| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 282, Issue 40, 29401-29413, October 5, 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||1
From the
Division of Biological Sciences, Moores Cancer Center, ||Division of Hematology/Oncology, Department of Medicine, University of California, San Diego, La Jolla, California 92093-0820 and the ¶Mary Babb Randolph Cancer Center and Department of Biochemistry, West Virginia University, Morgantown, West Virginia 26506
Received for publication, March 15, 2007 , and in revised form, August 7, 2007.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
(TNF) activates caspase-8 to cleave effector caspases or Bid, resulting in type-1 or type-2 apoptosis, respectively. We show here that TNF also induces caspase-8-dependent C-terminal cleavage of the retinoblastoma protein (Rb). Interestingly, fibroblasts from RbMI/MI mice, in which the C-terminal caspase cleavage site is mutated, exhibit a defect in Bid cleavage despite caspase-8 activation. Recent results suggest that TNF receptor endocytosis is required for the activation of caspase-8. Consistent with this notion, inhibition of V-ATPase, which plays an essential role in acidification and degradation of endosomes, specifically restores Bid cleavage in RbMI/MI cells. Inhibition of V-ATPase sensitizes RbMI/MI but not wild-type fibroblasts to TNF-induced apoptosis and stimulates inflammation-associated colonic apoptosis in RbMI/MI but not wild-type mice. These results suggest that Rb cleavage is required for Bid cleavage in TNF-induced type-2 apoptosis, and this requirement can be supplanted by the inhibition of V-ATPase. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
(TNF)2 is an inflammatory cytokine that orchestrates the systemic responses to infections and injuries. Discovered as an inducer of tumor necrosis, TNF also promotes tumor development, particularly under conditions of chronic inflammation (1–3). The tumor-promoting activity of TNF is mediated through its activation of the NF-
B pathway, which stimulates the production of cytokines, chemokines, and apoptotic inhibitors (4, 5). Nonetheless, the type-1 TNF receptor (TNFR1) contains a death domain (DD) that can induce the assembly of death-inducing signaling complex (DISC) to activate the initiator caspase-8, leading to the induction of apoptosis (6, 7). TNFR1 also activates programmed necrosis that is independent of caspase activity but mediated by reactive oxygen species (8–10). The prodeath function of TNF is observed when the NF-B pathway is inactivated. In ex vivo experiments, cycloheximide (CHX) is routinely used to divert TNF signal toward death by blocking the expression of NF-B-induced genes, such as FLIP and mitochondrial superoxide dismutase, that prevent the activation of caspase-8 and the generation of reactive oxygen species, respectively (11, 12). In cells defective in the NF-B pathway, TNF alone (without CHX) is sufficient to induce cell death (13, 14). In mice, TNF- and TNFR1-dependent cell death is observed in a variety of mouse tissues under conditions of acute inflammation (2, 5, 15). The molecular mechanisms that govern the survival versus the death response to TNF are likely to be complex and have not been fully elucidated.
An important clue to how TNF differentially activates NF-B or caspase-8 has come from recent studies showing that TNFR1 endocytosis is a prerequisite for DISC assembly (16, 17). In the plasma membrane, activated TNFR1 is capable of stimulating the NF-B pathway, but it does not associate with FADD or caspase-8 (18, 19). By contrast, two other DD receptors (i.e. FAS/CD95 and DR5) do assemble DISC at the plasma membrane when activated by FAS ligand or TRAIL, respectively (19). In experiments conducted with a human fibrosarcoma cell line (HT1080) that expresses a degradation-resistant IB- to divert TNF signal toward caspase-8, Micheau and Tschopp (18) detected a cytosolic DISC complex containing TRADD, FADD, and caspase-8 but free of TNFR1. Subsequent studies conducted with human U937 and mouse 3T3 cells detected TNFR1-associated TRADD-FADD-caspase-8 complex in the endosomal fraction (16). Together, these results suggest that TNFR1 endocytosis and the release of DISC from the receptor-endosome may play a role in determining the cellular response to TNF.
