,act of CaV1.2e1b/{alpha}2{delta} currents than in CaV1.2e1c/{alpha}2{delta} currents (Table 1). In contrast, beta3 similarly shifted the V1/2,act of CaV1.2/{alpha}2{delta} currents, regardless of the exon 1 splice variant. Collectively, these data indicate that alternative splicing of the exon 1-derived CaV1.2 N terminus modifies regulation by beta subunits and suggest that modifications in current phenotype are specific to particular beta subunit isoforms.

To further study membrane insertion of CaV1.2 containing exon 1b or 1c, vectors that express EGFP fused to the C terminus of CaV1.2e1b or CaV1.2e1c channels were constructed. Membrane localization of expressed channels was studied using confocal microscopy. In agreement with current density measurements, when co-expressed with {alpha}2{delta} membrane fluorescence intensity of CaV1.2e1b-EGFP channels was higher than for CaV1.2e1c-EGFP channels (Fig. 7, A and B). Co-expression of beta1b further increased CaV1.2e1b-EGFP and CaV1.2e1c-EGFP fluorescence intensity and normalized the difference between the N-terminal isoforms that occurred when each was co-expressed with only {alpha}2{delta} (Fig. 7, A and B). These data indicate that alternative splicing between exon 1b and 1c modifies CaV1.2 channel membrane insertion in the presence of {alpha}2{delta}, and this difference can be normalized by co-expression of a beta subunit.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In the present study, we have for the first time cloned full-length CaV1.2 subunits expressed in small, resistance size, arteries and discovered a novel 5'-end sequence generated by alternative splicing at exon 1. Termed "exon 1c", this sequence encodes a unique N terminus in which 4 out of 9 amino acids are cysteine residues. Quantitative PCR indicates that the vast majority (~96%) of CaV1.2 mRNA in isolated cerebral artery myocytes contains exon 1c, with the residual proportion containing exon 1b, the previously reported "brain" CaV1.2 subunit exon 1 (23). In contrast, exon 1a was entirely absent in cerebral artery myocytes, as determined by both 5'-RACE and quantitative PCR. While exons 1a, 1b, and 1c were all detected in isolated cardiac myocytes, exon 1a was prevalent and the relative expression of exon 1c (~13%) was much lower than in arterial myocytes. Therefore, in the cardiovascular system, exon 1c is likely to be predominant in arterial myocyte CaV1.2 subunits, whereas exon 1a would be prevalent in cardiac myocyte CaV1.2. Two different promoters drive the expression of CaV1.2 channels containing exon 1a- and 1b-derived N termini in heart and smooth muscle, which may explain their different expression profiles (32, 33). However, promoters which drive exon 1c expression are unclear.

Electrophysiological and imaging studies revealed that when co-expressed with {alpha}2{delta} subunits, current density generated by CaV1.2e1b was significantly greater than for CaV1.2e1c. In addition, when co-expressed with {alpha}2{delta}, membrane fluorescence intensity of EGFP-tagged CaV1.2e1b channels was higher than that of CaV1.2e1c channels. Four genes encode {alpha}2{delta} subunits, and {alpha}2{delta}-1, the isoform used here, increases CaV1.2 membrane insertion and alters channel inactivation (34). {alpha}2 is an extracellular domain that associates with the plasma membrane through a disulfide-bond with the membrane-spanning {delta} domain (8). Glycosylation of the {alpha}2 domain is essential for {alpha}2{delta}-mediated membrane insertion of CaV1.2 subunits (35). In contrast, {delta} mimics the effects of full-length {alpha}2{delta} on channel kinetics (36). Each N terminus might interact differently with {alpha}2{delta}, leading to the observed differences between CaV1.2e1b and CaV1.2e1c channels. Alternatively, differences in CaV1.2e1b and CaV1.2e1c channels might be interpreted as different conformational channel states controlled by the different N termini of CaV1.2 subunits, which only become evident in the presence of {alpha}2{delta} subunits. Regardless of the molecular underpinnings, our study indicates that alternative splicing of exon 1 alters both channel voltage sensitivity and current density.


