JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M705972200 on August 6, 2007

J. Biol. Chem., Vol. 282, Issue 40, 29574-29583, October 5, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/40/29574    most recent
M705972200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Noguchi, M.
Right arrow Articles by Nakao, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Noguchi, M.
Right arrow Articles by Nakao, K.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Genetic and Pharmacological Inhibition of Rho-associated Kinase II Enhances Adipogenesis*

Michio Noguchi{ddagger}, Kiminori Hosoda{ddagger}1, Junji Fujikura{ddagger}, Muneya Fujimoto{ddagger}, Hiroshi Iwakura{ddagger}, Tsutomu Tomita{ddagger}, Takako Ishii{ddagger}, Naoki Arai{ddagger}, Masakazu Hirata{ddagger}, Ken Ebihara{ddagger}, Hiroaki Masuzaki{ddagger}, Hiroshi Itoh{ddagger}, Shuh Narumiya§, and Kazuwa Nakao{ddagger}

From the {ddagger}Department of Medicine and Clinical Science, Kyoto University Graduate School of Medicine, Kyoto 606-8507, Japan and the §Department of Pharmacology, Kyoto University Faculty of Medicine, Kyoto 606-8501, Japan

Received for publication, July 20, 2007


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Rho-associated kinase (ROCK) regulates reorganization of actin cytoskeleton. During adipogenesis, the structure of filamentous actin is converted from long stress fibers to cortical actin, suggesting that the ROCK is involved in adipogenesis. Two ROCK isoforms have been identified: ROCK-I and ROCK-II. However, pharmacological inhibitors of ROCK cannot distinguish two ROCK isoforms. In the present study, we examined the role of ROCK in adipogenesis and actin cytoskeleton using genetic and pharmacological approaches. Y-27632, which inhibits the activity of both ROCK isoforms, enhanced adipogenesis through the up-regulation of adipogenic transcription factors in 3T3-L1 cells. Furthermore, Y-27632 restored inhibition of adipogenesis by lysophosphatidic acid, which activates Rho. Regarding actin cytoskeleton, Y-27632 disrupted stress fibers in 3T3-L1 preadipocytes. Next, we analyzed adipogenesis of mouse embryonic fibroblasts (MEFs) derived from ROCK-I and ROCK-II knock-out mice, respectively. Adipogenesis of ROCK-II (-/-) MEFs was markedly enhanced compared with wild-type MEFs while that of ROCK-I (-/-) MEFs was not. In contrast to pharmacological approaches, no obvious alteration was found in actin cytoskeleton of ROCK-II (-/-) MEFs compared with wild-type MEFs. In 3T3-L1 cells, knockdown of ROCK-II by RNA interference enhanced the expression of adipogenic transcription factors while that of ROCK-I did not. Moreover, Y-27632 inhibited IRS-1 serine phosphorylation and enhanced Akt phosphorylation in 3T3-L1 preadipocytes. Similarly, Akt phosphorylation in ROCK-II (-/-) MEFs was augmented compared with wild-type MEFs. In conclusion, inhibition of ROCK-II, not ROCK-I, enhances adipogenesis accompanied by the up-regulation of adipogenic transcription factors. Augmentation of insulin signaling may contribute to the enhancement of adipogenesis.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Adipogenesis is an area of intense interest because of the large and growing prevalence of obesity, insulin resistance, and type 2 diabetes (1, 2). Studies with in vitro models, such as 3T3-L1 and 3T3-F442A cell lines, have clarified the mechanisms of adipogenesis (3, 4). In 3T3-L1 cells, adipocyte differentiation is a process regulated by multiple transcription factors, principally the CCAAT/enhancer-binding protein (C/EBP)2 family and peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). In the presence of hormonal inducers, the expression of C/EBPbeta and C/EBP{delta} temporarily increases (5), followed by the expression of PPAR{gamma} and C/EBP{alpha} (6, 7). A cooperative interaction between PPAR{gamma} and C/EBP{alpha} drives the expression of genes that are necessary for the generation and maintenance of the adipogenic phenotype such as lipid accumulation and insulin sensitivity (8).

During adipogenesis, adipocytes morphologically change from fibroblastic cells to round and lipid-laden cells. It is well known that actin cytoskeleton regulates the morphology of the cells (9). Concerning adipogenesis and actin cytoskeleton, it has been reported that adipocyte differentiation results in the conversion of filamentous actin (F-actin) from stress fibers and lamellipodia to cortical actin structures (10).

During the past several decades, many studies have shed light on the molecular mechanisms of actin cytoskeletal regulation. Members of the Rho family are essential regulatory components of the signaling pathway that directs reorganization of actin cytoskeleton. Small GTPase Rho contributes to many cellular functions such as cell motility, adhesion, and cytokinesis through reorganization of actin cytoskeleton. Rho is activated by extracellular signals such as lysophosphatidic acid (LPA). The actions of Rho are mediated by downstream Rho effectors. One of these effectors is Rho-associated kinase (ROCK) (11, 12). Two ROCK isoforms have been identified: ROCK-I (also known as ROKbeta) and ROCK-II (also known as Rho kinase and ROK{alpha}) (13-16). ROCK mediates Rho signaling and reorganizes actin cytoskeleton through phosphorylation of several substrates that contribute to the assembly of actin filaments and contractility. Elucidation of the role of ROCK has been facilitated by the introduction of ROCK inhibitors, Y-27632 and fasudil. Studies with these inhibitors have revealed that ROCK regulates various physiological and pathological processes (17-20), while they cannot refer to the isoform-specific role of ROCK because ROCK inhibitors inhibit the activity of both ROCK-I and ROCK-II. Furthermore, ROCK inhibitors may potentially inhibit other protein kinases such as protein kinase A (12).


Figure 1
View larger version (49K):
[in this window]
[in a new window]

  		FIGURE 1.
ROCK expression and actin cytoskeleton during adipogenesis and effect of ROCK inhibitors on adipogenesis. A, equal amounts of proteins harvested from day 0 to day 8 were subjected to Western blot analysis using antibodies against ROCK-I and ROCK-II. B, 3T3-L1 preadipocytes and mature adipocytes were fixed, permeabilized, and stained with Oregon Green phalloidin for F-actin. Bar, 50 µm. C, differentiated adipocytes were fixed and stained with Oil Red O at day 8. Macroscopic and microscopic pictures of cells are shown. D, lipid accumulation was assessed by the quantification of A510 in destained Oil Red O with isopropyl alcohol. Data are expressed as mean ± S.E. from triplicate experiments. **, p < 0.01 (Student's t test) compared with dexamethasone and IBMX-treated group. Pio, pioglitazone, V, vehicle.