The retinoblastoma susceptibility gene product, Rb, is a nuclear scaffolding protein with multiple protein-binding pockets (20–23). Rb inhibits the transcription of E2F-regulated genes to block cell cycle progression. Because E2F also stimulates the expression of apoptotic factors, such as caspases and Apaf-1, inhibition of E2F by Rb confers apoptotic resistance in growth-arrested cells (24). Upon stimulation with mitogenic factors, Rb is inactivated through phosphorylation by cyclin-dependent kinases to promote cell cycle entry and S-phase progression (25). Upon exposure to death stimuli, Rb is cleaved by caspase at a predominant site, DEAD886G887, near the C terminus of the protein (26–28). Cleavage at this site generates a large fragment of Rb (Rb
I) that retains E2F-binding and transcription repression functions (26, 27, 29). Thus, the C-terminal cleavage does not interfere with the antiproliferative activity of Rb. We have mutated this C-terminal caspase cleavage site to DEAA886E887 in the mouse Rb gene to create the Rb-MI allele (30). The Rb-MI allele confers resistance to inflammation-induced apoptosis in the mouse intestine, which is dependent on TNF (30). The Rb-MI allele also confers resistance to TNF-induced apoptosis in explanted thymocytes and in fibroblasts derived from the mouse embryos (30, 31). Interestingly, however, Rb-MI does not protect fibroblasts from apoptosis induced by TRAIL3; nor is it protective of hepatocyte apoptosis induced by the ligation of FAS receptor.4
Death receptors, such as FAS and TNFR1, stimulate apoptosis through two pathways, both activated by caspase-8 (4, 32). In the type-1 pathway, initiator caspase-8 directly cleaves and activates effector caspases to induce apoptosis (33). In the type-2 pathway, initiator caspase-8 cleaves Bid, and the resulting tBid induces mitochondria outer membrane permeability to cause the release of proapoptotic factors, leading to the activation of apoptosome and caspase-9 (33, 34). We have previously shown that TNFR1-induced cytochrome c release is defective in Rb-MI fibroblasts (30). In pursuing the mechanism underlying this defect, we have discovered that inhibition of vacuolar ATPase can restore the TNFR1-induced type-2 apoptotic pathway in Rb-MI cells.
The vacuolar ATPase (V-ATPase) is a proton pump that is conserved in eukaryotic cells (35, 36). Composed of a soluble V1 complex that hydrolyzes ATP and an integral membrane V0 complex that forms the proton channel, V-ATPase couples ATP hydrolysis to the translocation of protons from the cytosol to the lumen of late endosomes, multivesicular bodies, and lysosomes (35, 37). V-ATPase-dependent luminal acidification provides the necessary condition for lysosomal degradative enzymes to perform their functions. Moreover, acidification is also required for endosomal trafficking (37, 38), best demonstrated by a recent report that V-ATPase allows the recruitment of Arf6 and ARNO to the endosomal membrane for sorting to the multivesicular body and lysosome (39). We show here that TNFR1 activates the 43-kDa endosomal caspase-8 in Rb-MI cells, but Bid is not cleaved. However, Bid cleavage is rescued either by the knockdown of Rb-MI or by the inhibition of V-ATPase.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
-mercaptoethanol. Cells were routinely treated with 10 ng/ml recombinant human TNF (hTNF) plus 2.5 µg/ml CHX for 5 h at 37 °C unless noted otherwise. Antibodies and Chemicals—Rb antibodies used are rabbit anti-Rb (851) raised against the C-terminal fragment (residues 768–928) of Rb (20) and anti-Rb from Pharmingen (554136); rat anti-caspase-8 (1G12) and rat anti-FADD (12E7) were from Alexis Biochemicals; rabbit anti-Smac was from Chemicon; goat anti-Bid and rabbit anti-Cox-IV were from Biovision; goat-anti-ATP6V1B1 (N-20), rabbit-anti-Mcl-1 (S-19), and rabbit anti-TRADD (H-278) were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA); rabbit anti-phospho-c-Jun, mouse anti-cleaved caspase-3 (5A1), and rabbit anti-PARP1 were from Cell Signaling Technology; mouse anti-cytochrome c antibody was from BD Biosciences; biotin-VAD-fmk was from Kamiya; the caspase-8 fluorometric assay kit was from Biovision; the caspase-3 fluorometric assay kit was from Molecular Probes; the TUNEL staining kit was obtained from BD Biosciences; recombinant human and mouse TNF were from R & D Systems; MG-132 and cathepsin inhibitor benzyloxycarbonyl-YY-fmk were from Calbiochem; and bafilomycin A1, concanamycin A, and carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) were from Sigma.