Figure 6
View larger version (31K):
[in this window]
[in a new window]

 
FIGURE 6.
Inactivation of CaV1.2e1b/{alpha}2{delta} and CaV1.2e1c/{alpha}2{delta} currents when expressed with beta1b, beta2a, or beta3 subunits. A–C, original recordings of 1-s depolarizing pulses to –80, –20, –10, and 0 mV followed by 200-ms test pulses to 0 mV for each subunit combination indicated. D–F, voltage dependence of steady-state inactivation for each subunit combination. G–I, voltage dependence of inactivation constants for each combination specified. Inactivation of CaV1.2/{alpha}2{delta}/beta1b and CaV1.2/{alpha}2{delta}/beta3 currents were best fit with a bi-exponential function representing {tau}fast and {tau}slow, whereas CaV1.2/{alpha}2{delta}/beta2a current inactivation was best fit with a single exponential. * illustrates p < 0.05.

 
beta subunits regulate CaV1.2 properties by binding to the Alpha Interaction Domain (AID) in the I-II linker (37). However, because a single amino acid mutation in the AID does not eliminate beta-subunit-mediated modulation of CaV1.2 subunits, additional interaction sites between {alpha}1 and beta subunits likely exist (38). Our data revealed that beta1b and beta3 were present in isolated cerebral artery myocytes, whereas beta2a was found only in intact cerebral arteries. Only one rat beta2a sequence has been described, but multiple splice variants of human beta2a exist (NCBI search, November 6, 2006) (39, 40). The primers used in our study to detect beta2a message recognize a rat beta2a sequence that corresponds to a highly conserved region in all five human splice variants. Thus, it appears to be unlikely that beta2a splice variants not recognized by the primers used here exist in rat arterial smooth muscle. These data underscore the need for caution when extrapolating RT-PCR data obtained using whole arterial cDNA to message levels present in myocytes. Future studies will determine whether exon 1c is also predominant in myocytes of other arteries, or is a specific cerebral artery splice variant.

beta3 is a cytosolic-localized protein, whereas beta1b and beta2a associate with the plasma membrane through either an acidic motif within the C terminus or palmitoylation sites in the N terminus, respectively (41, 42). When compared with currents obtained with {alpha}2{delta} alone, all three beta subunits elevated current density, with a greater increase seen in CaV1.2 channels containing exon 1c than in channels containing exon 1b, which abolished the current density difference between CaV1.2e1b/{alpha}2{delta} and CaV1.2e1c/{alpha}2{delta} currents. beta1b also normalized the difference in membrane fluorescence intensity between CaV1.2e1b/{alpha}2{delta} and CaV1.2e1c/{alpha}2{delta} channels. beta3 caused similar shifts in both the V1/2,inact and V1/2,act of CaV1.2e1b/{alpha}2{delta} and CaV1.2e1c/{alpha}2{delta} currents, while beta1b and beta2a caused larger negative shifts in CaV1.2e1b/{alpha}2{delta} currents than in CaV1.2e1c/{alpha}2{delta} currents. When co-expressed with either beta1b or beta3, the decay of CaV1.2/{alpha}2{delta} currents containing e1b or e1c was best fit by a bi-exponential function. Substitution of e1b for e1c decelerated the slow decay component of CaV1.2/{alpha}2{delta}/beta1b currents. In contrast, e1c accelerated the slow decay of CaV1.2/{alpha}2{delta}/beta3 currents, when compared with e1b. The rates of decay of CaV1.2/{alpha}2{delta} or CaV1.2/{alpha}2{delta}/beta2a currents were best fit with a single exponential function and were similar in CaV1.2 currents containing either the exon 1b or exon 1c-derived N terminus. Collectively, these data suggest that the CaV1.2 N terminus modifies beta subunit-mediated channel regulation. These findings also indicate that in the presence of a beta subunit, not only is the rate of slow inactivation modulated by splicing of the N terminus, but also that kinetic alterations depend on the beta subunit isoform involved. In contrast, exon 1b or 1c-derived N termini do not appear to significantly alter fast inactivation.