 
Several studies have reported that Rho-ROCK pathway is involved in adipogenesis (21, 22). However, the role of ROCK in adipogenesis still remains to be clarified. We show here the effects of inhibition of ROCK on adipogenesis and examine the molecular mechanisms using pharmacological and genetic approaches. Especially, the adipogenic analysis using MEFs derived from ROCK-I or ROCK-II knock-out mice and ROCK-I or ROCK-II siRNA can provide the evidence about the physiological role of ROCK and the isoform-specific role of ROCK in adipogenesis.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Y-27632 and pioglitazone (AD-4833) were provided by Mitsubishi Pharma (Osaka, Japan) and Takeda Pharmaceutical Company (Osaka, Japan), respectively. Insulin was purchased from Roche Applied Science (Mannheim, Germany). 3-Isobutyl-1-methylxanthine (IBMX) and dexamethasone were purchased from Nacalai Tesque, Inc. (Kyoto, Japan). LPA and wortmannin were obtained from Sigma-Aldrich (Tokyo, Japan). Fasudil was obtained from Calbiochem. Polyclonal antibodies against ROCK-I, ROCK-II, C/EBP{alpha}, C/EBP{delta}, PPAR{gamma}, and IRS-1 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Monoclonal antibodies against C/EBPbeta and adiponectin were obtained from Affinity BioReagents (Golden, CO). The monoclonal antibody against aP2 was purchased from R&D Systems (Minneapolis, MN). Polyclonal antibodies against Akt, phospho-Akt (Ser473), phospho-IRS-1 (Ser632/635), phospho-IRS-1 (Ser612), ERK1/2, phospho-ERK1/2, p38MAPK, and phospho-p38MAPK were purchased from Cell Signaling Technology Inc. (Beverly, MA). Horseradish peroxidase-conjugated anti-mouse, anti-rat, and anti-rabbit IgG antibodies and ECL plus Western detecting kit were purchased from Amersham Biosciences.

Cell Culture, Adipocyte Differentiation, and Oil Red O Staining—3T3-L1 cells (kindly provided by Dr. H. Green and Dr. M. Morikawa, Harvard Medical School, Boston, MA) were cultured and differentiated into adipocytes as described previously (23). Briefly, cells were grown for 2 days post-confluence (referred as day 0) in 10% CS/DMEM. Differentiation was induced with 10% FBS/DMEM containing 0.5 mM IBMX, 0.25 µM dexamethasone, and 1 µg/ml insulin for 2 days. The cells were then incubated in 10% FBS/DMEM with insulin for 2 days and maintained hereafter with 10% FBS/DMEM to day 8. Pioglitazone was dissolved in Me2SO and added to media within 0.1% of volume. The medium was changed every other day. At day 8, the cells were washed with phosphate-buffered saline (PBS) twice, fixed in 3.7% formaldehyde for 1 h and then stained with 0.6% (w/v) Oil Red O solution (60% isopropyl alcohol, 40% water) for 2 h at room temperature. Cells were then washed with water to remove unbound dye. Stained Oil Red O was eluted with isopropyl alcohol and quantified by measuring the optical absorbance at 510 nm (24).


Figure 2
View larger version (41K):
[in this window]
[in a new window]

  		FIGURE 2.
Effect of Y-27632 during 3T3-L1 adipogenesis. A, in the presence of dexamethasone and IBMX, 30 µMY-27632 was supplemented from day 0 to day 2, day 2 to day 4, day 0 to day 4, day 4 to day 8 or day 0 to day 8, respectively. Differentiated adipocytes were fixed and stained with Oil Red O at day 8. Macroscopic and microscopic pictures of cells are shown. B, lipid accumulation was assessed by the quantification of A510 in destained Oil Red O with isopropyl alcohol. Data are expressed as mean ± S.E. from triplicate experiments. *, p < 0.05 (Student's t test) compared with dexamethasone and IBMX-treated group. **, p < 0.01 (Student's t test) compared with dexamethasone and IBMX-treated group. C, relative cell number during adipogenesis. 10 µM or 30 µM Y-27632 was added from day 0 to day 4 in the presence of dexamethasone and IBMX. Proliferation of MEFs was assessed by counting cells at the indicated times. Data are expressed as mean ± S.E. from triplicate experiments.

 
Preparation of Primary Mouse Embryonic Fibroblasts and Induction of Adipogenesis—The generation of ROCK-I and ROCK-II knock-out mice was previously reported (25, 26). ROCK-II knock-out mice of a mixed background 129/Sv and C57BL/6N genetic background were backcrossed to the C57BL/6N strain for more than 8 generations. Primary MEFs were harvested from 13.5 d.p.c. embryos of each genotype as previously described (27). Differentiation of MEFs was induced with 0.5 mM IBMX, 0.25 µM dexamethasone and 10 µg/ml insulin for 6 days and maintained with 10% FBS/DMEM to day 8.

Small Interfering RNA (siRNA)—Synthetic siRNAs were purchased from Invitrogen (Carlsbad, CA). siRNAs were delivered into 3T3-L1 cells by a pulse of electroporation with Nucleofector (Amaxa, Gaithersburg, MD). After the electroporation, cells were immediately mixed with the fresh medium for 10 min and reseeded on plates for further examinations. The cells were differentiated 12 h after the electroporation. Negative control siRNA was used as the control of experiments. The targeted nucleotide sequences of the siRNAs were ATTGGTGCTTGTCAGTTAGGCGTGC (ROCK-I) and ATAATTACTCATAAGGTTGACGAGG (ROCK-II).

Preparation of Total Cell Lysates and Western Blot Analysis—Cells were washed twice with ice-cold PBS and harvested in a lysis buffer (40 mM HEPES, 10 mM EDTA, 100 mM NaF, 10 mM sodium pyrophosphate, 1 mM Na3VO4, 50 µM okadaic acid, 1% (v/v) Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, and 0.1 mg/ml aprotinin at pH 7.5). For the examination of transcription factors, cells were harvested in a lysis buffer (60 mM Tris-HCl and 1% SDS at pH 6.8). Lysates were heated at 100 °C for 10 min. After centrifugation, supernatants were normalized for protein concentration via the Bradford method and subjected to immunoblotting. For Western blot analysis, proteins were subjected to SDS-PAGE and electro-blotted to polyvinylidene fluoride membranes (Polyscreen, NEN Life Science Products, Inc., Boston, MA). Transferred membranes were blocked with Block Ace (Yukijirushi Nyugyo, Sapporo, Japan) and then incubated with the primary antibodies. After washing with PBS, membranes were reacted with secondary antibodies and developed with ECL plus as instructed by the manufacturer. The signal on the blot was detected and quantified with Lumino-Image Analyser LAS-1000 System (Fuji Photo Film Co., Tokyo, Japan).

Immunofluorescence Study—The cells were washed once with PBS and fixed as follows. 3T3-L1 cells were fixed first for 1 min with 4% formaldehyde and 0.1% Triton X in PBS and then for 15 min with 4% formaldehyde alone in PBS. The cells were permeabilized by washing in PBS containing 0.1% Triton X for 5 min and incubated with PBS containing 3% bovine serum albumin for 60 min at room temperature. F-actin was stained with Oregon Green phalloidin (Molecular Probes, Carlsbad, CA). Optical sections were obtained with a Carl Zeiss LSM5 Pascal.