Western Blot—Whole cell lysates were prepared in radioimmune precipitation buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% Nonidet P-40, 0.25% sodium deoxycholate, 0.1% SDS, 0.5 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol) plus protease inhibitor (from Sigma); 50–100 µg of total protein were resolved by SDS-PAGE, transferred onto polyvinylidene difluoride membranes, blocked in 5% nonfat dry milk/TBST (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.05% Tween 20), and incubated with primary antibodies overnight at 4 °C. Membranes were washed three times for 10 min each in TBST and incubated with horseradish peroxidase-conjugated secondary antibodies for 1–3 h at room temperature. After three 10-min washings, membranes were incubated with enhanced ECL reagent (from Pierce) for 1 min and exposed to x-ray films. To detect Rb protein in MEFs, 5 µg of anti-Rb (851) was mixed with 1 mg of whole cell lysate, and the immune complex was collected on protein A-Sepharose, resolved by SDS-PAGE, and then immunoblotted with anti-Rb antibody from Pharmingen.
Propidium Iodide Uptake—Cells were trypsinized and resuspended in 500 µl of phosphate-buffered saline containing 1 µg/ml propidium iodide, incubated for 10 min at room temperature, and immediately analyzed by flow cytometry, counting at least 10,000 events/sample. For each treatment condition, triplicate samples were analyzed, from which the average percentage of propidium iodide-positive cells was calculated.
DEVDase and IETDase Assay—Cells were lysed in PIPES/CHAPS buffer (10 mM HEPES-KOH (pH 7.5), 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 1 mM EGTA) and clarified by centrifugation. 100 µg of total protein was incubated with 50 µM Ac-DEVD-AMC or Ac-IETD-AFC for 60 min at 37 °C. Fluorometric detection of AMC and AFC was performed in triplicates by excitation at 360 nm/emission at 460 nm (AMC) or excitation at 400 nm/emission at 505 nm (AFC).
Cell Fractionation—Cells were trypsinized, washed in phosphate-buffered saline, resuspended in mannitol/sucrose buffer (210 mM mannitol, 70 mM sucrose, 10 mM HEPES (pH 7.5), 0.5 mM EDTA) plus protease inhibitor and broken up by passage through a 22.5-gauge needle. Heavy membrane fractions (containing mitochondria) were pelleted by centrifugation. 100 µg of the supernatant was resolved on a 14% SDS-polyacrylamide gel followed by immunoblotting with anti-cytochrome c or anti-Samc.
In Vitro Cytochrome c Release Assay—Freshly isolated liver mitochondria were combined with cytosolic extracts from untreated or TNF-treated Rb-wt or Rb-MI cells diluted in KCl buffer (125 mM KCl (pH 7.4), 10 mM HEPES-KOH, 5 mM Na2HPO4, 4 mM MgCl2, 0.5 mM EGTA) and incubated for 45 min at 37 °C under gentle agitation. Mitochondria were pelleted by centrifugation. The supernatants and the pellets were separately analyzed for cytochrome c and Cox-IV by immunoblotting.
In Vivo Affinity Labeling of Caspase-8—We adopted the method described by Tu et al. (41) to label activated caspase-8 in cells. Briefly, 1 x 107 cells were trypsinized, centrifuged, and resuspended in 4 ml of Dulbecco's modified Eagle's medium containing 10% fetal bovine serum with 50 µM biotin-VAD-fmk. After 1 h of incubation at 37 °C, 10 ng/ml hTNF plus CHX (2.5 µg/ml) were added. Cells were harvested at the indicated time and lysed in 0.5 ml of radioimmune precipitation buffer, and 1 mg of total proteins were incubated with 50 µl of streptavidin/Sepharose beads (Amersham Biosciences) at 4 °C overnight. The beads were washed with radioimmune precipitation buffer and boiled in 25 µl of 3x SDS sample buffer, the supernatant was resolved by SDS-PAGE, and caspase-8 was detected by immunoblotting.
Synchronization of Endocytosis—Rb-wt or Rb-MI cells were first incubated with different doses of hTNF/CHX at 4 °C for 90 min and then shifted to 37 °C for different amounts of time. Cells were subjected to either cell death assay by propidium iodide uptake or DEVDase and IETDase assay.
Dextran Sulfate Sodium (DSS)-induced Colonic Apoptosis in Mice—Rb+/+, Rb+/MI, or RbMI/MI mice were fed water containing 3% DSS (Mr 36,000–50,000 from Sigma). At 56 h into DSS feeding, they were injected intraperitoneally with either bafilomycin A1 at a concentration of 25 ng/g body weight or vehicle. Mice were sacrificed 16 h later, and colonic tissues were collected in a roll, fixed in 4% paraformaldehyde for 2 days, embedded into paraffin blocks, cut into 5-µm sections, deparaffined, and TUNEL-labeled. Fluorescent images of labeled sections were captured by CCD camera; TUNEL-positive nuclei were counted in at least 25 crypts per tissue samples. All animal studies were approved by the University of California San Diego institutional animal care and use committee.