Figure 7
View larger version (24K):
[in this window]
[in a new window]

 
FIGURE 7.
Membrane localization of EGFP-tagged CaV1.2e1b and CaV1.2e1c channels when expressed with{alpha}2{delta} or with{alpha}2{delta} +beta1b subunits in HEK 293 cells. A, representative images illustrating cellular fluorescence from EGFP-tagged CaV1.2e1b and CaV1.2e1c channels when expressed with subunit combinations indicated. Scale bar, 10 µm. B, mean data illustrating that co-expression of {alpha}2{delta} subunits elevated localized membrane fluorescence intensity of CaV1.2e1b more than for CaV1.2e1c, and that co-expression with {alpha}2{delta} + beta1b subunits further increased membrane fluorescence and normalized the difference between CaV1.2e1b/{alpha}2{delta} and CaV1.2e1c/{alpha}2{delta}. au indicates arbitrary units. Number of cells: CaV1.2e1b/{alpha}2{delta}, 18; CaV1.2e1c/{alpha}2{delta}, 16; CaV1.2e1b/{alpha}2{delta}/beta1b, 17; CaV1.2e1c/{alpha}2{delta}/beta1b, 20. * indicates p < 0.05 when compared with CaV1.2e1b + {alpha}2{delta}, and {dagger}, p < 0.05 when compared with the same {alpha}1 subunit + {alpha}2{delta}.

 
CaV1.2e1c contains 4 cysteine residues, which are putative palmitoylation sites. One function of palmitoylation is to aid protein targeting to lipid rafts in the plasma membrane (43). Conceivably, different local lipid microenvironments may explain distinctions between CaV1.2e1b and CaV1.2e1c currents. It is also possible that the cysteine-rich N terminus regulates CaV1.2e1c channels by interacting with other cellular molecules and regulatory proteins, since cysteine-cysteine interactions that occur through disulfide bridging can alter channel folding and protein-protein interactions (44, 45). Immobilization of the CaV1.2 N terminus also inhibits both voltage- and Ca2+-dependent inactivation (19). Although not defined here, our results pave the way for future studies to determine the full range of mechanisms by which exon 1b and 1c encoded N termini regulate CaV1.2 channel phenotypes.

In native arterial myocytes, the current phenotype produced by channels containing CaV1.2 subunits and thus, voltage-dependent Ca2+ influx, is the result of an orchestration of factors. A majority of CaV1.2 channels containing an N terminus derived from exon 1c rather than exon 1b could modify voltage-dependent Ca2+ influx through several mechanisms. First, CaV1.2e1c/{alpha}2{delta} current density was smaller than for CaV1.2e1b/{alpha}2{delta}. Second, CaV1.2e1c/{alpha}2{delta} currents inactivated at more negative voltages than CaV1.2e1b/{alpha}2{delta} currents. Third, when co-expressed with {alpha}2{delta}, less CaV1.2e1c channels localized to the plasma membrane than did CaV1.2e1b channels. Collectively, these exon 1c-derived effects would reduce voltage-dependent Ca2+ influx in arterial myocytes. Arterial myocytes do not generate action potentials, but undergo steady-state changes in membrane potential. In arteries at physiological pressures, myocyte membrane potential is between ~–60 and –40 mV (46). Thus, arterial myocytes maintain relatively depolarized potentials when compared with many other cell types, particularly those that generate action potentials. A predominance of CaV1.2 channels containing exon 1c may serve to limit Ca2+ influx under the steady depolarized potentials that occur in arterial myocytes. Because arterial myocyte membrane potential changes steadily rather than rapidly (as in the case of action potentials), differences in inactivation rates between CaV1.2e1b/{alpha}2{delta}/beta and CaV1.2e1c/{alpha}2{delta}/beta channels would presumably have a smaller influence on Ca2+ influx than the exon 1c-induced alterations in current density, steady-state inactivation, and membrane insertion. Because CaV1.2 {alpha}1 subunits undergo splicing at 19 out of 55 exons, and some of these variants have also been described to modify channel electrophysiological properties, it is premature to provide a detailed comparison of properties of the splice variants described here and what is likely to be a heterogeneous CaV1.2 splice variant population in myocytes (9). Furthermore, auxiliary subunit expression in arterial myocytes, which would modify CaV1.2 currents, is also unclear. Even though we detected beta1b and beta3 message in arterial myocytes, it is uncertain which other beta subunit isoforms are expressed, the relative proportions of each isoform, the relative amount of beta to {alpha}2{delta} subunits, the relative proportions of each auxiliary subunit to {alpha}1 subunits, and whether beta and {alpha}2{delta} subunit isoforms exhibit defined cellular localization that could specifically modify the properties of {alpha}1 subunits containing exon 1b- or 1c-derived N termini. The electrophysiological properties of arterial myocyte CaV1.2 currents result from the combination of these additional, multiple factors. Nevertheless, our data indicate that electrophysiological properties of CaV1.2 currents are modified by splicing of the CaV1.2 {alpha}1 subunit N terminus. Although beta subunits normalized the isoform specific effects of {alpha}2{delta} on CaV1.2e1b and CaV1.2e1c channels in an overexpression system, it remains to be determined whether this occurs in arterial myocytes in physiology and disease. Given that alternative splicing of CaV1.2 subunits has been observed in disease (11, 47), and that CaV1.2 subunit expression is up-regulated in arterial myocytes of hypertensive animals (5), modifications in exon 1 splicing could occur during vascular disease and may contribute to increased CaV1.2 expression in hypertension.