Quantitative Real-time PCR—Total RNA was prepared using TRIzol Reagent (Invitrogen). For quantitative RT-PCR assay, cDNA was synthesized by iScript (Bio-Rad). To determine ROCK-I, ROCK-II, PPAR{gamma}, and C/EBP{alpha} mRNA levels, these probes and primers were employed. ROCK-I-specific primers, sense: 5'-AGGAAAATACAGGAACTGCAAAGTG-3', antisense: 5'-CTTTCTTGCTTTCCTGAGTCAACTC-3' and probe: 5'-GTCTTCCAGAATCCCTCGCGCCAGCT-3'; ROCK-II-specific primers, sense: 5'-AAGACAGCGACATTGAACAGC-3', antisense: 5'-ACCATCCTTCTAATCTTGATTCTGG-3' and probe: 5'-GATCCATCAGGCTCAGCATCGCC-3'; PPAR{gamma}-specific primers, sense: 5'-CCCAGAGCATGGTGCCTT-3', antisense: 5'-GGCATCTCTGTGTCAACCATGGT-3' and probe: 5'-CTGATGCACTGCCTATGAGCACTTCACA-3'; C/EBP{alpha}-specific primers, sense: 5'-CGCCTTCAACGACGAGTTC-3', antisense: 5'-TTGGCCTTCTCCTGCTGTC-3', and probe: 5'-TGGCCGACCTCTTCCAGCACAG-3'. TaqMan PCR was performed using ABI Prism 7300 Sequence Detection System as instructed by manufacturer (Applied Biosystems, Foster City, CA). Levels of mRNA were normalized to those of 18S mRNA.


Figure 3
View larger version (56K):
[in this window]
[in a new window]

  		FIGURE 3.
Effect of Y-27632 on protein expression of adipogenic genes. A, equal amounts of proteins harvested at day 4 were subjected to Western blot analysis using antibodies against PPAR{gamma}, C/EBP{alpha}, and beta-actin. B, equal amounts of proteins harvested at day 2 were subjected to Western blot analysis using antibodies against C/EBPbeta, C/EBP{delta}, and beta-actin. C, equal amounts of proteins harvested at day 0, 1, 2, 4, and 8 were subjected to Western blot analysis using antibodies against PPAR{gamma}, C/EBP{alpha}, C/EBPbeta, C/EBP{delta}, aP2, adiponectin, and beta-actin. beta-Actin proteins were monitored as hallmarks during adipocyte differentiation. Pio, pioglitazone. All data are representatives of at least three independent experiments.

 
Statistical Analysis—Data are presented as means ± S.E. Student's t test was used to compare with the control. Differences were accepted as significant at p < 0.05 level.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
ROCK Expression and Actin Cytoskeleton during Adipogenesis and Effect of ROCK Inhibitors on Adipogenesis—We detected protein expression of ROCK in 3T3-L1 cells by Western blot analysis (Fig. 1A). In 3T3-L1 preadipocytes (day 0) and mature adipocytes (day 8), both ROCK-I and ROCK-II were expressed. The expression levels of two ROCK isoforms did not significantly change during adipogenesis. Then, we observed actin cytoskeleton by phalloidin staining at preadipocytes and mature adipocytes. During adipogenesis, the structure of filamentous actin was converted from long stress fiber (preadipocyte) to cortical actin (mature adipocyte), suggesting that Rho-ROCK pathway is involved in adipogenesis (Fig. 1B). To examine the effects of ROCK inhibitors on adipogenesis, 3T3-L1 cells were exposed to 1 µM, 10 µM, 30 µM Y-27632, 10 µM fasudil, 1 µM pioglitazone, and 1 µg/ml insulin, respectively in the presence of dexamethasone and IBMX. Y-27632, fasudil, or pioglitazone was added to media from day 0 to day 8. Insulin was added to media from the start of differentiation (day 0) to day 4. At day 8, we evaluated the lipid accumulation by Oil Red O staining (Fig. 1, C and D). Y-27632 enhanced lipid accumulation in a dose-dependent manner. Y-27632 or fasudil-treated dishes accumulated lipid droplets markedly compared with vehicle-treated dishes, indicating that ROCK inhibitors enhance adipogenesis. Consistent with previous reports (28-30), insulin and pioglitazone enhanced lipid accumulation, respectively. Then, to determine when the ROCK inhibitor principally affects adipogenesis, 30 µM Y-27632 was added in various periods of 3T3-L1 adipogenesis stimulated by dexamethasone and IBMX (Fig. 2, A and B). The exposure of 30 µM Y-27632 during days 0-4 fully enhanced lipid accumulation, while during days 4-8, Y-27632 did not enhance it at all. In cases of days 0-2 and 2-4, Y-27632 partially enhanced lipid accumulation. Treatment with 10 µM or 30 µM Y-27632 did not significantly alter total cell number during adipogenesis compared with vehicle treatment (Fig. 2C).

Effect of Y-27632 on the Expression of Adipogenic Genes—Because ROCK inhibitors enhanced lipid accumulation, we examined the expression of adipogenic transcription factors C/EBPbeta and C/EBP{delta} at day 2, and C/EBP{alpha} and PPAR{gamma} at day 4 by Western blot analysis (Fig. 3, A and B). In the presence of dexamethasone and IBMX, Y-27632 with a concentration of 30 µM augmented the expression of C/EBPbeta (~1.8-fold increase), C/EBP{alpha} (~6.5-fold increase) and PPAR{gamma} (~5.6-fold increase) while it suppressed that of C/EBP{delta} (~40% decrease) compared with the non-treated group. 1 µg/ml insulin did not affect the expression of C/EBPbeta and C/EBP{delta} at day 2 while it enhanced that of C/EBP{alpha} and PPAR{gamma} at day 4. 1 µM pioglitazone augmented the expression of C/EBPbeta and C/EBP{alpha} while it suppressed those of C/EBP{delta} and PPAR{gamma}. The effects of insulin and pioglitazone on the expression of adipogenic trasnscription factors were compatible with previous reports (29, 31). Furthermore, we examined protein expression of adipogenic genes during the course of differentiation; day 0, day 1, day 2, day 4, and day 8 (Fig. 3C). Compared with the vehicle treatment group, 30 µM Y-27632 enhanced the expression of adipogenic transcription factors: C/EBPbeta (~1.7-fold increase, day 1), PPAR{gamma} (~5.2-fold increase, day 4), and C/EBP{alpha} (~11.7-fold increase, day 4) and adipogenic late markers: aP2 (~8.9-fold increase, day 4) and adiponectin (~8.1-fold increase, day 4). Also in this analysis, Y-27632 suppressed the expression of C/EBP{delta} (~31% decrease, day 2).