Lysosomal pH Measurement—We adopted the method described by Trombetta et al. (42) to measure the luminal pH of endosomes and lysosomes. Briefly, 10,000 Rb-wt or Rb-MI mouse fibroblasts were plated per well in a 96-well plate. After overnight culture, cells were loaded with the pH-sensitive FITC-dextran (Sigma) for 1 h at 37 °C, followed by treatment with hTNF/CHX or bafilomycin A1 (200 nM) for 5 h. At the end of the experiment, excess FITC-dextran was removed by extensive washing with Dulbecco's modified Eagle's medium, and the wells were replaced with phosphate-buffered saline. The fluorescence emitted at 520 nm was recorded at two excitation wavelengths, 450 and 490 nm, using a SpectraMax Gemini fluorescence plate reader. The pH values were determined by comparing the fluorescence signals with a standard curve constructed for FITC-dextran in phosphate/citrate buffers of different pH values between 4.0 and 8.0.
DNA Microarray—Rb-MI or Rb-wt cells were subjected to different treatments, and then the total RNA was extracted, and the cRNA probes were synthesized and labeled with biotin (for Affymetrix GeneChip® (MGU74A)) or Cy5 or Cy3 (for Agilent mouse whole genome array (G4112A)). Array hybridization, data collection, and analysis were conducted using protocols and programs supplied by the manufacturers and indicated in the figures and tables.
siRNA Experiments—Sense and antisense RNA oligonucleotides corresponding to the target sequence for mouse Rb (GUUGAUAAUGCUAUGUCAA), mouse ATP6V1B1 (TCCACCTCAGTCCTATATA), and LacZ (AACGTACGCGGAATACTTCGA) were synthesized and annealed by Ambion. Uniqueness of individual target sequences was confirmed by a BLAST search of the mouse genomic plus transcript data base. Transfection of synthetic siRNA was performed using Lipofectamine reagent with standard procedures. 48 h after transfection, cells were collected, and target protein levels were analyzed. Cotransfection of Cy3-labeled siRNA duplexes was performed to determine transfection efficiency when necessary.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
10 ng/ml concentration of either hTNF or mTNF, although the maximal levels of IETDase were higher in mTNF/CHX-treated Rb-wt cells. With the Rb-MI cells, the IETDase activity stimulated by mTNF/CHX was about 2-fold lower than that found in Rb-wt cells at every mTNF concentration tested (Fig. 1C). With hTNF, however, Rb-MI cells appeared nonresponsive, with no detectable stimulation of IETDase at hTNF concentrations up to 80 ng/ml (Fig. 1C). We have previously shown that hTNF/CHX-induced cytochrome c release is defective in Rb-MI cells (30). As shown in Fig. 1D, cytosolic Smac and cytochrome c were detected in Rb-wt cells treated with hTNF/CHX or mTNF/CHX, but their release only occurred in mTNF/CHX-treated Rb-MI cells. Consistent with the role of Bid cleavage in TNF-induced cytochrome c release (34, 44), we observed Bid cleavage in Rb-wt cells treated with hTNF/CHX or mTNF/CHX, but Bid was only cleaved in mTNF/CHX-treated Rb-MI cells (Fig. 1E). To further examine the cytochrome c release defect in Rb-MI cells, we prepared lysates from hTNF/CHX-treated Rb-wt and Rb-MI cells and incubated them with liver mitochondria. Cytochrome c release activity was detected in lysates from hTNF/CHX-treated Rb-wt cells but not those from Rb-MI cells (Fig. 1F). The lysates of Rb-MI cells, either before or after hTNF/CHX treatment, did not interfere with cytochrome c release induced by a recombinant NC-Bid (45) (Fig. 1G), suggesting that the defect is not caused by an inhibitor of tBid in Rb-MI lysates. In keeping with this conclusion, we found that hTNF/CHX induced similar modifications of Mcl-1, an inhibitor of cytochrome c release, in Rb-wt and Rb-MI cells (supplemental Fig. 1B). We also prepared liver mitochondria from Rb-MI mice and found them to be competent in releasing cytochrome c in response to lysates from hTNF/CHX-treated Rb-wt fibroblasts (Fig. 1H). Taken together, these results show that TNFR1-induced Bid cleavage is defective in Rb-MI cells and that the lack of tBid rather than the accumulation of inhibitors accounted for the cytochrome c release defect in hTNF/CHX-treated Rb-MI cells.