In the human genome, sequences highly homologous to exon 1a and 1b are present in the CaV1.2 gene, yet a sequence identical to 1c is not found. A sequence that shares high homology with the 5'-untranslated region upstream of exon 1c is present in the human genome (p13.33 of chromosome 12), raising the possibility that CaV1.2 channels in human arterial myocytes contain an N terminus different to that described in human jejunum (25). Future studies will be required to identify human CaV1.2 {alpha}1 subunit exon 1 splice variants in arterial myocytes and other cell types.

In summary, we have established that CaV1.2 subunits which are expressed in myocytes of small, resistance size, cerebral arteries contain a novel exon 1c-derived splice variant that alters current regulation by auxiliary subunits. Considering the critical importance of CaV1.2 channels in the regulation of blood pressure and flow, and their role in vascular pathologies, including hypertension (5), exon 1c likely contributes to vascular specific Ca2+ signaling and Ca2+-dependent physiology.


    FOOTNOTES
 
* This study was supported by grants from the National Institutes of Health (to J. H. J., HL67061 and HL77678; and A. M. D., AA11560 and HL77424) and the American Heart Association National Center (to J. H. J.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Table S1.

The nucleotide sequence(s) reported in this paper has been submitted to the Gen-BankTM/EBI Data Bank with accession number(s) DQ538522 [GenBank] and AY974797 [GenBank] . Back

1 Recipient of a predoctoral fellowship from the Southeast Affiliate of the American Heart Association. Back

2 To whom correspondence should be addressed: Dept. of Physiology, University of Tennessee Health Science Center, 894 Union Ave., Memphis, TN 38163. Tel.: 901-448-1208; Fax: 901-448-7126; E-mail: jjaggar{at}physio1.utmem.edu.

3 The abbreviations used are: CaV1.2, voltage-dependent L-type Ca2+; RACE, rapid amplification of cDNA ends; EGFP, enhanced green fluorescent protein; I-V, current-voltage. Back


