![]()
|
|
||||||||
J. Biol. Chem., Vol. 282, Issue 40, 29634-29645, October 5, 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

¶1

3
From the
Michael Smith Laboratories, University of British Columbia, Vancouver, British Columbia, Canada V6T 1Z4, the ||Departamento de Microbiología Molecular, Instituto de Biotecnología, Universidad Nacional Autónoma de México, Cuernavaca, Morelos México 62210, and the Departments of
Microbiology and Immunology and ¶Medicine, Dalhousie University, Halifax, Nova Scotia, Canada B3X 1H5
Received for publication, July 23, 2007
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Enteropathogenic Escherichia coli (EPEC) is a human diarrheal attaching and effacing (A/E) pathogen that attaches to intestinal microvilli and then injects type III effector proteins directly into host cells (2, 3). After bacterial attachment, dramatic cytoskeletal rearrangements result in the effacement of microvilli (4). The A/E phenotype has been linked to the locus of enterocyte effacement (LEE) (5), a pathogenicity island that is involved in EPEC virulence (6). The LEE encodes components of the T3SS, transcriptional regulators, chaperones and type III effector proteins, the latter of which are translocated directly into host cells (7).
EPEC and other related strains have multiple type III effectors that are encoded within the LEE, in addition to non-LEE-encoded effectors that are located in distinct pathogenicity islands throughout the chromosome (3, 8, 9). One of the best studied EPEC type III effectors is Tir (translocated intimin receptor), a protein that is injected into host cells, modified by host kinases, and localized to the host membrane (10, 11). Furthermore, the amino- and carboxyl-terminal regions of Tir interact with a number of host proteins, causing dramatic host cytoskeletal rearrangements, which result in actin-rich lesions termed pedestals (12-16). Remarkably, host membrane-localized Tir also serves as a receptor for EPEC via intimin (10), a bacterial outer membrane adhesin also encoded by the LEE of A/E pathogens. The direct importance of Tir in the virulence of A/E pathogens has been convincingly demonstrated in three in vivo animal models of infection, where tir mutants do not colonize the host intestine or cause clinical symptoms of disease (7, 17, 18). Other well studied LEE encoded type III effectors include Map, EspF, and EspG (19-22), which have been shown to have multifunctional disruptive properties within host cells.
The translocation of type III effectors into host cells is often dependent on a dedicated family of proteins termed type III chaperones (NCBI conserved domain data base, pFam05932). These proteins are cytosolic or membrane-associated, generally small (
20 kDa), soluble, and negatively charged (pI 4-5) (23). Type III secretion chaperones typically form homodimers that bind to the amino-terminal region of effectors and remain in the bacterial cell following translocation of effectors into the host cell. The crystal structures of many type III secretion chaperones have been solved, some in a complex with an effector (24-29). Collectively, these studies have revealed remarkable chaperone structural similarity, even in the absence of primary sequence similarity. Certain type III secretion chaperones are thought to bind a single effector, whereas others have been demonstrated to have multivalent properties and bind more than one effector.
In the case of EPEC, the LEE encoded type III secretion chaperone CesT was initially shown to bind and stabilize Tir within the bacterial cell (30, 31); however, additional studies have demonstrated interactions with the effectors Map, EspF, and NleA (32-34). CesT is also required for the efficient in vitro type III secretion of other LEE and non-LEE type III effectors (33), suggesting that other chaperone-effector interactions may occur within the bacterium. Furthermore, we have previously demonstrated that CesT interacts with the membrane-associated ATPase EscN of the T3SS, in a role probably serving to recruit and target type III effectors for translocation into host cells (33, 35). Interestingly, cesT mutants do not cause overt disease in a mouse model of attaching and effacing pathogenesis (7), indicating that this type III secretion chaperone has a central role in disease.
In this study, we demonstrate that CesT interacts with at least eight EPEC type III effectors. A degenerate CesT binding domain within multiple type III effectors was identified and experimentally confirmed by pull-down and protein domain-exchanging experiments. A variety of complementary genetic and biochemical assays were used to demonstrate a modular nature for the CesT binding domain. Last, using multiple EPEC strains in secretion and infection assays, it is demonstrated that a coordinated Tir-CesT interaction is required for the efficient injection of other type III effectors into host cells. The results highlight events leading to the hierarchical injection of the critical host colonization factor Tir, which probably precedes the delivery of subsequent effectors.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
served as a cloning strain and E. coli BL21(
DE3) was used as an overexpression strain for selected proteins.
|
To create a plasmid for nleH expression from its native promoter, primers 163 (TCGAATTACCCTGATTTTGCTGG) and 169 were used in a PCR with genomic DNA. The resulting PCR fragment encompassed 419 bp upstream of the nleH start codon and the complete nleH open reading frame. The fragment was restriction-digested with KpnI followed by directional cloning into NruI/KpnI-treated pNT242 to create pNT244, which expresses NleH-FLAG from the nleH promoter. Truncated forms of NleH-FLAG were created by using pNT244 as template in a PCR with primer 163 individually paired with primers 164 (CGGGTACCTGTTCTGTTGCCAACCGTTAC) (NleH aa 1-50), 165 (CGGGTACCCGTGCTCACTGGCGATGTATTC) (NleH aa 1-100), 166 (CGGGTACCACCAATAACATTACCTGGCACG) (NleH aa 1-150), 167 (CGGGTACCATATATTTTCTCTGCACTCCCGG) (NleH aa 1-200), and 168 (CGGGTACCTGTATCAACAAAAAGAATTCC) (NleH aa 1-250). The resulting fragments were restriction-digested with KpnI and cloned into NruI/KpnI-digested pNT242. A deletion construct of nleH, lacking the first 150 bp encoding the CesT binding domain (CBD) of NleH was created using a ligation-PCR strategy. Briefly, an nleH promoter region was amplified from pNT244 with primers 163 and 170 (GGAATTCCATATGTTTCAACCTTCAAAATAAACCTATC). An nleH gene fragment was then amplified with primer 173 (GGAATTCCATATGTATCGTGTTGTGGTCACTGATAATAAG) and primer 169. The two DNA fragments were digested with NdeI and then mixed in a 1:1 ratio, followed by the addition of T4 ligase. An aliquot of the ligation was added to a PCR with primers 163 and 169 to amplify a 1.2-kb fragment that was then treated with KpnI, followed by cloning into NruI/KpnI-digested pNT242 to generate pNT250.
The generation of plasmids expressing CBD exchange derivatives of Tir and NleH used a multiple step blunt ligation-PCR strategy. For the Tir-NleH[CBD]-Tir fusion, three fragments were ligated as follows. The NleH CBD (aa 1-40) was PCR-amplified with primers 172 (ATGTTATCGCCCTCTTCTATAAATTTGG) and 176 (GCTATCAGAGTGAACAGCAGC) using pNT244 as template, generating fragment A (120 bp). A DNA fragment containing nucleotides 250-1653 of tir was amplified by PCR from EPEC genomic DNA with primers 177 (TGCTTGCTTGGAGGATTTG) and 151 (CCGGATATCTTAAACGAAACGTACTGGTCC), generating fragment B (1.4 kb). Fragments A and B were treated with T4 polynucleotide kinase, gel-purified, and then blunt end-ligated to each other in a ligation reaction. The ligation reaction then served as template in a PCR with primers 172 and 151, generating fragment C. The promoter and first 114 nucleotides of tir were then amplified from EPEC genomic DNA with primers 145 (GTAAGGAGACTAAATGTCGC) and 174 (AATTAGATGACCAGTTCCTC), generating fragment D. Fragments C and D were kinase-treated and blunt end-ligated as before. The ligation reaction then served as a template in a PCR with primers 145 and 151, generating a 2.2-kb DNA fragment that was digested with BamHI and subsequently cloned into BamHI/EcoRV-treated pACYC184 to create pNT251. For the Tir[CBD]-NleH fusion, the Tir CBD was PCR-amplified with primers 178 (GGAATTCCATATGAGCTCTACAGGAGCATTAGGA) and 179 (TGTCTCAGATGTAGCTGCAGC), generating fragment E. A DNA fragment containing nucleotides 121-909 of nleH was PCR-amplified with primers 180 (GGGACGCAAGTAACGGTTGGC) and 169 using pNT244 as template, generating fragment F. The fragments were kinase-treated and then ligated. The ligation reaction served as template in a PCR with primers 178 and 169, which generated a 1-kb fragment that was directionally cloned into NdeI/KpnI-digested pNT250, creating pNT252.
A plasmid construct expressing NleH-FLAG from the tir promoter was created by amplifying a DNA fragment with primers 175 (CCGCTCGAGGTCTGTTAGGAATAATTAGATAGG) and 169 in a PCR with pNT244 serving as template, followed by cloning of the product into XhoI/KpnI-digested pNT242, to create pNT253. The same primers were used in a PCR with pNT250 as template to create pNT254 expressing NleH[
CBD]-FLAG from the tir promoter. A plasmid construct expressing NleA-FLAG from a tac promoter was generated by amplifying a DNA fragment from EPEC genomic DNA with primers 157 (GGAATTCCCATATGAACATTCAACCGATCGTAAC) and 158 (CGGGTACCGACTCTTGTTTCTTGGATTATATC) followed by cloning into NdeI/KpnI-digested pFLAG-CTC to create pNT255.
To create a plasmid expressing Tir (
2-38), an inverse PCR strategy was used. Briefly, primer 186 (CATACATATATCCTTTTATTTAGAAATTTGACACG) and primer 191 (AGCTGTGCACCGTATCGCGG) were used in a PCR with pTir as template DNA. The resulting product was treated with T4 polynucleotide kinase, followed by ligation and transformation into DH5
, creating pTir(
2-38). The plasmid was then transformed into
tir for phenotypic analyses.
A nonpolar in frame nleA deletion mutant was generated by allelic exchange with a nleA gene fragment with an internal in-frame deletion. Briefly, primers 159 (CGGAGCTCGACGCACTCGACATCTCACTGG) and 160 (CCGCTCGAGGATTCCGGATGTTACGATCGG) were used to PCR-amplify a 1013-bp fragment from EPEC genomic DNA. Similarly, primers 161 and 162 generated a 799-bp fragment. The two DNA fragments were digested with XhoI and ligated with T4 DNA ligase. The ligation served as template in a PCR with primers 159 and 162 with the resulting 1.8-kb product being cloned into SacI/KpnI-digested pRE112, generating pNT256. pNT256 was conjugated into EPEC
sepD, followed by the isolation and genotypic verification of
sepD
nleA strains, as previously described (37). Similarly, a pRE112-based espZ deletion construct was created using primer pairs EPespZ(1) (GCGGTACCTGCTTGTCGAGCAACGAGGCG) and
EPespZ(R) (CCGCTAGCGGATTAGCGATGAAATATGCC) and
EPespZ(F) (GCGCTAGCTGGTAATACTGCACCAGAAGG) and EPespZ(2) (CCGAGCTCGAGTATCTTTGTATATTGACTC), followed by the isolation of
espZ mutants. An EPEC
sepD
escN mutant was created in the
escN genetic background by allelic exchange using a sepD deletion construct (38) harboring a gene fragment of sepD with an internal in-frame deletion.
sepD
escN mutants were verified by PCR genotyping and evaluating protein secretion profiles.
Transcriptional Analyses—The nleA gene promoter was cloned upstream of the promoterless chloramphenicol acetyl-tranferase gene within pKK232-8 (Amersham Biosciences). The resulting construct was transformed into various EPEC strains and tested in transcriptional reporter assays as previously described (41).
Evaluation of Total EPEC Secreted Proteins—Total EPEC secreted proteins were collected as previously described (33). Briefly, Dulbecco's modified Eagle's medium-cultured EPEC cells were pelleted, and the culture supernatant was then filtered (0.22 µm). The filtrate was precipitated by the addition of ice-cold trichloroacetic acid (final concentration 10% (v/v)) and incubated on ice for 30 min. The precipitated proteins were pelleted by centrifugation at 16,000 x g and then washed with ice-cold acetone. Precipitated proteins were resuspended in 2x ESB (0.0625 M Tris-HCl (pH 6.8), 1% (w/v) SDS, 10% glycerol, 2% 2-mercaptoethanol, 0.001% bromphenol blue) and subjected to SDS-PAGE and Western blotting analyses.
|
DE3) lysate using Ni2+-nitrilotriacetic acid affinity chromatography (33). Purified CesT (200 µg) was equilibrated with binding buffer (20 mM Tris (pH 7.9), 0.5 M NaCl), followed by the addition of various filtered EPEC culture supernatants. The column was extensively washed with binding buffer, followed by a higher stringency wash buffer (20 mM Tris (pH 7.9), 0.5 M NaCl, 60 mM imidazole). Retained proteins were co-eluted with His-CesT using elution buffer (20 mM Tris (pH 7.9), 0.5 M NaCl, 1 M imidazole). For mass spectrometry identification of CesT-interacting proteins, the procedure was modified to specifically exclude CesT from the elution fraction. Briefly, after CesT-interacting EPEC proteins were column-bound, the column was treated with denaturing binding buffer (20 mM Tris (pH 7.9), 0.5 M NaCl, 6 M urea). This served to denature and elute proteins from the column. The eluate was then passed over a separate Ni2+-nitrilotriacetic acid column, pre-equilibrated with denaturing binding buffer, to specifically retain denatured His-CesT. The eluate from this column was then trichloroacetic acid-precipitated, followed by mass spectrometry analyses (see below).
To evaluate a direct interaction between NleH and CesT, FLAG-tagged NleH expressed in DH5
was immunoprecipitated from a cell lysate (5-ml culture, A600 = 0.8) onto FLAG beads as previously described (33). Purified GST-CesT or GST only was added to the NleH-containing beads, followed by incubation at 4 °C. The beads were then washed three times with phosphate-buffered saline containing protease inhibitors (Roche Applied Science complete mini-EDTA, one tablet per 10 ml of phosphate-buffered saline). NleH-FLAG was competitively eluted from the beads using FLAG peptide (final concentration of 90 ng/µl). The eluted protein fraction was then subjected to SDS-PAGE and immunoblotting analyses. An additional control for GST-CesT demonstrated that it did not bind to FLAG-beads exposed to a DH5
lysate, ruling out CesT interacting with the beads or any nonspecific bead-interacting proteins from DH5
.
In Vitro Cell Culture EPEC Infection Assays—For immunofluorescence microscopy experiments, HeLa cells were infected with overnight LB-cultured EPEC strains at a multiplicity of infection of 100. All infections were carried out at 37 °C, 5% CO2 for 3 h in Dulbecco's modified Eagle's medium containing fetal bovine serum unless otherwise indicated. Infected HeLa monolayers were washed with phosphate-buffered saline, followed by fixation with paraformaldehyde (2.5%, v/v). The samples were processed for immunofluorescence microscopy as previously described (37). Monoclonal antibodies were used to stain fixed samples: anti-FLAG (1:2000) (Sigma), anti-Tir (1:500), and anti-PY (1:500) clone 4G10 (Upstate%20Biotechnology">Upstate Biotechnology, Inc.), followed by extensive washing and staining with secondary antibodies (Alexa 488- or 568-conjugated anti-mouse (Molecular Probes), 1:400). For visualization of polymerized actin, Alexa 488-conjugated phalloidin (Molecular Probes) was included with the secondary antibodies at a 1:100 dilution. Images were detected using a Zeiss Axioskop microscope, captured with an Empix DVC1300 digital camera, and analyzed using Northern Eclipse imaging software.
Mass Spectrometry Analyses—20 ml of a filtered EPEC
sepD secreted protein preparation was applied to a CesT affinity column. Retained proteins were extensively washed and eluted as described above. The eluted proteins were trichloroacetic acid-precipitated and washed in acetone before SDS-PAGE, followed by Sypro Ruby Red staining. Well defined dominant protein bands were excised, whereas less obvious protein-containing regions within the same gel lane were excised according to apparent molecular weight. Excised gel slices were subjected to trypsin digestion and peptide recovery using a Montage in-gel digest kit (Millipore) as directed by the manufacturer. The peptides were analyzed on an API Q STAR PULSARi Hybrid liquid chromatograph/tandem mass spectrometer at the University of British Columbia Michael Smith Laboratories/Laboratory of Molecular Biophysics Proteomics Core Facility. The data were analyzed using Mascot software (39), and peptide sequences were searched within the nonredundant Proteobacteria data base at the NCBI. In addition, matches to peptides were also searched within the assembled EPEC 2348/69 genome data base at the Welcome Trust Sanger Institute.
| RESULTS |
|---|
|
|
|---|
sepD strain of EPEC that is known to hypersecrete type III effector proteins but not translocator proteins (38).
sepD was cultured under conditions that promote type III effector secretion, and the culture supernatant was collected and passed over a CesT affinity column. After extensive washing, bound protein species were eluted and subjected to mass spectrometry analyses.
Tir was completely depleted from the
sepD supernatant flow-through fraction, indicating a strong interaction with CesT (Fig. 1A). NleA was reduced in the flow-through, as well as many other protein species. A
sepD
escN strain defective for type III secretion due to the absence of the T3SS ATPase did not secrete known type III effectors and served as a control on a separate CesT affinity column. A column without CesT did not bind supernatant proteins to any significant extent (data not shown). Notably, EspC, a large type V secreted protein (110 kDa) (40), was not depleted to any significant extent from the
sepD flow-through, further indicating the specificity of the column for CesT interactions (Fig. 1A). As expected, mass spectrometry analyses of gel-extracted proteins from the
sepD supernatant identified three known CesT binding partners, Tir, NleA, and EspF. Five other type III effectors (EspG, EspZ, NleG, NleH, and NleH2) (Table 2; see "Experimental Procedures") were also identified as CesT-interacting proteins. These proteins are known to be substrates of the type III secretion system, and some require CesT for their efficient secretion in EPEC (33). Thus, their observed interaction with the CesT affinity column is consistent with their dependence on CesT for efficient secretion. The novel effectors are encoded in different pathogenicity islands within EPEC (Table 2), implicating CesT as a multivalent chaperone for diverse type III effector proteins.
|
that does not encode EPEC type III effectors. Notably, NleH-FLAG could be expressed as a soluble protein in the absence of CesT, which was not the case for all type III effectors tested (see "Discussion"). NleH-FLAG was immunoprecipitated onto FLAG beads from a cell lysate and then mixed with purified recombinant GST-CesT (30), followed by extensive washing and elution with FLAG peptide. GST-CesT co-eluted with NleH-FLAG, whereas GST alone did not bind to the NleH-FLAG-containing beads (Fig. 1B). Next, we set out to further characterize the CesT interaction with NleH. Plasmid-encoded NleH was expressed in
sepD or
sepD
cesT and examined for protein secretion. NleH was highly secreted in
sepD but only to a minimal extent in
sepD
cesT, as demonstrated by Western blotting total secreted protein preparations, confirming the requirement of CesT for efficient NleH secretion (Fig. 2A). Carboxyl-terminal truncated versions of NleH and a deletion mutant (
2-50 NleH) were then expressed in
sepD to characterize the type III secretion requirements of NleH. All of the
sepD strains harboring plasmids had similar secretion profiles (Fig. 2B). NleH (aa 1-50) was not detectable in lysate or secreted protein samples, whereas the longer versions were all secreted at high levels from
sepD (Fig. 2C). The amino-terminal deletion mutant (
2-50 NleH) was not secreted, and the protein remained in the bacterial cell, as demonstrated by Western blotting of
sepD whole cell lysates (Fig. 2D). Next, the culture supernatant from EPEC
sepD expressing NleH (aa 1-100) was collected and passed over the CesT affinity column. NleH (aa 1-100) was depleted from the flow-through fraction and remained bound after extensive washing. The protein was co-eluted with CesT (Fig. 2E), indicating that the CesT binding domain of this effector resides within the first 100 amino acids.
|
|
|
|
|
Deletion of the CBD from NleH produced a stable protein species that was not secreted to any extent (Fig. 2B). Fusing the CBD of Tir (amino acids 39-83) to NleH lacking its own CBD resulted in the recombinant NleH protein being secreted at levels comparable with wild type NleH (Fig. 4A). This indicated that the Tir CBD, when fused to NleH (missing its native CBD), can support the type III secretion of the recombinant protein in EPEC.
Since the CBD of Tir is located
38 amino acids into the protein, the CBD of NleH (aa 1-40) was used to replace amino acids 38-83 of Tir. Deletion of the CBD of Tir destabilizes the protein, consistent with Tir stability being strictly dependent on the presence of CesT in EPEC (30). The recombinant Tir protein harboring the NleH CBD was rendered stable and was efficiently secreted by
tir EPEC (Fig. 4A), indicating that the CBD of NleH functionally served to stabilize cytoplasmic Tir and supported its secretion. A
escN mutant defective for type III secretion did not secrete the NleH- and Tir-interchanged CBD fusion proteins (data not shown). This latter result indicated that the secretion of the fusion proteins remained dependent on a functional type III secretion system.
The ability of each fusion protein to interact with CesT was examined using the aforementioned CesT affinity binding assay. The Tir-NleH[CBD]-Tir fusion protein secreted from
tir bound to the CesT column at levels similar to native Tir secreted by wild type EPEC (Fig. 4B). The Tir[CBD]-NleH fusion was also observed to interact with CesT.
Bacteria expressing the recombinant proteins were then tested in an infection assay for their ability to deliver the domain-exchanged type III effectors into HeLa cells. Tir injection into HeLa cells results in the formation of actin-rich pedestals that can be observed as punctate actin staining by immunofluorescence. Since the Tir-NleH[CBD]-Tir hybrid protein was stable and efficiently secreted in secretion assays, we evaluated the efficiency of pedestal formation for a tir mutant expressing the recombinant Tir-NleH[CBD]-Tir hybrid protein. The
tir mutant expressing a Tir derivative lacking its CBD did not produce pedestals or focus actin to any significant extent, whereas the tir mutant harboring pNT251 encoding Tir-NleH[CBD]-Tir produced pedestals and focused actin similar to wild type EPEC (Fig. 5). Wild type EPEC harboring a plasmid encoding epitope-tagged NleH or the Tir[CBD]-NleH fusion translocated the respective NleH proteins into HeLa cells (Fig. 5). NleH and Tir[CBD]-NleH both localized immediately underneath adherent bacteria, close to regions of considerable actin focusing. These experiments indicate that the degenerate CesT binding domain is modular in nature and can be functionally exchanged between type III effectors.
|
sepD strain hypersecretes effectors that are readily detectable by Coomassie staining and thus represents an ideal genetic background to address the role of Tir with respect to other type III effectors. Therefore, a
sepD
tir strain was generated and evaluated for effector secretion. Surprisingly, total effector secretion was dramatically reduced for the
sepD
tir strain compared with the
sepD parent (Fig. 6A). Notably, abundant levels of NleA were missing from the culture supernatant as well as other type III effector proteins. The
sepD
tir strain was trans-complemented with a plasmid expressing Tir, which restored total effector secretion. This experiment also served to rule out polar transcriptional effects on chromosomal cesT gene expression. Deletion of either a type III effector gene encoded outside of the LEE (nleA) or within the LEE (espZ) from the
sepD background did not alter secreted type III effector levels (Fig. 6B), indicating that Tir protein expression is important to sustain total type III effector secretion. A transcriptional fusion to nleA was used to evaluate the expression level of this effector gene in different EPEC strain backgrounds. nleA gene expression was not significantly different in
sepD or
sepD
tir strains (Fig. 6C), indicating that the absence of NleA secretion in
sepD
tir was not due to a lack of nleA transcription.
A Coordinated CesT-Type III Effector Interaction Rescues the
sepD
tir Secretion Defect—Based on these results, it was hypothesized that by unlinking tir from cesT gene expression, the CesT protein would be temporally unbound and that free CesT would act as a feedback signal to negatively modulate the secretion of other type III effectors. It was therefore hypothesized that any type III effector that interacts with CesT should return total type III effector secretion to the
sepD
tir strain, provided that its expression was linked with CesT. To address this hypothesis, NleA-FLAG was expressed within
sepD
tir from a recombinant tac promoter, which is active during typical Tir expression conditions. NleA-FLAG (encoded by pNT255) was found to be secreted and partially restored the secretion of other type III effectors (Fig. 7). Another plasmid encoding NleH from the tir promoter (pNT253) was transformed into the
sepD
tir strain and evaluated for effector secretion. NleH expressed from the tir promoter also partially restored type III effector secretion minus Tir (Fig. 7). Notably, NleA secretion was restored. Last, a plasmid encoding NleH without its CBD (pNT254) did not restore effector secretion, suggesting that a coordinated CesT-type III effector protein interaction is important for efficient type III effector secretion.
Tir Secretion Is Required to Efficiently Activate Type III Effector Secretion in EPEC—The ability of any effector to rescue total effector secretion in the
sepD
tir double mutant could be due to an interaction with CesT. Alternatively, other type III effectors may require the action of Tir secretion from the cytoplasm to support their subsequent secretion. To address these questions, we constructed a plasmid that expresses a CesT-interacting Tir variant without its putative signal sequence (Tir
2-38 aa). This region of Tir encodes the putative Tir secretion signal (aa 1-26) (42) up to the beginning of the Tir CBD. Immunoblotting of cell lysates and the secreted protein preparations revealed that the Tir variant was stable within the EPEC cytoplasm, suggestive of an interaction with CesT. In addition, this Tir variant was only minimally secreted compared with wild type Tir (Fig. 8A). Notably, this Tir variant did not rescue effector secretion, whereas overexpression of a wild type Tir protein completely restored type III effector secretion as visualized by staining total secreted proteins.
|
sepD was found to secrete comparable levels of NleH and Tir (aa 1-38)-NleH as determined by immunoblotting of total secreted protein preparations (Fig. 8B). In addition, Tir (aa 1-38)-NleH did not restore total type III effector secretion to
sepD
tir (Fig. 8C), indicating that amino acids 1-38 of Tir alone cannot impose secretion hierarchy to other type III effectors. | DISCUSSION |
|---|
|
|
|---|
A pressing question in bacterial pathogenesis is how pathogens regulate their multiple virulence determinants to create a productive infection leading to disease. For extracellular intestinal pathogens, it is absolutely critical to attach and colonize gut tissues before being prematurely shed into the environment. We show here with genetic and biochemical evidence that the receptor for intimate attachment, Tir, is the hierarchical type III effector in EPEC. The data suggest that once Tir-mediated intimate attachment has been achieved, then other type III effectors involved in subverting the host's intracellular processes are injected. The results are in direct accordance with animal infection experiments where Tir-mediated adherence of A/E pathogens is important for host colonization and disease progression. This point has been directly and robustly demonstrated in three animal models of infection: (i) EHEC tir mutants do not efficiently colonize the infant rabbit intestine and do not show clinical signs of disease (18); (ii) Citrobacter rodentium tir mutants do not colonize the mouse intestine and do not cause disease (43); and (iii) rabbit EPEC tir mutants do not cause diarrhea in weaned rabbits and do not intimately adhere to host intestinal cells (17).
|
There could be additional CesT-interacting type III effectors that were not secreted at high enough levels within our EPEC secretion assays or were in an improper conformation to interact with immobilized His-CesT (Fig. 1). Indeed, it has been reported that the CesT-interacting type III effector Map is expressed at very low levels within EPEC (32), which may explain why it was not detected in our analyses. Nonetheless, from our observations and those from other reports (32-34), CesT physically interacts or is involved in the secretion of every LEE-encoded effector described to date, further strengthening its central role in EPEC pathogenesis. Pairwise protein interaction studies between CesT and each of its partner effectors will help to identify specific binding affinities for this multivalent chaperone of EPEC.
The multivalent binding property of CesT with different type III effectors suggests that there is a common feature among the effectors that mediates CesT binding. A study by Lilic et al. (26) suggests that a number of type III effectors have a conserved structural
-fold that type III secretion chaperones interact with. This does not appear to be the case for all of the EPEC type III effectors that interact with CesT, since the presumed structural
-folds are not in a proper spatial context for dimeric CesT binding. From our CBD swapping experiments with EPEC effectors, it is clear that a degenerate binding domain of
40 amino acids is involved in CesT binding.
We hypothesize that EPEC has a hierarchical mechanism to deliver its receptor initially as modeled in Fig. 9. The coordinated expression of tir and cesT genes promotes a timely protein interaction of the CesT chaperone dimer with Tir within the bacterial cell, which results in efficient Tir secretion. In the absence of Tir (e.g. tir mutants), CesT is probably uncomplexed and perhaps is able to have a negative feedback mechanism with respect to effector secretion. We tested this possibility by overexpressing CesT in both wild type and tir mutant strains during secretion permissive growth conditions and observed no difference compared with strains with normal CesT levels (data not shown). This suggests that CesT alone does not mediate regulated type III effector secretion. We hypothesize that the action of Tir secretion results in CesT being associated with the secretory apparatus. This is in agreement with the observed inner membrane association of CesT within EPEC, a localization that is enhanced in the presence of Tir (33). After Tir secretion, other effectors can bind to membrane-associated or cytoplasmic CesT, which then supports their secretion through the secretory apparatus (Fig. 9). This model is similar to a proposed model for Yersinia pestis type III effector secretion, where it is thought that LcrQ and its chaperone SycH function together to mediate a hierarchy of secretion (45).
Prior to this study, genetic evidence for type III effector hierarchy was lacking, although convincing evidence for the hierarchical assembly of the type III translocon has been reported (46). From the studies presented here, it is evident that certain type III effectors are hierarchical over others. The data presented here also implicate type III secretion chaperones to be involved with hierarchy, although additional studies are required to elucidate the mechanisms and dynamics underlying this process. The role of multivalent secretion chaperones, such as CesT, are particularly interesting in this regard, given their multiple interactions with diverse type III effectors.
| FOOTNOTES |
|---|
2 Supported by Direccion General de Asuntos del Personal Académico and Consejo Nacional de Ciencia y Tecnologia. ![]()
3 A CIHR Distinguished Investigator, an International HHMI Scholar, and the University of British Columbia Peter Wall Distinguished Professor. ![]()
1 Recipient of a CIHR/NSHRF New Investigator Award. To whom correspondence should be addressed: Dept. of Microbiology and Immunology/Medicine, Dalhousie University, Halifax, Nova Scotia, B3X 1H5 Canada. Tel.: 902-494-8065; Fax: 902-494-5125; E-mail: n.thomas{at}dal.ca.
4 The abbreviations used are: T3SS, type III secretion system; EPEC, enteropathogenic E. coli; A/E, attaching and effacing; LEE, locus of enterocyte effacement; CBD, CesT binding domain; aa, amino acids; GST, glutathione S-transferase. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|