Figure 4
View larger version (59K):
[in this window]
[in a new window]

  		FIGURE 4.
Effect of LPA and Y-27632 on actin cytoskeleton and adipogenesis of 3T3-L1 preadipocytes. A, 3T3-L1 cells were treated or not treated with 30 µM Y-27632 for 2 h, then exposed to 10 µM LPA for 0 and 5 min. The cells were fixed, permeabilized, and stained with Oregon Green phalloidin for F-actin. Bar, 50 µm. B, differentiated adipocytes were fixed and stained with Oil Red O at day 8. Macroscopic and microscopic pictures of cells are shown. C, lipid accumulation was assessed by the quantification of A510 in destained Oil Red O with isopropyl alcohol. Data are expressed as mean ± S.E. from triplicate experiments. *, p < 0.05 (Student's t test) compared with DMI-treated group. **, p < 0.01 (Student's t test) compared with DMI-treated group. #, p < 0.01 (Student's t test) compared with 10 µM LPA-treated group. DMI, dexamethasone, IBMX, and insulin.

 
Effect of LPA and Y-27632 on Actin Cytoskeleton and Adipogenesis—LPA activates small GTPase Rho via specific G protein-coupled receptors: LPA1-4 (32). It has been reported that LPA induces the stress fiber formation in Swiss 3T3 fibroblast, which is inhibited by Y-27632 (33, 34). Therefore, we examined the regulation of actin cytoskeleton by LPA and Y-27632 in 3T3-L1 preadipocytes (Fig. 4A). We stimulated serum-starved 3T3-L1 preadipocytes with or without 10 µM LPA after the pretreatment of 30 µM Y-27632 or non-treatment and assessed the effects on actin cytoskeleton by staining cells with phalloidin. LPA addition to serum-starved 3T3-L1 cells spread the cells and induced stress fibers while this change was inhibited by Y-27632. In Y-27632-treated cells without LPA addition, we could not observe stress fibers or thick actin rim in the cell periphery.

We examined the effects of Y-27632 on LPA-treated 3T3-L1 cells by Oil Red O staining. LPA and Y-27632 were added to media from day 0 to day 8. In the presence of dexamethasone, IBMX, and insulin, 10 µM Y-27632 enhanced adipogenesis (~20% increase) while 30 µM LPA inhibited it (~32% decrease), consistent with a previous report in 3T3-F442A cells (32). In 3T3-L1 cells, LPA inhibited adipogenesis in a dose-dependent manner with concentrations of 1 µM, 10 µM, and 30 µM. Y-27632 completely restored its inhibition with concentrations of 10 µM and 30 µM (Fig. 4, B and C).

Adipogenesis of ROCK-II (-/-) and ROCK-I (-/-) MEFs—To establish more directly causal link between ROCK and adipogenesis, primary mouse embryonic fibroblasts (MEFs) prepared from ROCK-II (+/+), ROCK-II (+/-), ROCK-II (-/-), and ROCK-I (+/+), ROCK-I (+/-), ROCK-I (-/-) mice were subjected to the adipogenic induction culture. Disruption of ROCK-I and ROCK-II protein was confirmed by Western blot analysis (Figs. 5B and 6B). ROCK-II protein levels in ROCK-I (+/+), ROCK-I (+/-), and ROCK-I (-/-) mice did not differ between genotypes. Similarly, ROCK-I protein levels in ROCK-II (+/+), (+/-), and (-/-) mice did not differ between genotypes. These results show that there is no compensatory increase in expression of the other ROCK isoform. After adipogenic induction, we examined lipid accumulation by Oil Red O staining and the expression of adipogenic transcription factors by Taqman PCR at day 8. ROCK-II (-/-) MEFs exhibited the enhancement of lipid accumulation compared with wild-type MEFs and mRNA levels of PPAR{gamma} and C/EBP{alpha} were markedly enhanced compared with wild-type MEFs (~14.2-fold and ~6.2-fold increase, respectively; **, p < 0.01). ROCK-II (+/-) MEFs also exhibited the enhancement of lipid accumulation compared with wild-type MEFs and mRNA levels of PPAR{gamma} and C/EBP{alpha} were significantly enhanced compared with wild-type MEFs (~5.4-fold and ~4.4-fold increase, respectively; **, p < 0.01). 30 µM Y-27632 did not enhance lipid accumulation in ROCK-II (-/-) MEFs, significantly (Fig. 5, A, C, and D). Before adipogenic induction, the architecture of actin cytoskeleton in ROCK-II (-/-) MEFs did not change compared with wild-type MEFs (Fig. 5E). The percentage of stress fiber positive cells was not significantly altered ((+/+), 96.67 ± 3.33%; (+/-), 97.22 ± 2.77%; (-/-), 97.1 ± 1.5%). In ROCK-I (-/-) MEFs, adipogenesis was not significantly enhanced compared with wild-type MEFs. Lipid accumulation and mRNA levels of PPAR{gamma} and C/EBP{alpha} did not differ between each genotype. Furthermore, 30 µM Y-27632 enhanced lipid accumulation in ROCK-I (-/-) MEFs (Fig. 6, A, C, and D).


Figure 5
View larger version (57K):
[in this window]
[in a new window]

  		FIGURE 5.
Adipogenesis of ROCK-II (-/-) MEFs. A, differentiated MEFs were fixed and stained with Oil Red O at day 8. Macroscopic and microscopic pictures of cells are shown. 30 µM Y-27632 was supplemented in the differentiation medium of ROCK-II (-/-) MEFs. B, equal amounts of proteins were subjected to Western blot analysis using antibodies against ROCK-I, ROCK-II, and beta-tubulin. C, lipid accumulation was assessed by the quantification of A510 in destained Oil Red O with isopropyl alcohol. Data are expressed as mean ± S.E. from triplicate experiments. **, p < 0.01 (Student's t test) compared with ROCK-II (+/+) MEFs. D, expression of mRNA for PPAR{gamma} and C/EBP{alpha} from ROCK-II (+/+), (+/-) and (-/-) MEFs. Data are expressed as mean ± S.E. **, p < 0.01 (Student's t test) compared with ROCK-II (+/+) MEFs. n = 6 in each group. E, actin cytoskeleton of MEFs. Before adipogenic induction, the cells were fixed, permeabilized, and stained with Oregon Green phalloidin for F-actin. Bar, 50 µm.

 


Figure 6
View larger version (38K):
[in this window]
[in a new window]

  		FIGURE 6.
Adipogenesis of ROCK-I (-/-) MEFs. A, differentiated MEFs were fixed and stained with Oil Red O at day 8. Macroscopic and microscopic pictures of cells are shown. 30 µM Y-27632 was supplemented in the differentiation medium of ROCK-I (-/-) MEFs. B, equal amounts of proteins were subjected to Western blot analysis using antibodies against ROCK-I, ROCK-II, and beta-tubulin. C, lipid accumulation was assessed by the quantification of A510 in destained Oil Red O with isopropyl alcohol. Data are expressed as mean ± S.E. from triplicate experiments. **, p < 0.01 (Student's t test) compared with ROCK-I (+/+) MEFs. D, expression of mRNA for PPAR{gamma} and C/EBP{alpha} from ROCK-I (+/+), (+/-), and (-/-) MEFs. Data are expressed as mean ± S.E. N.S., not significant. n = 6 in each group.

 
Effect of Knockdown of ROCK on Expression of Adipogenic Transcription Factors—To determine whether inhibition of ROCK-II enhances adipogenesis in 3T3-L1 cells, we examined the effect of ROCK-I or ROCK-II knockdown on 3T3-L1 adipogenesis using siRNA technique. We introduced siRNA targeted for ROCK-I or ROCK-II into 3T3-L1 preadipocytes. 3T3-L1 cells were differentiated 12 h after introduction of siRNA. We confirmed the knockdown of ROCK-I or ROCK-II expression by Western blot analysis at day 2. Compared with the negative control group, introduction of ROCK-I and ROCK-II siRNA resulted in ~96 and ~86% decrease, respectively (Fig. 7, A and B). There was no obvious compensatory increase of the expression of the other ROCK isoform. At day 3, we examined the expression of adipogenic transcription factors by quantitative RT-PCR. ROCK-II siRNA enhanced the expression of PPAR{gamma} and C/EBP{alpha} compared with the control (~2.1-fold and ~1.8-fold increase, respectively, **, p < 0.01) (Fig. 7C). ROCK-I siRNA did not enhance the expression of PPAR{gamma} and C/EBP{alpha} significantly (Fig. 7D).

Effect of Inhibition of ROCK on Intracellular Signaling Pathway—We addressed the mechanisms of downstream signaling of Rho-ROCK. It is known that ROCK directly associates with IRS-1 and phosphorylates its serine residues (35-37). We stimulated serum-starved 3T3-L1 preadipocytes with insulin after the pretreatment of Y-27632. 30 µM Y-27632 inhibited insulin-induced IRS-1 Ser612 (~35% decrease, **, p < 0.01) and IRS-1 Ser632/635 (~36% decrease, **, p < 0.01) phosphorylation and markedly enhanced insulin-induced Akt phosphorylation (~3.6-fold increase, **, p < 0.01) compared with non-treated groups (Fig. 8, A and C). Regarding MAPK signaling, Y-27632 slightly enhanced p38MAPK phosphorylation (~1.1-fold increase) and inhibited ERK1/2 phosphorylation (~23% decrease) upon the stimulation of insulin (Fig. 8B). We examined whether an inhibitor of PI3-kinase, wortmannin, blocks the enhancement of 3T3-L1 adipogenesis induced by Y-27632. Wortmannin and Y-27632 were added to media from day 0 to day 8. Wortmannin with concentrations of 100 nM and 1 µM inhibited the enhancement of preadipocyte differentiation induced by 10 µM Y-27632 in the presence of dexamethasone and IBMX (Fig. 8D). We examined insulin-induced Akt phosphorylation in ROCK-II knock-out MEFs. In ROCK-II (-/-) and (+/-) MEFs, insulin-induced Akt phosphorylation was significantly enhanced compared with wild-type MEFs (5 min after stimulation; ~6.0-fold increase and ~2.8-fold increase, respectively, **, p < 0.01) (Fig. 9A). In ROCK-I MEFs, there is no significant difference in insulin-induced Akt phosphorylation between each genotype (Fig. 9B).


Figure 7
View larger version (42K):
[in this window]
[in a new window]

  		FIGURE 7.
Effect of knockdown of ROCK-I or ROCK-II on 3T3-L1 adipogenesis by RNA interference. A, ROCK-II protein level was determined 48 h after adipogenic induction by Western blot analysis using antibodies against ROCK-II and beta-tubulin. B, ROCK-I protein level was determined 48 h after adipogenic induction by Western blot analysis using antibodies against ROCK-I and beta-tubulin. C, expression of mRNA for PPAR{gamma}, C/EBP{alpha}, and ROCK-II harvested at day 3. Data are expressed as mean ± S.E. **, p < 0.01 (Student's t test) compared with a negative control. n = 6 in each group. D, expression of mRNA for PPAR{gamma}, C/EBP{alpha}, and ROCK-I harvested at day 3. Data are expressed as mean ± S.E. N.S., not significant. NC, negative control. n = 6 in each group.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
In the present study, we show that inhibition of ROCK enhances adipogenesis. It is impossible to determine the isoform-specific role of ROCK by treatment of ROCK inhibitors. In addition to pharmacological approaches, we examined the adipogenesis of both ROCK-I (-/-) MEFs and ROCK-II (-/-) MEFs. Furthermore, we examined the effects of knock-down of ROCK-I or ROCK-II on 3T3-L1 adipogenesis by RNA interference. To the best of our knowledge, this is the first study demonstrating that inhibition of ROCK-II enhances adipogenesis and insulin-induced Akt phosphorylation. Our results suggest that ROCK-II plays an important role in adipogenesis and insulin signaling.

We examined the ROCK expression in 3T3-L1 cells by Western blot analysis. Both ROCK isoforms are expressed during the course of adipogenesis. A previous study showed that ROCK-II was expressed in 3T3-L1 mature adipocytes (36) while the expression of ROCK-I has not been reported.

Next, we examined the effects of ROCK inhibitors on lipid accumulation in 3T3-L1 cells. We found that two ROCK inhibitors, Y-27632 and fasudil, enhance lipid accumulation, respectively. These findings suggest that inhibition of ROCK enhances adipogenesis. We also assessed when Y-27632 affects adipogenesis. Supplementation with Y-27632 during days 0-4 fully enhances adipogenesis. These results let us speculate that inhibition of ROCK enhances the expression of adipogenic transcription factors. As expected, Y-27632 enhances the expression of adipogenic transcription factors, C/EBPbeta, C/EBP{alpha}, and PPAR{gamma} in the presence of dexamethasone and IBMX, which indicates that inhibition of ROCK enhances adipogenesis through the up-regulation of adipogenic transcription factors. Following this, Y-27632 enhances the expression of adipogenic late markers, such as aP2 and adiponectin.

We assessed the effects of LPA and Y-27632 on adipogenesis and actin cytoskeleton. Because the Rho-ROCK pathway regulates actin cytoskeleton, we examined the effects of LPA and Y-27632 on actin cytoskeleton with phalloidin staining. We showed that stress fiber formation is augmented by LPA and that it is inhibited by Y-27632 in 3T3-L1 preadipocytes. These results provide the evidence that LPA activates the Rho-ROCK pathway and Y-27632 inhibits the pathway. Then, we showed that LPA inhibits adipogenesis in 3T3-L1 cells consistent with a previous report in 3T3-F442A cells. Furthermore, we showed that Y-27632 restores its inhibition in a dose-dependent manner. These results indicate that the Rho-ROCK pathway plays an important role in adipogenesis.

To determine the isoform-specific role of ROCK and to entirely exclude the nonspecific effects of ROCK inhibitors, we examined adipogenesis of ROCK-I (-/-) and ROCK-II (-/-) MEFs. We demonstrated that targeted disruption of ROCK-II enhances adipogenesis and that, in contrast, that of ROCK-I does not enhance adipogenesis. Furthermore, Y-27632 enhances lipid accumulation in ROCK-I (-/-) MEFs and does not enhance lipid accumulation in ROCK-II (-/-) MEFs. It suggests that inhibition of endogenous ROCK-II enhances adipogenesis. In 3T3-L1 cells, we examined the effect of knockdown of ROCK-I or ROCK-II on adipogenesis using siRNA. We showed that ROCK-II siRNA enhances the expression of adipogenic transcription factors while ROCK-I siRNA does not enhance it. Taken together, our results from the pharmacological and genetic approaches indicate that inhibition of ROCK, especially ROCK-II, enhances adipogenesis.

We investigated the mechanisms of the enhancement of adipogenesis by inhibition of ROCK. We demonstrated that Y-27632 inhibits IRS-1 serine phosphorylation and markedly enhances Akt phosphorylation upon the stimulation of insulin in 3T3-L1 preadipocytes. Previously, it has been reported that insulin/IGF-1 signaling is required for adipogenesis. MEFs derived from IRS-1 (-/-) mice do not have enough differentiation properties (27). IRS-1 and IRS-3 double knock-out mice exhibit lipodystrophy (38). Constitutively active Akt causes spontaneous differentiation in 3T3-L1 cells (39). Furthermore, we also demonstrated that an inhibitor of PI3-kinase, wortmannin, blocks the enhancement of adipogenesis induced by Y-27632. Therefore, augmentation of insulin signaling may contribute to the enhancement of preadipocyte differentiation. Concerning MAPK signaling, we showed that Y-27632 slightly enhances p38MAPK phosphorylation and slightly inhibits ERK1/2 phosphorylation in this cell line. Regarding ERK1/2 and p38MAPK, a great deal of evidence about the molecular link between MAPK and adipogenesis has been accumulating (40-45). However, their roles in adipogenesis are still controversial. In addition to pharmacological approaches, we showed that in ROCK-II (-/-) MEFs and even in ROCK-II (+/-) MEFs, insulin-induced Akt phosphorylation is enhanced compared with that in wild-type MEFs while in ROCK-I MEFs, there is no significant difference in insulin-induced Akt phosphorylation between each genotype. It provides the direct evidence that loss of ROCK-II enhances insulin-induced Akt phosphorylation.


Figure 8
View larger version (51K):
[in this window]
[in a new window]

  		FIGURE 8.
Effect of inhibition of ROCK on intracellular signaling pathway in 3T3-L1 cells. A, effect of Y-27632 on insulin signaling pathway. 3T3-L1 preadipocytes were stimulated with 10 nM insulin for 15 min or 100 nM insulin for 5 min in the absence or presence of 30 µM Y-27632. Western blot analysis was performed using antibodies against phospho-IRS-1 (Ser632/635), phospho-IRS-1 (Ser612), IRS-1, phospho-Akt (Ser473), and Akt. All data are representatives of at least three independent experiments. B, effect of Y-27632 on MAPK signaling pathway. 3T3-L1 preadipocytes were stimulated with 100 nM insulin for 5 min in the absence or presence of 30 µM Y-27632. Western blot analysis was performed using antibodies against phospho-ERK1/2, ERK1/2, phospho-p38MAPK and p38MAPK. All data are representatives of at least three independent experiments. C, quantification of IRS-1 Ser632/635 phosphorylation, IRS-1 Ser612 phosphorylation, and Akt phosphorylation. Phosphorylation level was normalized to total IRS-1 or total Akt level. Data are expressed as mean ± S.E. from triplicate experiments. **, p < 0.01 (Student's t test) compared with insulin-stimulated group without Y-27632. Open bars are treated without Y-27632. D, effect of wortmannin on the enhancement of 3T3-L1 adipogenesis induced by Y-27632. Differentiated adipocytes were fixed and stained with Oil Red O at day 8. Macroscopic and microscopic pictures of cells are shown.

 
Regarding the ROCK and insulin signaling, we showed that a ROCK inhibitor reduces IRS-1 serine phosphorylation and increases Akt phosphorylation in 3T3-L1 preadipocytes. It is known that ROCK directly associates with IRS-1 and phosphorylates its serine residues (35-37). In addition, previous studies have reported that IRS-1 serine phosphorylation negatively regulates insulin signaling in vascular smooth muscle cells (37) and NIH3T3 fibroblasts (46). However, recently, it has been reported that ROCK phosphorylates IRS-1 serine residues and positively regulates insulin signaling in 3T3-L1 mature adipocytes (36). The discrepancy between these reports shows that IRS-1 serine phosphorylation regulates insulin signaling differently depending on cell types. Therefore, there could be a difference in the regulation of insulin signaling by IRS-1 serine phosphorylation between preadipocytes and mature adipocytes.

Adipogenic analysis of both ROCK-I (-/-) and ROCK-II (-/-) MEFs revealed that loss of ROCK-II, not ROCK-I, enhances adipogenesis. The isoform-specific role of ROCK has been still obscure both in vitro and in vivo. As previously reported, loss of ROCK-I results in the eyelid open at birth (EOB) and omphalocele, while loss of ROCK-II results in placental dysfunction, intrauterine growth retardation, and fetal death. However, recently it has been reported that ROCK-II knock-out mice backcrossed in the C57BL6/N background exhibit not only the placental phenotype but also EOB and omphalocele (47). Concerning actin cytoskeletal regulation, it suggests that ROCK-I and ROCK-II cooperatively regulate actin bundle assembly required for eyelid and ventral body wall closure. In this context, our findings that inhibition of ROCK-II, not ROCK-I, enhances adipogenesis is a novel isoform-specific role of ROCK.


Figure 9
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 9.
Effect of knock-out of ROCK on insulin-induced Akt phosphorylation in MEFs. A, insulin-induced Akt phosphorylation in ROCK-II (-/-) MEFs. ROCK-II (+/+), (+/-), and (-/-) MEFs were stimulated with 100 nMinsulin for 5 min after serum starvation. Western blot analysis was performed using antibodies against phospho-Akt (Ser473) and Akt. All data are representatives of at least three independent experiments. Quantification of insulin-induced Akt phosphorylation. Phospho-Akt level was normalized to total Akt level. Data are expressed as mean ± S.E. from triplicate experiments. **, p < 0.01 (Student's t test) compared with ROCK-II (+/+) MEFs. B, insulin-induced Akt phosphorylation in ROCK-I (-/-) MEFs. ROCK-I (+/+), (+/-), and (-/-) MEFs were stimulated with 100 nM insulin for 15 min after serum starvation. Western blot analysis was performed using antibodies against phospho-Akt (Ser473) and Akt. All data are representatives of at least three independent experiments. Quantification of insulin-induced Akt phosphorylation. Phospho-Akt level was normalized to total Akt level. Data are expressed as mean ± S.E. from triplicate experiments. N.S., not significant.

 
In summary, the present study first provides the robust and direct evidence that inhibition of ROCK-II enhances adipogenesis accompanied by the up-regulation of adipogenic transcription factors and that inhibition of ROCK-II enhances insulin-induced Akt phosphorylation. These results indicate that inhibition of ROCK-II enhances adipogenesis, at least in part, via augmentation of insulin signaling. Finally, these findings raise the possibility that ROCK-II is a novel target for the treatment of obesity, insulin resistance, and type 2 diabetes.


   FOOTNOTES
 
* This work was supported by research grants from the Japanese Ministry of Education, Culture, Sports, Science, and Technology and the Japanese Ministry of Health, Labor and Welfare. This work was also supported in part by a grant from the Smoking Research Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Dept. of Medicine and Clinical Science, Kyoto University Graduate School of Medicine, 54 Shogoin Kawahara-cho, Sakyo-ku, Kyoto 606-8507, Japan. Tel.: 81-75-751-3172; Fax: 81-75-771-9452; E-mail: kh{at}kuhp.kyoto-u.ac.jp.

2 The abbreviations used are: C/EBP, CCAAT/enhancer-binding protein; IRS, insulin receptor substrate; ERK, extracellular signal-related kinase; MAPK, mitogen-activated protein kinase; CS, calf serum; FBS, fetal bovine serum; DMEM, Dulbecco's modified Eagle medium; BSA, bovine serum albumin; PI3K, phosphatidylinositol 3-kinase; IGF-1, insulin-like growth factor-1; ROCK, Rho-associated kinase; PPAR{gamma}, proliferator-activated receptor {gamma}; LPA, lysophosphatidic acid. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Spiegelman, B. M., and Flier, J. S. (2001) Cell 104, 531-543[CrossRef][Medline] [Order article via Infotrieve]
  2. Flier, J. S. (2004) Cell 116, 337-350[CrossRef][Medline] [Order article via Infotrieve]
  3. Hwang, C. S., Loftus, T. M., Mandrup, S., and Lane, M. D. (1997) Annu. Rev. Cell Dev. Biol. 13, 231-259[CrossRef][Medline] [Order article via Infotrieve]
  4. Rosen, E. D., and Spiegelman, B. M. (2000) Annu. Rev. Cell Dev. Biol. 16, 145-171[CrossRef][Medline] [Order article via Infotrieve]
  5. Cao, Z., Umek, R. M., and McKnight, S. L. (1991) Genes Dev. 5, 1538-1552[Abstract/Free Full Text]
  6. Tontonoz, P., Hu, E., Graves, R. A., Budavari, A. I., and Spiegelman, B. M. (1994) Genes Dev. 8, 1224-1234[Abstract/Free Full Text]
  7. Lane, M. D., Tang, Q. Q., and Jiang, M. S. (1999) Biochem. Biophys. Res. Commun. 266, 677-683[CrossRef][Medline] [Order article via Infotrieve]
  8. Wu, Z., Rosen, E. D., Brun, R., Hauser, S., Adelmant, G., Troy, A. E., McKeon, C., Darlington, G. J., and Spiegelman, B. M. (1999) Mol. Cell 3, 151-158[CrossRef][Medline] [Order article via Infotrieve]
  9. Jaffe, A. B., and Hall, A. (2005) Annu. Rev. Cell Dev. Biol. 21, 247-269[CrossRef][Medline] [Order article via Infotrieve]
  10. Kanzaki, M., and Pessin, J. E. (2001) J. Biol. Chem. 276, 42436-42444[Abstract/Free Full Text]
  11. Etienne-Manneville, S., and Hall, A. (2002) Nature 420, 629-635[CrossRef][Medline] [Order article via Infotrieve]
  12. Riento, K., and Ridley, A. J. (2003) Nat. Rev. Mol. Cell. Biol. 4, 446-456[CrossRef][Medline] [Order article via Infotrieve]
  13. Leung, T., Chen, X. Q., Manser, E., and Lim, L. (1996) Mol. Cell. Biol. 16, 5313-5327[Abstract]
  14. Leung, T., Manser, E., Tan, L., and Lim, L. (1995) J. Biol. Chem. 270, 29051-29054[Abstract/Free Full Text]
  15. Ishizaki, T., Maekawa, M., Fujisawa, K., Okawa, K., Iwamatsu, A., Fujita, A., Watanabe, N., Saito, Y., Kakizuka, A., Morii, N., and Narumiya, S. (1996) EMBO J. 15, 1885-1893[Medline] [Order article via Infotrieve]
  16. Matsui, T., Amano, M., Yamamoto, T., Chihara, K., Nakafuku, M., Ito, M., Nakano, T., Okawa, K., Iwamatsu, A., and Kaibuchi, K. (1996) EMBO J. 15, 2208-2216[Medline] [Order article via Infotrieve]
  17. Uehata, M., Ishizaki, T., Satoh, H., Ono, T., Kawahara, T., Morishita, T., Tamakawa, H., Yamagami, K., Inui, J., Maekawa, M., and Narumiya, S. (1997) Nature 389, 990-994[CrossRef][Medline] [Order article via Infotrieve]
  18. Itoh, K., Yoshioka, K., Akedo, H., Uehata, M., Ishizaki, T., and Narumiya, S. (1999) Nat. Med. 5, 221-225[CrossRef][Medline] [Order article via Infotrieve]
  19. Shimokawa, H., Seto, M., Katsumata, N., Amano, M., Kozai, T., Yamawaki, T., Kuwata, K., Kandabashi, T., Egashira, K., Ikegaki, I., Asano, T., Kaibuchi, K., and Takeshita, A. (1999) Cardiovasc. Res. 43, 1029-1039[Abstract/Free Full Text]
  20. Sawada, N., Itoh, H., Ueyama, K., Yamashita, J., Doi, K., Chun, T. H., Inoue, M., Masatsugu, K., Saito, T., Fukunaga, Y., Sakaguchi, S., Arai, H., Ohno, N., Komeda, M., and Nakao, K. (2000) Circulation 101, 2030-2033[Abstract/Free Full Text]
  21. Sordella, R., Jiang, W., Chen, G. C., Curto, M., and Settleman, J. (2003) Cell 113, 147-158[CrossRef][Medline] [Order article via Infotrieve]
  22. McBeath, R., Pirone, D. M., Nelson, C. M., Bhadriraju, K., and Chen, C. S. (2004) Dev. Cell 6, 483-495[CrossRef][Medline] [Order article via Infotrieve]
  23. Frost, S. C., and Lane, M. D. (1985) J. Biol. Chem. 260, 2646-2652[Abstract/Free Full Text]
  24. Ramirez-Zacarias, J. L., Castro-Munozledo, F., and Kuri-Harcuch, W. (1992) Histochemistry 97, 493-497[CrossRef][Medline] [Order article via Infotrieve]
  25. Shimizu, Y., Thumkeo, D., Keel, J., Ishizaki, T., Oshima, H., Oshima, M., Noda, Y., Matsumura, F., Taketo, M. M., and Narumiya, S. (2005) J. Cell Biol. 168, 941-953[Abstract/Free Full Text]
  26. Thumkeo, D., Keel, J., Ishizaki, T., Hirose, M., Nonomura, K., Oshima, H., Oshima, M., Taketo, M. M., and Narumiya, S. (2003) Mol. Cell. Biol. 23, 5043-5055[Abstract/Free Full Text]
  27. Miki, H., Yamauchi, T., Suzuki, R., Komeda, K., Tsuchida, A., Kubota, N., Terauchi, Y., Kamon, J., Kaburagi, Y., Matsui, J., Akanuma, Y., Nagai, R., Kimura, S., Tobe, K., and Kadowaki, T. (2001) Mol. Cell. Biol. 21, 2521-2532[Abstract/Free Full Text]
  28. Sandouk, T., Reda, D., and Hofmann, C. (1993) Am. J. Physiol. 264, C1600-C1608[Medline] [Order article via Infotrieve]
  29. Norisada, N., Masuzaki, H., Fujimoto, M., Inoue, G., Hosoda, K., Hayashi, T., Watanabe, M., Muraoka, S., Yoneda, F., and Nakao, K. (2004) Metabolism 53, 1532-1537[CrossRef][Medline] [Order article via Infotrieve]
  30. Kletzien, R. F., Clarke, S. D., and Ulrich, R. G. (1992) Mol. Pharmacol. 41, 393-398[Abstract]
  31. Rosen, E. D., Walkey, C. J., Puigserver, P., and Spiegelman, B. M. (2000) Genes Dev. 14, 1293-1307[Free Full Text]
  32. Simon, M. F., Daviaud, D., Pradere, J. P., Gres, S., Guigne, C., Wabitsch, M., Chun, J., Valet, P., and Saulnier-Blache, J. S. (2005) J. Biol. Chem. 280, 14656-14662[Abstract/Free Full Text]
  33. Tsuji, T., Ishizaki, T., Okamoto, M., Higashida, C., Kimura, K., Furuyashiki, T., Arakawa, Y., Birge, R. B., Nakamoto, T., Hirai, H., and Narumiya, S. (2002) J. Cell Biol. 157, 819-830[Abstract/Free Full Text]
  34. Ridley, A. J., and Hall, A. (1992) Cell 70, 389-399[CrossRef][Medline] [Order article via Infotrieve]
  35. Farah, S., Agazie, Y., Ohan, N., Ngsee, J. K., and Liu, X. J. (1998) J. Biol. Chem. 273, 4740-4746[Abstract/Free Full Text]
  36. Furukawa, N., Ongusaha, P., Jahng, W. J., Araki, K., Choi, C. S., Kim, H. J., Lee, Y. H., Kaibuchi, K., Kahn, B. B., Masuzaki, H., Kim, J. K., Lee, S. W., and Kim, Y. B. (2005) Cell Metab. 2, 119-129[CrossRef][Medline] [Order article via Infotrieve]
  37. Begum, N., Sandu, O. A., Ito, M., Lohmann, S. M., and Smolenski, A. (2002) J. Biol. Chem. 277, 6214-6222[Abstract/Free Full Text]
  38. Laustsen, P. G., Michael, M. D., Crute, B. E., Cohen, S. E., Ueki, K., Kulkarni, R. N., Keller, S. R., Lienhard, G. E., and Kahn, C. R. (2002) Genes Dev. 16, 3213-3222[Abstract/Free Full Text]
  39. Kohn, A. D., Summers, S. A., Birnbaum, M. J., and Roth, R. A. (1996) J. Biol. Chem. 271, 31372-31378[Abstract/Free Full Text]
  40. Belmonte, N., Phillips, B. W., Massiera, F., Villageois, P., Wdziekonski, B., Saint-Marc, P., Nichols, J., Aubert, J., Saeki, K., Yuo, A., Narumiya, S., Ailhaud, G., and Dani, C. (2001) Mol. Endocrinol. 15, 2037-2049[Abstract/Free Full Text]
  41. Benito, M., Porras, A., Nebreda, A. R., and Santos, E. (1991) Science 253, 565-568[Abstract/Free Full Text]
  42. Camp, H. S., and Tafuri, S. R. (1997) J. Biol. Chem. 272, 10811-10816[Abstract/Free Full Text]
  43. Engelman, J. A., Lisanti, M. P., and Scherer, P. E. (1998) J. Biol. Chem. 273, 32111-32120[Abstract/Free Full Text]
  44. Hu, E., Kim, J. B., Sarraf, P., and Spiegelman, B. M. (1996) Science 274, 2100-2103[Abstract/Free Full Text]
  45. Prusty, D., Park, B. H., Davis, K. E., and Farmer, S. R. (2002) J. Biol. Chem. 277, 46226-46232[Abstract/Free Full Text]
  46. Ozes, O. N., Akca, H., Mayo, L. D., Gustin, J. A., Maehama, T., Dixon, J. E., and Donner, D. B. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 4640-4645[Abstract/Free Full Text]
  47. Thumkeo, D., Shimizu, Y., Sakamoto, S., Yamada, S., and Narumiya, S. (2005) Genes Cells 10, 825-834[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
L. Madsen, R. K. Petersen, K. R. Steffensen, L. M. Pedersen, P. Hallenborg, T. Ma, L. Froyland, S. O. Doskeland, J.-A. Gustafsson, and K. Kristiansen
Activation of Liver X Receptors Prevents Statin-induced Death of 3T3-L1 Preadipocytes
J. Biol. Chem., August 15, 2008; 283(33): 22723 - 22736.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
R. K. Petersen, L. Madsen, L. M. Pedersen, P. Hallenborg, H. Hagland, K. Viste, S. O. Doskeland, and K. Kristiansen
Cyclic AMP (cAMP)-Mediated Stimulation of Adipocyte Differentiation Requires the Synergistic Action of Epac- and cAMP-Dependent Protein Kinase-Dependent Processes
Mol. Cell. Biol., June 1, 2008; 28(11): 3804 - 3816.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/40/29574    most recent
M705972200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services