    ACKNOWLEDGMENTS
 
We thank Dr. Steven J. Tavalin for helpful discussions on the manuscript.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gollasch, M., and Nelson, M. T. (2000) Kidney Blood Press. Res. 20, 355–371
  2. Berridge, M. J., Lipp, P., and Bootman, M. D. (2000) Nat. Rev. Mol. Cell. Biol. 1, 11–21[CrossRef][Medline] [Order article via Infotrieve]
  3. Moosmang, S., Schulla, V., Welling, A., Feil, R., Feil, S., Wegener, J. W., Hofmann, F., and Klugbauer, N. (2003) EMBO J. 22, 6027–6034[CrossRef][Medline] [Order article via Infotrieve]
  4. Nelson, M. T., Patlak, J. B., Worley, J. F., and Standen, N. B. (1990) Am. J. Physiol. 259, C3–C18[Medline] [Order article via Infotrieve]
  5. Sonkusare, S., Palade, P. T., Marsh, J. D., Telemaque, S., Pesic, A., and Rusch, N. J. (2006) Vascul. Pharmacol. 44, 131–142[CrossRef][Medline] [Order article via Infotrieve]
  6. Triggle, D. J. (2006) Curr. Pharm. Des. 12, 443–457[CrossRef][Medline] [Order article via Infotrieve]
  7. Catterall, W. A., Perez-Reyes, E., Snutch, T. P., and Striessnig, J. (2005) Pharmacol. Rev. 57, 411–425[Abstract/Free Full Text]
  8. Arikkath, J., and Campbell, K. P. (2003) Curr. Opin. Neurobiol. 13, 298–307[CrossRef][Medline] [Order article via Infotrieve]
  9. Tang, Z. Z., Liang, M. C., Lu, S., Yu, D., Yu, C. Y., Yue, D. T., and Soong, T. W. (2004) J. Biol. Chem. 279, 44335–44343[Abstract/Free Full Text]
  10. Koch, W. J., Ellinor, P. T., and Schwartz, A. (1990) J. Biol. Chem. 265, 17786–17791[Abstract/Free Full Text]
  11. Tiwari, S., Zhang, Y., Heller, J., Abernethy, D. R., and Soldatov, N. M. (2006) Proc. Natl. Acad. Sci. U. S. A
  12. Jaggar, J. H. (2001) Am. J. Physiol. 281, C439 –C448
  13. Liu, Q., and Hofmann, P. A. (2003) Am. J. Physiol. Heart Circ. Physiol. 285, H97–H103[Abstract/Free Full Text]
  14. Pragnell, M., Sakamoto, J., Jay, S. D., and Campbell, K. P. (1991) FEBS Lett. 291, 253–258[CrossRef][Medline] [Order article via Infotrieve]
  15. Perez-Reyes, E., Castellano, A., Kim, H. S., Bertrand, P., Baggstrom, E., Lacerda, A. E., Wei, X. Y., and Birnbaumer, L. (1992) J. Biol. Chem. 267, 1792–1797[Abstract/Free Full Text]
  16. Castellano, A., Wei, X., Birnbaumer, L., and Perez-Reyes, E. (1993) J. Biol. Chem. 268, 3450–3455[Abstract/Free Full Text]
  17. Jaggar, J. H., Li, A., Parfenova, H., Liu, J., Umstot, E. S., Dopico, A. M., and Leffler, C. W. (2005) Circ. Res. 97, 805–812[Abstract/Free Full Text]
  18. Meir, A., Bell, D. C., Stephens, G. J., Page, K. M., and Dolphin, A. C. (2000) Biophys. J. 79, 731–746[Medline] [Order article via Infotrieve]
  19. Kobrinsky, E., Tiwari, S., Maltsev, V. A., Harry, J. B., Lakatta, E., Abernethy, D. R., and Soldatov, N. M. (2005) J. Biol. Chem. 280, 12474–12485[Abstract/Free Full Text]
  20. Pietrzykowski, A. Z., Martin, G. E., Puig, S. I., Knott, T. K., Lemos, J. R., and Treistman, S. N. (2004) J. Neurosci. 24, 8322–8332[Abstract/Free Full Text]
  21. Liao, P., Yong, T. F., Liang, M. C., Yue, D. T., and Soong, T. W. (2005) Cardiovasc. Res. 68, 197–203[Abstract/Free Full Text]
  22. Mikami, A., Imoto, K., Tanabe, T., Niidome, T., Mori, Y., Takeshima, H., Narumiya, S., and Numa, S. (1989) Nature 340, 230–233[CrossRef][Medline] [Order article via Infotrieve]
  23. Snutch, T. P., Tomlinson, W. J., Leonard, J. P., and Gilbert, M. M. (1991) Neuron 7, 45–57[CrossRef][Medline] [Order article via Infotrieve]
  24. Biel, M., Ruth, P., Bosse, E., Hullin, R., Stuhmer, W., Flockerzi, V., and Hofmann, F. (1990) FEBS Lett. 269, 409–412[CrossRef][Medline] [Order article via Infotrieve]
  25. Lyford, G. L., Strege, P. R., Shepard, A., Ou, Y., Ermilov, L., Miller, S. M., Gibbons, S. J., Rae, J. L., Szurszewski, J. H., and Farrugia, G. (2002) Am. J. Physiol. Cell Physiol. 283, C1001–C1008[Abstract/Free Full Text]
  26. Soldatov, N. M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 4628–4632[Abstract/Free Full Text]