|
TNFR1-induced Bid Cleavage Is Restored by the Knockdown of Rb-MI—To demonstrate that the Rb-MI protein is required to prevent Bid cleavage, we used siRNA to knockdown its expression (Fig. 2E). The knockdown of wild type Rb protein did not enhance hTNF/CHX-induced IETDase activity, Bid cleavage, or cell death (Fig. 2, F–H). In contrast, knockdown of Rb-MI restored hTNF/CHX-induced IETDase activity, Bid cleavage, and cell death (Fig. 2, F–H). These results suggest that Rb cleavage is sufficient to promote TNFR1-induced Bid cleavage, because the knockdown of Rb does not further enhance Bid cleavage. By contrast, the Rb-MI protein, which cannot be cleaved, blocks Bid cleavage. Furthermore, the Rb-MI protein must be present to prevent TNFR1 from inducing the cleavage of Bid, because Bid cleavage is restored with the knockdown of Rb-MI.
TNF-induced Gene Expression Is Similar in Rb-wt and Rb-MI Cells—Given the established role of Rb in the regulation of gene expression, we performed microarray analyses to compare gene expression profiles of Rb-MI cells treated with hTNF/CHX versus mTNF/CHX. However, we did not detect any statistically significant differences despite the fact that mTNF/CHX, but not hTNF/CHX, induced Bid cleavage in Rb-MI cells (supplemental Fig. 2 and Table 1). We also compared hTNF/CHX-induced gene expression changes in Rb-wt and Rb-MI cells and found a similar cohort of up-regulated and down-regulated genes in these two cell lines (supplemental Table 2). We have previously observed hTNF/CHX-induced IB- degradation in Rb-wt and Rb-MI cells (30), consistent with the similar up-regulation of several known NF-B regulated genes by TNF in these cells (supplemental Table 2). We also found that hTNF/CHX-induced phosphorylation of c-Jun was similar in Rb-wt and Rb-MI cells (supplemental Fig. 1A). Thus, Rb-MI did not exert a detectable effect on TNF-induced gene expression, which is mediated by the TNFR1 at the plasma membrane. Moreover, a Bid cleavage defect in Rb-MI cells is not likely to require new gene expression, since it is observed in the presence of CHX.
Activation of Caspase-8 in Rb-MI Cells—We have previously observed the loss of full-length caspase-8, occurring between 12 and 24 h after hTNF/CHX treatment in both Rb-wt and Rb-MI primary fibroblasts (30), indicating that caspase-8 activation is not impaired in Rb-MI cells. With the immortalized Rb-wt and Rb-MI fibroblasts, we could not detect any reduction in full-length caspase-8 at 5 h after hTNF/CHX treatment when Bid cleavage was observed (Fig. 3A). Since caspase-8 activation does not require its cleavage (46, 47), we adopted an in vivo affinity labeling method to covalently biotinylate activated caspase-8 with a membrane-permeable biotin-VAD-fmk (41) (Fig. 3B). The full-length (p55) caspase-8 was pulled down by streptavidin beads only in cells exposed to biotin-VAD-fmk (not shown), and this p55 band was not found in caspase-8-/- fibroblasts (Fig. 3C). The levels of biotinylated p55 caspase-8 were similar in untreated and hTNF/CHX-treated cells (Fig. 3, C and D). Detection of active caspase-8 in untreated cells may not be surprising, given the recent finding that caspase-8 has biological functions other than the stimulation of apoptosis (48, 49). At 2 h after hTNF/CHX addition, a p43 caspase-8 band was pulled down in cells with caspase-8 but not in the Caspase-8-/- cells (Fig. 3, C and D). Previous studies have shown that the p43 caspase-8 is present in the endosomal fraction of TNF-treated cells (16). Approximately 1% of the input p55 band was pulled down by the streptavidin beads (Fig. 3D), and the p43 band could not be detected in whole cell lysates (Fig. 3A), indicating that only a small fraction of the full-length caspase-8 was activated and converted to p43 in response to hTNF/CHX. We observed biotinylated p55 and p43 bands in hTNF/CHX-treated Rb-wt and Rb-MI cells (Fig. 3D), consistent with the previous conclusion that TNFR1-induced caspase-8 activation does occur in Rb-MI cells.
|
|
Inhibition of V-ATPase Restores Caspase-8-dependent Bid Cleavage in Rb-MI Cells—To further examine the effect of V-ATPase inhibition, we tested whether Baf can enhance the activation of caspase-8. Using the in vivo biotinylation approach outlined in Fig. 3B, we showed that Baf did not cause a significant increase in the pull-down of p55 and p43 caspase-8 in Rb-wt and Rb-MI cells (Fig. 5A). However, Baf allowed the accumulation of cytosolic IET-Dase activity and the cleavage of Bid in hTNF/CHX-treated Rb-MI cells (Fig. 5, B and C). Baf treatment did not enhance IETDase activity or Bid cleavage in Rb-wt cells. Bid cleavage under the condition of Baf plus hTNF/CHX remained dependent on caspase-8 (Fig. 5D), showing that Baf did not activate an alternative Bid cleavage pathway. We found that the levels of TNFR1 and DISC component proteins were similar in Rb-wt and Rb-MI cells, and their levels were not affected by hTNF/CHX and/or Baf treatment (Fig. 5E). We noted that Baf also stimulated hTNF/CHX-induced Rip1 cleavage, which is mediated by caspase-8 (51), in Rb-MI cells but not in Rb-wt cells (Fig. 5E).
To seek additional evidence that inhibition of V-ATPase can restore Bid cleavage in Rb-MI cells, we knocked down the B1 subunit of the cytosolic V1 complex of the V-ATPase by siRNA. The control siRNA did not affect Bid cleavage; however, the knockdown of the V-ATPase B1 subunit rescued hTNF/CHX-induced IETDase activity and Bid cleavage in Rb-MI cells (Fig. 5, F–H). Because pretreatment with Baf or V1B1 knockdown did not enhance hTNF/CHX-induced IETDase or Bid cleavage in Rb-wt cells (Fig. 5, B, C, E, F, and G), it suggests that V-ATPase inhibition is irrelevant to Bid cleavage when Rb can be cleaved. However, in Rb-MI cells, V-ATPase inhibition supplants the requirement of Rb cleavage to allow Bid cleavage.
Bafilomycin A1 Stimulates DSS-induced Colonic Apoptosis in RbMI/MI Mice—We have previously shown that Rb-MI promotes colon tumors in the p53-null genetic background, correlating with reduced apoptotic response to inflammation-associated epithelial apoptosis (52). We induced apoptosis of colonic epithelial cells by feeding mice with water containing DSS for 3 days (52). Mice were also exposed to Baf via intraperitoneal injection 16 h prior to the collection of colonic tissue. Exposure to DSS induced TUNEL-positive nuclei in the colonic epithelium (Fig. 6A). Exposure to Baf alone did not induce apoptosis (not shown). Following DSS exposure, the number of TUNEL-positive nuclei in the colonic crypts was significantly lower in RbMI/MI mice than in Rb+/+ littermates (Fig. 6B). However, additional exposure to Baf significantly increased the apoptotic response of RbMI/MI mice to DSS feeding. Baf also significantly enhanced the apoptotic response of Rb+/MI mice to DSS (Fig. 6B). By contrast, Baf did not affect the colonic apoptotic response in Rb+/+ mice (Fig. 6B). We have previously shown that thymocytes from RbMI/MI mice are resistant to hTNF/CHX-induced apoptosis (31). We found that treatment with Baf also enhanced hTNF/CHX-induced apoptosis of thymocytes from RbMI/MI but not Rb+/+ mice (not shown). Thus, Rb-MI-mediated inhibition of TNFR1-dependent apoptosis can be overridden by Baf in fibroblasts, thymocytes, and colonic epithelial cells.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
The sequential cleavage model predicts that Rb cleavage would not be required for TNF to kill cells that die by the type-1 pathway alone. In other words, Rb-MI would only protect type-2 cells from TNF-induced apoptosis. This is consistent with our previous findings that endotoxin-induced apoptosis is blocked in the intestine but not in the spleen of Rb-MI mice (30). We would point out that mouse embryo fibroblasts (MEFs) are type-1 cells, because TNF/CHX-induced apoptosis is observed in Bid knock-out and cytochrome c knock-out MEFs (53, 54). In other words, the Bid-dependent cytochrome c release is not necessary for TNF/CHX to kill MEFs. In fact, we show that mTNF/CHX can indeed activate apoptosis in Rb-MI MEFs. Only by activating TNFR1 alone with human TNF could we reveal the type-2 pathway blockade imposed by Rb-MI in MEFs. The physiological relevance of the MEF-based experimental results is demonstrated by our observation that bafilomycin A1 can restore colonic apoptosis in DSS-treated RbMI/MI mice. We have found that DSS-induced colonic apoptosis is diminished in TNFR1-deficient mice,5 suggesting the involvement of TNFR1 in this in vivo response. This death response is diminished in Rb+/MI and RbMI/MI mice but could be enhanced by bafilomycin. Taken together, results from Rb-MI MEFs and RbMI/MI mice are consistent with the model that Rb cleavage is required for TNF to activate the type-2 apoptotic pathway.
Receptor Endocytosis and Cytosolic Accumulation of Activated Caspase-8—Previous studies have shown that TNFR1 does not initiate DISC assembly at the plasma membrane (18, 19). Instead, the TNFR1-DISC complex is detected in the endosomal fraction under conditions of synchronized endocytosis in several cell types (16, 17). A cytosolic DISC free of TNFR1 has been observed in a human fibrosarcoma cell line that ectopically expresses a constitutive inhibitor of NF-B (18). In the fibrosarcoma cell line, two distinct signaling complexes were identified. Complex-1 contains TNFR1, TRADD, RIP1, and TRAF2 and mediates NF-B activation. This membrane complex appears to be further processed to recruit FADD through TRADD, resulting in the formation of complex-2 (i.e. the DISC complex), which dissociates from TNFR1 and accumulates in the cytosol (18). Interestingly, although TRAIL-induced apoptosis does not require receptor endocytosis (55), internalization of FAS/CD95 and TNFR1 through endocytosis is required for the induction of apoptosis (16, 17, 56). Activated FAS/CD95L directly recruits FADD and stimulates a small amount of DISC formation at the cell surface, followed by endocytosis of the entire complex. In type-1 cells, this internalization step triggers further recruitment of FADD and caspase-8 to stimulate apoptosis (56). We have found that Rb-MI does not interfere with apoptosis induced by anti-FAS or TRAIL (30).6 Rb-MI does not interfere with TNFR1 endocytosis, because synchronization of endocytosis rescued Bid cleavage in Rb-MI cells. Taken together, these results suggest that Rb-MI does not block apoptosis at the step of receptor internalization. Furthermore, these results suggest that DISC complexes stimulated by activated Fas versus TNFR1 may be subjected to different regulation, despite the similar requirement for receptor endocytosis in the assembly of DISC. Because synchronized endocytosis can enhance caspase-8 activity and Bid cleavage in MEFs, irrespective of Rb cleavage, and because the inhibition of V-ATPase specifically enhanced caspase-8-dependent Bid cleavage in Rb-MI cells, Rb-MI is likely to exert its antiapoptotic effect by preventing the cytosolic accumulation of activated caspase-8 downstream of TNFR1 activation.
|
|
Mechanism of Rb-dependent Blockade of Bid Cleavage—The nuclear Rb protein inhibits cell proliferation and apoptosis through transcriptional regulation of E2F-dependent gene expression (58). Cleavage of Rb at the C-terminal caspase site (DEAD886G887) mutated in Rb-MI (DEAA886E887) generates a large Rb-I fragment (residues 1–886) that encompasses the two well-defined E2F-binding pockets and the Abl-binding C-pocket in the Rb protein (59, 60). We have previously shown that Rb-I is further degraded in apoptotic cells (28, 30), suggesting that C-terminal cleavage can cause the loss of Rb protein thus leading to the activation of proapoptotic gene expression through E2F and Abl (31, 58). The blockade of Bid cleavage observed in this study is not likely to involve new gene expression, because Rb-I was not further degraded at the time point when Bid cleavage occurred and because cycloheximide was used in conjunction with TNF to induce cell death.
We have previously shown that thymocytes from Abl- or p73-deficient mice are resistant to TNF-induced apoptosis (31). With Abl- or p73-deficient mouse fibroblasts, TNF/CHX-induced apoptosis was not abolished; nevertheless, reintroduction of Abl or p73 could enhance the death response in these knock-out cells by stimulating cytochrome c release (31). Although Abl enhances TNF/CHX-induced fibroblast cell death, we found that the ectopic activation of Abl tyrosine kinase through inducible dimerization (61) in Rb-MI cells did not rescue the hTNF/CHX-induced IETDase activity (supplemental Fig. 3). However, the ectopic activation of the same dimerizable Abl kinase could stimulate IETDase in hTNF (without cycloheximide)-treated p21E cells, which lack p21Cip1 and express the adenoviral E1A protein (supplemental Fig. 3). Furthermore, siRNA-mediated knockdown of Abl did not interfere with hTNF/CHX-induced IETDase activity in Rb-wt cells (supplemental Fig. 3). Whereas Abl contributes to TNF-induced type-2 apoptosis, results from this study suggest that the blockade of Bid cleavage in Rb-MI cells is mediated through Abl-independent mechanisms.
|
I and/or the C-terminal 41-amino acid peptide) exert a positive effect on caspase-8 and Bid cleavage. In the second scenario, cleavage of Rb causes the release of a factor that stimulates the cytosolic accumulation of caspase-8, thus leading to Bid cleavage. The first scenario that Rb fragments directly activate caspase-8 or Bid cleavage is inconsistent with the result that knockdown of Rb-MI rescued cytosolic caspase-8 activity and Bid cleavage. Furthermore, knockdown of Rb-wt did not affect hTNF/CHX-induced caspase-8 activation or Bid cleavage, suggesting that Rb fragments are not required for Bid cleavage. Although we currently favor the second scenario (i.e. Rb cleavage causes the release of a factor (X in Fig. 7B) to stimulate Bid cleavage), we do not know the identity of such a factor. A previous report has shown that Rb-I loses the ability to bind MDM2 (62). There is considerable evidence in the literature that MDM2 functions as an inhibitor of apoptosis (63), thus inconsistent with MDM2 being an activator of the TNF-induced type-2 apoptotic pathway. Identification of the mechanism by which Rb-MI blocks Bid cleavage awaits further investigation.
Rb Cleavage as a Nuclear Checkpoint for TNF-induced Type-2 Apoptosis—The sequential model depicted in Fig. 7B suggests that cleavage of Rb may serve as a nuclear checkpoint for the activation of the type-2 apoptotic pathway by TNF. Previous studies have suggested that hyperphosphorylated Rb is more resistant to caspase cleavage (59, 64). If so, Rb cleavage is less likely to occur in S/G2/M phase cells that contain hyperphosphorylated Rb. Since TNF activates NF-B, which promotes cell growth and survival, the Rb cleavage checkpoint may help to prevent the activation of the type-2 apoptotic pathway during TNF-stimulated cell proliferation. We have found that DSS induced colonic apoptosis to occur preferentially in the differentiated and nonproliferating epithelial cells, and it is this population of cells that are protected from apoptosis in the RbMI/MI mice. The status of the Rb protein (i.e. phosphorylation versus degradation) may therefore regulate the proliferative versus apoptotic response to TNF.
|
FOOTNOTES |
|---|
The on-line version of this article (available at http://www.jbc.org) contains supplemental Tables 1 and 2 and Figs. 1–3.
1 To whom correspondence should be addressed: Moores-UCSD Cancer Center, 3855 Health Sciences Dr., La Jolla, CA 92093-0820. Tel.: 858-534-6253; Fax: 858-534-2821; E-mail: jywang{at}ucsd.edu.
2 The abbreviations used are: TNF, tumor necrosis factor-; TNFR1, type-1 receptor for TNF; MI, mutated at the ICE-site; DISC, death-inducing signaling complex; CHX, cycloheximide; DSS, dextran sulfate sodium; DD, death domain; MEF, mouse embryo fibroblast; hTNF, human TNF; mTNF, mouse TNF; TUNEL, terminal dUTP nick-end labeling; PIPES, 1,4-piperazinediethanesulfonic acid; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; AMC, 7-amido-4-methylcoumarin); AFC, 7-amino-4-trifluoromethylcoumarin; fmk, fluoromethyl ketone; V-ATPase, vacuolar ATPase; siRNA small interfering RNA; FITC, fluorescein isothiocyanate; Baf, bafilomycin A1; FCCP, carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone; 3-MA, 3-methyladenine.
3 B. N. Chau and J. Y. J. Wang, unpublished results.
4 T.-T. Chen and J. Y. J. Wang, unpublished results.
5 I. C. Hunton and J. Y. J. Wang, unpublished results.
6 X. Huang, A. Masselli, S. M. Frisch, I. C. Hunton, Y. Jiang, and J. Y. J. Wang, unpublished results.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