  27. Hell, J. W., Westenbroek, R. E., Warner, C., Ahlijanian, M. K., Prystay, W., Gilbert, M. M., Snutch, T. P., and Catterall, W. A. (1993) J. Cell Biol. 123, 949–962[Abstract/Free Full Text]
  28. Tang, Z. Z., Hong, X., Wang, J., and Soong, T. W. (2007) Cell Calcium 41, 417–428[CrossRef][Medline] [Order article via Infotrieve]
  29. Restituito, S., Cens, T., Rousset, M., and Charnet, P. (2001) Biophys. J. 81, 89–96[Medline] [Order article via Infotrieve]
  30. Stephens, G. J., Page, K. M., Bogdanov, Y., and Dolphin, A. C. (2000) J. Physiol. 525, 377–390[Abstract/Free Full Text]
  31. Hullin, R., Singer-Lahat, D., Freichel, M., Biel, M., Dascal, N., Hofmann, F., and Flockerzi, V. (1992) EMBO J. 11, 885–890[Medline] [Order article via Infotrieve]
  32. Saada, N., Dai, B., Echetebu, C., Sarna, S. K., and Palade, P. (2003) Biochem. Biophys. Res. Commun. 302, 23–28[CrossRef][Medline] [Order article via Infotrieve]
  33. Saada, N. I., Carrillo, E. D., Dai, B., Wang, W. Z., Dettbarn, C., Sanchez, J., and Palade, P. (2005) Cell Calcium 37, 301–309[CrossRef][Medline] [Order article via Infotrieve]
  34. Klugbauer, N., Marais, E., and Hofmann, F. (2003) J. Bioenerg. Biomembr. 35, 639–647[CrossRef][Medline] [Order article via Infotrieve]
  35. Sandoval, A., Oviedo, N., Andrade, A., and Felix, R. (2004) FEBS Lett. 576, 21–26[CrossRef][Medline] [Order article via Infotrieve]
  36. Felix, R., Gurnett, C. A., De, W. M., and Campbell, K. P. (1997) J. Neurosci. 17, 6884–6891[Abstract/Free Full Text]
  37. Bichet, D., Cornet, V., Geib, S., Carlier, E., Volsen, S., Hoshi, T., Mori, Y., and De, W. M. (2000) Neuron 25, 177–190[CrossRef][Medline] [Order article via Infotrieve]
  38. Gerster, U., Neuhuber, B., Groschner, K., Striessnig, J., and Flucher, B. E. (1999) J. Physiol. 517, 353–368[Abstract/Free Full Text]
  39. Takahashi, S. X., Mittman, S., and Colecraft, H. M. (2003) Biophys. J. 84, 3007–3021[Medline] [Order article via Infotrieve]
  40. Foell, J. D., Balijepalli, R. C., Delisle, B. P., Yunker, A. M., Robia, S. L., Walker, J. W., McEnery, M. W., January, C. T., and Kamp, T. J. (2004) Physiol. Genomics 17, 183–200[Abstract/Free Full Text]
  41. Bogdanov, Y., Brice, N. L., Canti, C., Page, K. M., Li, M., Volsen, S. G., and Dolphin, A. C. (2000) Eur. J. Neurosci. 12, 894–902[CrossRef][Medline] [Order article via Infotrieve]
  42. Chien, A. J., Gao, T., Perez-Reyes, E., and Hosey, M. M. (1998) J. Biol. Chem. 273, 23590–23597[Abstract/Free Full Text]
  43. Resh, M. D. (1999) Biochim. Biophys. Acta 1451, 1–16[Medline] [Order article via Infotrieve]
  44. Arien, H., Wiser, O., Arkin, I. T., Leonov, H., and Atlas, D. (2003) J. Biol. Chem. 278, 29231–29239[Abstract/Free Full Text]
  45. Cho, H. C., Tsushima, R. G., Nguyen, T. T., Guy, H. R., and Backx, P. H. (2000) Biochemistry 39, 4649–4657[CrossRef][Medline] [Order article via Infotrieve]
  46. Davis, M. J., and Hill, M. A. (1999) Physiol. Rev. 79, 387–423[Abstract/Free Full Text]
  47. Yang, Y., Chen, X., Margulies, K., Jeevanandam, V., Pollack, P., Bailey, B. A., and Houser, S. R. (2000) J. Mol. Cell Cardiol. 32, 973–984[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
G. Zhao, A. Adebiyi, E. Blaskova, Q. Xi, and J. H. Jaggar
Type 1 inositol 1,4,5-trisphosphate receptors mediate UTP-induced cation currents, Ca2+ signals, and vasoconstriction in cerebral arteries
Am J Physiol Cell Physiol, November 1, 2008; 295(5): C1376 - C1384.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. Adebiyi, E. M. McNally, and J. H. Jaggar
Sulfonylurea Receptor-Dependent and -Independent Pathways Mediate Vasodilation Induced by ATP-Sensitive K+ Channel Openers
Mol. Pharmacol., September 1, 2008; 74(3): 736 - 743.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/40/29211    most recent
M610623200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheng, X.
Right arrow Articles by Jaggar, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, X.
Right arrow Articles by Jaggar, J. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement