Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M701330200 on August 9, 2007

J. Biol. Chem., Vol. 282, Issue 42, 30434-30441, October 19, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/42/30434    most recent
M701330200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arthur, J. F.
Right arrow Articles by Gardiner, E. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arthur, J. F.
Right arrow Articles by Gardiner, E. E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Ligand Binding Rapidly Induces Disulfide-dependent Dimerization of Glycoprotein VI on the Platelet Plasma Membrane*

Jane F. Arthur{ddagger}, Yang Shen{ddagger}, Mark L. Kahn§, Michael C. Berndt{ddagger}, Robert K. Andrews{ddagger}, and Elizabeth E. Gardiner{ddagger}1

From the {ddagger}Department of Immunology, Monash University, Melbourne 3004, Australia and the §Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104

Received for publication, February 15, 2007 , and in revised form, August 6, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Thrombus formation in hemostasis or thrombotic disease is initiated by adhesion of circulating platelets to damaged blood vessel walls. Exposed subendothelial collagen interacting with platelet glycoprotein (GP) VI leads to platelet activation and integrin {alpha}IIbbeta3-mediated aggregation. We previously showed that ligand binding to GPVI also induces metalloproteinase-dependent shedding, generating an ~55-kDa soluble ectodomain fragment and an ~10-kDa membrane-associated remnant. Here, treatment of platelets with collagen or the GPVI-targeting rattlesnake toxin convulxin also induces rapid (10–30 s) formation of a high molecular weight GPVI complex (GPVIc) under nonreducing conditions, as detected by immunoblotting with anti-GPVI antibodies. The appearance of an ~20-kDa remnant detectable using a polyclonal antibody against the GPVI cytoplasmic tail under nonreducing, but not reducing, conditions after ectodomain shedding and nonreduced/reduced two-dimensional SDS-polyacrylamide gel analysis of biotinylated platelets confirmed that that GPVIc was a homodimer. Formation of disulfide-linked GPVIc was prolonged in the presence of metalloproteinase inhibitor GM6001 and was independent of GPVI signaling because it was unaffected by inhibitors of Src kinases, Syk, or phosphoinositide 3-kinase. To identify the thiol involved in disulfide bond formation, wild-type or mutant GPVI, where two available sulfhydryls (Cys-274 and Cys-338) were individually mutated to serine, was expressed in rat basophilic leukemia cells. Dimerization of wild-type and C274S GPVI, but not the C338S mutant, was observed after treating cells with convulxin. We conclude that (i) a subpopulation of GPVI forms a constitutive dimer on the platelet surface, facilitating rapid disulfide cross-linking, (ii) convulxin or other GPVI agonists induce disulfide-linked GPVI dimerization independent of GPVI signaling, and (iii) the penultimate residue of the GPVI cytoplasmic tail, Cys-338, mediates disulfide-dependent dimer formation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The ability of platelets to adhere at sites of vascular damage is a fundamental requirement of platelet function. Circulating platelets adhere to exposed collagen in an injured vessel wall in a process requiring rapid activation of multiple signaling events. The platelet collagen receptor, glycoprotein (GP)2 VI, predominantly mediates intracellular signaling that leads to activation of the platelet integrin {alpha}IIbbeta3, which binds fibrinogen or von Willebrand factor and mediates platelet aggregation (1, 2). Platelet adhesion is stabilized by the additional collagen receptor, {alpha}2beta1 (3). Ligands other than collagen, such as collagen-related peptide (CRP) (4) and the snake venom protein convulxin (5), rapidly induce platelet aggregation by binding to distinct but overlapping sites on GPVI (6, 7). Engagement of GPVI (~65 kDa) also induces metalloproteinase-dependent loss of GPVI from the platelet surface and the release of a soluble ~55-kDa ectodomain fragment of GPVI (8, 9) by a mechanism that may be distinct from that involved in cleavage of other platelet receptors (10–12).

GPVI is a platelet-specific receptor of the immunoglobulin (Ig) superfamily, containing two extracellular Ig domains, a single transmembrane domain, and a cytoplasmic tail of ~51 residues (13, 14). Mature GPVI contains six Cys residues, four of which maintain the tertiary structure of the ectodomain via a disulfide bond in each Ig domain. Cys residues at the extracellular domain/membrane interface and at the penultimate position within the cytoplasmic tail (13) have no known function.

Our laboratory recently showed that GPVI associates with GPIb{alpha} (the major ligand-binding subunit of the GPIb-IX-V complex) on resting and activated platelets (15) and that these receptors act synergistically in human or mouse platelets, particularly at low agonist concentrations (16–20). GPVI is also noncovalently associated with the Fc receptor {gamma} chain (FcR{gamma}), required for GPVI surface expression. GPVI signals via an immunoreceptor tyrosine activation motif (ITAM) within the FcR{gamma} cytoplasmic tail. Ligand-induced cross-linking of GPVI/FcR{gamma} enables phosphorylation of the ITAM by GPVI-associated Src kinases, Fyn and Lyn, and ITAM-dependent activation of Syk kinase upstream of pathways leading to (a) activation of

{alpha}IIbbeta3, and (b) activation of metalloproteinases involved in GPVI shedding (14, 21–24).

Receptor cross-linking, therefore, appears to be a critical mechanism for amplifying signaling responses by GPVI (1, 25, 26) and other Ig family immunoreceptors (27–31). This is consistent with recent crystallographic data showing dimerization of ectodomain fragments of GPVI (32) and the ITAM-bearing immunoreceptor Fc{gamma}RIIa (46), both of which contain two extracellular Ig domains. Recently, Berlanga et al. (33), using chemical cross-linking and bioluminescence resonance energy transfer analysis, also showed GPVI oligomerization on nonstimulated platelets, suggesting the presence of preexisting constitutive dimers separated by <10 nm, and that multivalent ligands induce higher level clusters involving receptors distant by 10 nm or more. In this case, chemically cross-linked GPVI also contained FcR{gamma}. In the course of studies on the association of GPIb-IX-V and GPVI (15), we noticed a high molecular weight complex immunoreactive to anti-GPVI antibodies when samples were run on SDS-polyacrylamide gels under nonreducing conditions. In this paper, we show that this band represented a ligand-induced disulfide-dependent GPVI homodimer. Mutation of Cys-338 within the GPVI cytoplasmic domain, but not the other available sufhydryl at Cys-274, prevented dimerization, demonstrating an unusual role for the penultimate residue, Cys-338. Together, these results provide unique evidence supporting the presence of constitutive GPVI homodimers on the platelet surface and demonstrate that GPVI agonists can induce transient disulfide-dependent dimerization of GPVI independent of platelet activation.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Antibodies—A murine monoclonal antibody, 6B12, against human platelet GPVI ectodomain has been characterized previously (8, 34). Rabbit IgG against the cytoplasmic tail of GPVI (23) was raised and affinity-purified as described previously (35, 36). Horseradish peroxidase (HRP)-conjugated or fluorescein isothiocyanate-conjugated anti-mouse and anti-rabbit Ig antibodies raised in sheep were from Chemicon (Melbourne, Australia). Avidin-HRP was from Sigma.

Reagents—Purified convulxin from the venom of the South American rattlesnake Crotalus durissus terrificus was a kind gift from Dr. Kenneth Clemetson (Berne, Switzerland). The GPVI-specific agonist, CRP, with amino acid sequence GCO(GPO)10GCOG-NH2, where O represents hydroxyproline (Mimotopes, Clayton, Victoria, Australia), was cross-linked using the chemical cross-linker (3-(2-pyridyldithio) propionic acid N-hydroxysuccinimide (Sigma) as described previously (37). GM6001, a hydroxamic acid-based metalloproteinase inhibitor with broad specificity (38), calmodulin inhibitor W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide), inhibitors of Src family kinases (PP2), phosphoinositide 3-kinase (wortmannin), and Syk kinase (piceatannol) were obtained from Calbiochem. CompleteTM protease inhibitor mixture tablets were obtained from Roche Diagnostics (Mannheim, Germany).

Platelet Aggregation—Human platelets were isolated from venous blood using a 19-gauge winged infusion kit with acid citrate dextrose as the anticoagulant, and washed three times in CGS buffer (37.5 mM trisodium citrate, 5 mM glucose, 0.15 M NaCl, pH 7.0), as described previously (39). Platelets were resuspended at 5 x 108 platelets/ml in Tyrode's buffer (0.36 mM NaH2PO4.H2O, 5.5 mM glucose, 138 mM NaCl, 12 mM NaHCO3, 1.8 mM CaCl2, 0.49 mM MgCl2. 6H2O, 2.6 mM KCl, pH 7.4). Platelet aggregation was induced by addition of convulxin (0.5 µg/ml, final concentration) with stirring at 900 rpm in a Lumiaggregometer (Chronolog, Havertown, PA) at 37 °C. Assays were terminated by the addition of one-quarter volume 4x nonreducing SDS sample-loading buffer.

Analysis of Platelets Treated with GPVI Agonists—To examine the effect of GPVI ligands on platelet GPVI, aliquots (0.1 ml) of washed platelets were mixed with 0.1 ml of Tyrode's buffer containing (final concentration) convulxin (0.01–3 µg/ml), collagen (20 µg/ml), or the calmodulin inhibitor W7 (150 µM) and incubated at room temperature for the indicated times. Some platelet suspensions also contained wortmannin (0.1 µM), piceatannol (30 µg/ml), PP2 (10 µM), or the metalloproteinase inhibitor GM6001 (0.1 mM) added 10 min before the addition of agonist. Incubations were halted by adding 10 mM EDTA (final concentration), and platelets were pelleted by centrifugation at 15,000 x g for 2 min. The supernatant was mixed with one-quarter volume 4x nonreducing SDS sample-loading buffer. Platelet pellets were lysed with 0.25 ml of lysis buffer (20 mM Tris-HCl, pH 7.4, 5 mM EGTA, 1% (v/v) Triton X-100) plus Complete proteinase inhibitor on ice for 30 min. Lysates were mixed with one-quarter volume 4x nonreducing SDS sample-loading buffer, resolved on SDS-5–20% polyacrylamide gels, and electrotransferred to polyvinylidene difluoride (PVDF) membranes. Membranes were blocked with 0.01 M Tris-HCl, 0.15 M NaCl, pH 7.4 (TS buffer) containing 5% (w/v) skim milk and 0.1% (v/v) Tween-20. GPVI was detected using 1–5 µg/ml anti-GPVI antibodies and HRP-conjugated IgG secondary antibodies and visualized by chemiluminescence (Amersham Biosciences).

Two-dimensional SDS-Polyacrylamide Gel Analysis of Biotinylated Platelets—Washed human platelets were either unlabeled or labeled with N-hydroxysuccinimide-biotin (Sigma) according to the manufacturer's instructions and were treated with convulxin (0.5 µg/ml) for 3 min at room temperature to induce GPVI dimer formation. Biotinylated platelets were lysed in TS buffer containing 1% (v/v) Triton X-100, 5 mM EGTA, and protease inhibitor mixture, precleared with protein A-Sepharose, and immunoprecipitated with rabbit anti-GPVI tail antibody (40) using methods described previously (15). Samples of convulxin-treated unlabeled or biotinylated platelet lysates and immunoprecipitates were Western blotted with anti-GPVI monoclonal antibody 6B12 as described above. For two-dimensional gel analysis, biotinylated platelet lysate was resolved in the first dimension under nonreducing conditions on SDS-7.5%-polyacrylamide tube gels and in the second dimension under reducing conditions on SDS-7.5%-polyacrylamide slab gels essentially as described previously (41, 42). After electrotransfer, the PVDF membrane was Western blotted with anti-GPVI monoclonal antibody 6B12, stripped and reprobed with avidin-HRP, and visualized by chemiluminescence as described above.

Expression of Wild-type and Mutant GPVI—Rat basophilic leukemia (RBL) cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal bovine serum (CSL, Melbourne, Australia), 0.75% (w/v) NaHCO3, and 1 mM sodium pyruvate, as well as penicillin, streptomycin, and antimycin. RBL cells were stably transfected with wild-type human GPVI cDNA in growth medium containing 1.0 mg/ml G418 as described previously (43). Cys to Ser point mutations were introduced into GPVI cDNA at amino acid positions 274 and 338 (residue numbers according to Ref. 13) using the PCR method of QuikChange mutagenesis, and selected in G418-containing medium as described above. Oligonucleotides for mutagenesis were as follows: C274S (23-mers) forward primer, GGTCCGGATATCCCTCGGGGCTG, and reverse primer, CAGCCCCGAGGGATATCCGGACC; and C338S (31-mers) forward primer, CACAGCCGCGGGTTATCTTATGATCTAGAG, and reverse primer, CTCTAGATCATGAAGATAACCCGCGGCTG. Cells were sorted for expression of GPVI using a FACSvantage DiVa (BD Biosciences) with anti-GPVI monoclonal antibody 6B12, and cells positive for GPVI isolated. Expression of wild-type and mutant GPVI was monitored by flow cytometry and Western blotting using 6B12.

Ligand-induced Dimerization of GPVI on RBL Cells—RBL cells expressing wild-type and mutant GPVI were plated onto 6-well plates 24 h prior to an experiment to achieve >90% confluency. Culture medium was removed and cell monolayers rinsed three times with phosphate-buffered saline (PBS) buffer (0.01 M NaH2PO4, 0.15 M NaCl, pH 7.4) containing 1 mM Ca2+/Mg2+, and then treated with either PBS alone or PBS containing 0.5 µg/ml convulxin at 37 °C. Cells were lysed in TS buffer containing 1% (v/v) Triton X-100 and protease inhibitor mixture, cleared of nuclei and cell debris by centrifugation and analyzed by Western blot as described above.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Rapid Ligand-induced Induction of a High Molecular Weight GPVI Complex on Platelets—In resting platelets, GPVI is present as an ~65-kDa monomer under both reducing and nonreducing conditions (8) (Fig. 1A). However, treatment of platelets with the snake venom protein convulxin induced both platelet aggregation (Fig. 1B) and the appearance of a high molecular weight GPVI complex (GPVIc) at ~120 kDa under nonreducing conditions, detectable by Western blotting with anti-GPVI antibody 6B12 (Fig. 1A). GPVIc was not detectable under reducing conditions (Fig. 1C), indicating that the complex involved a disulfide bond(s). Levels of GPVIc were detectable in 15 s, peaked at 1–3 min (Fig. 1A), and began to disappear after 3 min. The loss of GPVIc corresponded to maximal platelet aggregation (Fig. 1B) and to the metalloproteinase-dependent cleavage of intact GPVI (8) that occurs more slowly (3–60 min), resulting in the appearance of the ~55-kDa ectodomain fragment (GPVIf). GPVIc was also present in lysates of platelets treated with collagen (see below) and CRP (data not shown) under nonreducing conditions; however, convulxin is a more potent agonist, presumably related to the extent of ligand-induced cross-linking, and was used for further analysis. The generation of GPVIc after 30 s was proportional to the agonist concentration (Fig. 1D). At maximal levels (1–3 µg/ml convulxin), the amount of GPVIc represented 60–70% of total platelet GPVI. At this time point (30 s), GPVI shedding from the platelet surface is negligible (Fig. 1A), confirming that formation of GPVIc on the platelet surface occurred prior to receptor shedding.


Figure 1
View larger version (37K):
[in this window]
[in a new window]

  		FIGURE 1.
Platelet GPVI forms a high molecular weight disulfide-dependent complex upon treatment with convulxin. A, Western blot of platelet lysates (PL) resolved by SDS-PAGE under nonreducing conditions showing formation of GPVIc upon treatment with convulxin with time. GPVI was detected using monoclonal antibody 6B12. B, platelet aggregation induced by 0.5 µg/ml convulxin (Cvx). The extent of aggregation at 15 s, 1 min, and 3 min are directly comparable with lanes in panel A. C, treatment of samples with beta-mercaptoethanol abolishes the GPVIc by Western blot with 6B12. D, Western blot of platelet pellets resolved by SDS-PAGE under nonreducing conditions showing a concentration-dependent increase in GPVIc following 30-s convulxin treatment. Data are representative of at least three experiments with different donors. GPVIf, ~55-kDa GPVI fragment.

 
To assess whether GPVIc was a homodimer, convulxin-treated biotinylated platelets were analyzed on two-dimensional nonreduced/reduced SDS-polyacrylamide gels. The formation of ligand-induced GPVIc was unaffected by biotinylation, was immunoprecipitated by anti-GPVI tail antibody (Fig. 2A), and produced a single spot on a two-dimensional gel recognizable by both anti-GPVI antibody and by avidin-HRP (Fig. 2B, arrow). Anti-GPVI and avidin-HRP also recognized a spot corresponding to GPVI monomer in both dimensions (Fig. 2B). These results suggest that the GPVIc is a homodimer of GPVI.


Figure 2
View larger version (56K):
[in this window]
[in a new window]

  		FIGURE 2.
Two-dimensional nonreduced/reduced SDS-PAGE analysis of GPVIc. A, Western blot with anti-GPVI monoclonal antibody 6B12, convulxin-treated, unlabeled, or biotinylated platelet lysates, or biotinylated platelet lysates immunopreciptiated with rabbit anti-GPVI tail antibody. Samples were analyzed on SDS-7.5% polyacrylamide gels. B, two-dimensional SDS-7.5% polyacrylamide gel analysis of convulxin-treated biotinylated platelets under nonreducing conditions in the first dimension and reducing conditions in the second dimension, blotted with anti-GPVI antibody and HRP-conjugated secondary antibody, or avidin-HRP, and visualized by ECL. The arrow points to the GPVIc, resolving as a single spot recognized by both anti-GPVI antibody and avidin-HRP.

 
GPVIc Formation Is Not Blocked by Inhibitors of GPVI Signaling—Results shown in Fig. 1 suggest that the formation of GPVIc occurred rapidly (within 15 s). GPVI signaling that occurs on this time scale (5, 8, 44, 45), however, was not required for dimer formation. When platelets were incubated with inhibitors of the GPVI-related signaling molecules, Src family kinases (PP2; 10 µM), Syk (piceatannol; 30 µg/ml) or phosphoinositide 3-kinase (wortmannin; 0.1 µM), convulxin-induced GPVIc was detected after 30 s (Fig. 3A). Consistent with previous results (8), these inhibitors blocked ligand-induced shedding of the ~55-kDa GPVI fragment (Fig. 3A) and inhibited proteolysis of GPVIc (cf. Fig. 1A). These results indicate that GPVIc is formed prior to the onset of ligand-induced GPVI signaling and that GPVI signaling is not required for GPVIc formation. In this regard, we only tested inhibitors related to GPVI-dependent signaling but do not rule out the possibility that other pathways associated with GPVI function (46) might affect disulfide bond formation.

The dissociation of calmodulin from its binding site within the GPVI cytoplasmic tail is an early event that occurs upon GPVI ligand binding (47), and calmodulin dissociation induced by treatment of platelets with calmodulin inhibitors such as W7 triggers ligand-independent shedding of GPVI after 2 h (8). To assess a possible role for calmodulin in regulating GPVIc, platelets were treated with W7 and lysates analyzed under nonreducing conditions. However, treatment with W7 (150 µM, final concentration) up to 2 h did not induce formation of GPVIc (Fig. 3B), although as observed previously (8), shedding of GPVI occurred after 2 h (Fig. 3B). Taken together, these results indicate that formation of GPVIc occurs within seconds of ligand binding, and is independent of downstream ligand-induced GPVI signaling events or calmodulin association. The possible involvement of membrane raft domains was also assessed; however, the raft-disrupting reagent methyl-beta-cyclodextrin (15) did not affect formation of the high molecular weight GPVI complex (data not shown).


Figure 3
View larger version (46K):
[in this window]
[in a new window]

  		FIGURE 3.
GPVI complex formation is unaffected by inhibitors of GPVI signaling. Western blot of human washed platelets treated for 30 s or 30 min with convulxin (0.5 µg/ml) in the presence or absence of GPVI signaling inhibitors wortmannin (Wort.), piceatannol (Pic.), or PP2. Aliquots of platelet pellet and supernatant were resolved by SDS-PAGE under nonreducing conditions, transferred to PVDF, and probed with the anti-GPVI antibody 6B12. Data are representative of at least three experiments with different donors. PL, platelet lysate; Cvx, convulxin.

 
GPVIc Is Stable When GPVI Ectodomain Shedding Is Blocked—Similar to inhibitors of GPVI signaling that block ligand-induced metalloproteinase-mediated proteolysis of GPVI and GPVIc, the metalloproteinase inhibitor GM6001, previously shown to block ligand-induced shedding of GPVI (8), also protects convulxin-induced GPVIc on platelets (Fig. 4A). Under these conditions, collagen also induces formation of the disulfide-linked form of GPVI (Fig. 4C). This shows that the disulfide-linked form of GPVI is the same as that induced by convulxin and that it is less abundant than the convulxin-induced form. Lysates of convulxin-treated platelets were also probed with an affinity-purified rabbit antibody against the GPVI cytoplasmic tail (36). Fig. 4A shows this antibody recognized full-length GPVI under resting conditions and, upon treatment with convulxin to induce GPVIc formation and shedding, also recognized a membrane-bound remnant of GPVI incorporating the cytoplasmic tail (~10 kDa) and GPVIc (~120 kDa). With time, both GPVI and GPVIc were shed from the platelet surface, concomitant with the appearance of an ~10-kDa remnant fragment of GPVI. Inclusion of GM6001 prevented the appearance of this cleaved fragment, but not formation of GPVIc, indicating that GPVIc was stable up to 30 min following convulxin treatment when metalloproteinase activity was inhibited. Longer exposure of the PVDF membrane to film also revealed an ~20-kDa fragment of GPVI in samples treated with convulxin for 10 and 30 min (Fig. 4B). This ~20-kDa fragment was not present under reducing conditions (data not shown), suggesting that it was a dimeric fragment of the GPVI cytoplasmic tail recognized by the anti-GPVI tail antibody. The simplest explanation for these results is that GPVIc is a disulfide-dependent GPVI homodimer that forms through association of GPVI cytoplasmic domains, that is, C-terminal to the ectodomain cleavage site.


Figure 4
View larger version (42K):
[in this window]
[in a new window]

  		FIGURE 4.
GPVI complex formation is stabilized by inhibition of GPVI ectodomain shedding. A, Western blot of human washed platelets treated for 30 s to 30 min with convulxin (0.5 µg/ml) in the presence or absence of metalloproteinase inhibition by 100 µM GM6001. GM6001 was added 30 s after convulxin. B, longer exposure of film to membrane. Aliquots of platelet lysates were resolved by SDS-PAGE under nonreducing conditions, transferred to PVDF, and probed with anti-GPVI tail polyclonal antibody. C, Western blot of human washed platelets treated for 30 s to 30 min with collagen (20 µg/ml) in the presence of 100 µM GM6001.

 
Dimerization of GPVI in RBL Cells Involves Cys-338—To further characterize the nature of the GPVI dimer, we expressed human GPVI in RBL cells as described previously (15, 43). These cells do not express endogenous GPVI but do express FcR{gamma} (required for GPVI surface expression) and signaling molecules required for GPVI function (43). GPVI contains a total of six Cys residues, four of which are within the extracellular Ig domains (Cys-48 –Cys-88 and Cys-134 –Cys-180, respectively) upstream of the ectodomain cleavage site; however, Cys-274 within the transmembrane domain and Cys-338 within the cytoplasmic tail are both potential sites of disulfide bond formation (Fig. 5A) and consistent with the ~20-kDa dimeric fragment described above. To examine whether mutation of either Cys-274 or Cys-338 interferes with disulfide-dependent GPVIc formation, RBL cell lines stably expressing wild-type GPVI, or C274S or C338S mutant GPVI were prepared (43). Analysis by flow cytometry (Fig. 5B) and Western blot (Fig. 5C) using an anti-GPVI monoclonal antibody indicated that wild-type and mutant GPVI were expressed at similar levels. However, treatment with convulxin for 15 min or 4 h showed that under non-reducing conditions GPVIc could be detected in cells expressing wild-type GPVI and C274S GPVI but not C338S GPVI (Fig. 5C). All of the cell lines shed the ~55-kDa GPVI fragment into the supernatant following convulxin treatment (data not shown), confirming that the mutant GPVI was expressed in a functional form competent to bind ligand and transmit signals leading to activation of proteolytic pathways required for GPVI ectodomain shedding but that ligand-induced formation of GPVIc is critically dependent on Cys-338.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In this study, we present evidence that (i) GPVI molecules exist as constitutive dimers on the platelet surface, facilitating their rapid ligand-induced dimerization; (ii) GPVI can be rapidly disulfide-linked to form a high molecular weight complex (GPVIc) following ligation by GPVI ligands; and (iii) Cys-338 within the cytoplasmic tail of GPVI is involved in the formation of disulfide-bonded homodimers.

First, the speed with which the disulfide-linked GPVI dimer is formed (appearing within 15 s and at maximal levels at 1–3 min) implies that a subpopulation of GPVI receptors is already present as noncovalently linked dimers on the platelet surface. This same argument for the existence of constitutive homodimers of the G protein-coupled dopamine D2 receptor has been made based on the capacity to rapidly form disulfide-linked homodimers, in this case induced by the oxidizing cross-linking reagent copper phenanthroline (48). D2 neither forms disulfide bonds in response to ligand, nor is disulfide bond formation related to receptor ligand binding or signaling. Many members of the Ig-containing immunoreceptor superfamily exist on cell membranes as dimers and/or dimerize upon ligation during activation (27, 29–31, 49). The recently solved crystal structure of the Ig domains of GPVI and of Fc{gamma}RIIa support a dimeric conformation (32, 49, 50), and chemical cross-linking and bioluminescence resonance energy transfer analysis shows GPVI oligomerization on nonstimulated platelets involving the GPVI ectodomain, consistent with the presence of preexisting dimers (separated by <10 nm) and induction of higher level clusters (involving receptors separated by 10 nm or more) by multivalent ligand (33). Thus, although our data showing rapid disulfide bond formation following ligand binding do not definitively prove the existence of constitutive GPVI homodimers on the platelet surface, they provide evidence supporting this proposition, consistent with other evidence obtained using different approaches such as chemical cross-linking, bioluminescence resonance energy transfer, or crystallography (32, 33). In the case of Fc{gamma}RIIa, dimer formation on the cell surface was also demonstrated by protein complementation studies, and mutation of residues at the dimerization interface did not affect ligand binding but significantly altered receptor activation (49). It is also recognized that ligands that cause greater cross-linking and clustering of GPVI also more potently cause platelet activation and aggregation, whereas platelets (51, 52) or GPVI-expressing cells (34) with low levels of surface GPVI respond poorly to collagen. Recently, a peptide with a sequence matching two GPVI recognition motifs from collagen linked by a spacer was reported to induce greater platelet reactivity than a peptide containing the two motifs alone, implying that the first peptide might support simultaneous binding of two GPVI molecules in either a parallel or anti-parallel stacking arrangement (53). In this study, GPVI disulfide-linked dimer formation was observed when platelets were treated with GPVI ligands, collagen, CRP, and the snake venom protein convulxin, with convulxin being the most potent of these agonists. Convulxin is a C-type lectin-like snake toxin from the rattlesnake C. durissus terrificus and is an octamer composed of four {alpha}beta disulfide-linked heterodimers (6); the valency of different recombinant forms of convulxin reflects their potency with respect to platelet activation (54).


Figure 5
View larger version (41K):
[in this window]
[in a new window]

  		FIGURE 5.
A, schematic representation of thiols (I–VI) in human GPVI. Sequences of transmembrane and cytoplasmic domains of human wild-type GPVI, as well as Cys to Ser mutants, are shown with transmembrane residues in bold. The solid line indicates the calmodulin-binding domain, and the dotted underline represents a Pro-rich region shown to bind Fyn/Lyn. (Numbering of residues is based on Ref. 13). B, flow cytometry of RBL cells expressing wild-type or mutant GPVI. Cells were incubated with either nonimmune mouse IgG (solid histogram) or 6B12 (open histogram) followed by fluorescein isothiocyanate-conjugated anti-mouse secondary antibody. C, Cys-338 is important for GPVI dimer formation in convulxin-stimulated cells: Western blot of RBL cells expressing wild-type GPVI (WT), C274S (274) or C338S (338), either untreated or treated with 0.5 µg/ml convulxin (Cvx) for 15 min or 4 h. Aliquots of lysed cells were resolved by SDS-PAGE under nonreducing conditions and immunoblotted with anti-GPVI monoclonal antibody, 6B12. PL, platelet lysate.

 
Second, although very little disulfide-linked GPVIc was present on resting platelets, levels increased rapidly following addition of GPVI agonist. The time frame for disulfide-linked dimer formation (15s to 3 min) precedes that of receptor proteolysis (>3 min; Ref. 8 and this study). In time course experiments, both disulfide-linked GPVI dimer and GPVI monomer undergo metalloproteinolysis. The majority of GPVI remaining on the platelet surface following extended convulxin treatment is in the form of cleaved GPVI monomer, as indicated by the greatly increased amount of monomeric GPVI tail (~10 kDa) detected relative to dimeric GPVI tail (~20 kDa) (Fig. 4B). We found no evidence of an intermediate ~75-kDa GPVI species corresponding to an ~65-kDa full-length GPVI molecule disulfide bonded to an ~10-kDa remnant fragment of GPVI. These results show that GPVI dimer is lost either by metalloproteinase shedding or reduction following ligand binding.

Third, the identification of the ~20-kDa dimer of the GPVI cytoplasmic tail remnant, present in low abundance but detectable at longer exposures of immunoblots of platelets in which shedding had been induced by convulxin (10–30 min), not only provided evidence that GPVIc was a GPVI homodimer but also indicated that the site of the disulfide bond must be C-terminal to the ectodomain cleavage site, PAR{downarrow}QYY (40), that is, within the ~10-kDa membrane-associated remnant sequence. There are only two available Cys residues within this region (Fig. 5A). Studies with recombinant GPVI expressed in RBL cells identified Cys-338 as being involved in disulfide bond formation. Although wild-type and C227S GPVI dimerized in response to convulxin, C338S GPVI did not form disulfide-linked GPVIc. This is unusual in that Cys-338 is the penultimate C-terminal residue in the GPVI cytoplasmic tail (Fig. 5A) and unique among the immunoreceptor family of receptors. Nevertheless, several reports provide precedence for the involvement of the cytoplasmic tail in disulfide-dependent dimerization of other receptors. For example, the C-terminal tail of the G protein-coupled {delta}-opioid receptor is necessary for dimerization (55). Ultraviolet light promotes the dimerization and activation of oncogenic RET tyrosine kinase proteins through intracellular disulfide bond formation (56), and osmotic stress triggers activation of RET kinase via disulfide-dependent dimerization of RET proteins at their C-terminal kinase domain (57). Disulfide cross-linking between the cytoplasmic domains of adjacent Na+/H+ exchanger (NHE-1) molecules has also been reported (58). Using a proteomics approach, Cumming et al. (59) reported the existence of stable cytoplasmic disulfide bonds between a range of intracellular proteins in both resting and oxidant-stressed neuronal cells.

Interestingly, the cytoplasmic sequence of mouse GPVI lacks the C-terminal sequence containing Cys-338, suggesting that mouse GPVI would be unable to form ligand-induced disulfide-dependent dimers by this mechanism. Although mouse GPVI lacks Cys-338, its absence would not preclude noncovalent association or disulfide bond formation involving other thiols. In fact, mouse GPVI contains another Cys residue within the cytoplasmic tail ~9 residues downstream of the transmembrane domain. The other five Cys residues are conserved. It is also possible that the surface arrangement of GPVI or mechanisms for covalent or noncovalent dimer formation on mouse platelets could be different from human platelets.

In conclusion, we report for the first time that the human platelet receptor GPVI rapidly forms a disulfide-dependent dimer following treatment of platelets with GPVI agonists. Dimerization of GPVI is an early, transient event in platelet activation that occurs upstream of signaling and is consistent with known functional dimerization of ITAM-based receptors (including GPVI-associated FcR{gamma} chain) leading to Syk activation. Studies are under way to determine whether disulfide-dependent dimer formation represents a mechanism to accelerate receptor activation, a protective mechanism against agonist-induced shedding, or both.


   FOOTNOTES
 
* This work was supported by the National Health and Medical Research Council and the National Heart Foundation of Australia. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Dept. of Immunology, Monash University, Alfred Medical Research and Education Precinct, Melbourne 3004, Australia. Tel.: 61-3-9903-0661; Fax: 61-3-9903-0038; E-mail: elizabeth.gardiner{at}med.monash.edu.au.

2 The abbreviations used are: GP, glycoprotein; CRP, collagen-related peptide; GPVIc, a high molecular weight complex of glycoprotein VI observed under nonreducing conditions; ITAM, immunoreceptor tyrosine activation motif; RBL, rat basophilic leukemia; FcR{gamma}, Fc receptor {gamma}; PVDF, polyvinylidene difluoride; HRP, horseradish peroxidase; PBS, phosphate-buffered saline. Back


   ACKNOWLEDGMENTS
 
We thank Carmen Llerena, Cheryl Berndt, and Jing Jing for excellent technical assistance.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Nieswandt, B., and Watson, S. P. (2003) Blood 102, 449–461[Abstract/Free Full Text]
  2. Farndale, R. W., Sixma, J. J., Barnes, M. J., and De Groot, P. G. (2004) J. Thromb. Haemost. 2, 561–573[CrossRef][Medline] [Order article via Infotrieve]
  3. Sarratt, K. L., Chen, H., Zutter, M. M., Santoro, S. A., Hammer, D. A., and Kahn, M. L. (2005) Blood 106, 1268–1277[Abstract/Free Full Text]
  4. Asselin, J., Knight, C. G., Farndale, R. W., Barnes, M. J., and Watson, S. P. (1999) Biochem. J. 339, 413–418[CrossRef][Medline] [Order article via Infotrieve]
  5. Polgar, J., Clemetson, J. M., Kehrel, B. E., Wiedemann, M., Magnenat, E. M., Wells, T. N., and Clemetson, K. J. (1997) J. Biol. Chem. 272, 13576–13583[Abstract/Free Full Text]
  6. Batuwangala, T., Leduc, M., Gibbins, J. M., Bon, C., and Jones, E. Y. (2004) Acta Crystallogr. Sect. D Biol. Crystallogr. 60, 46–53[CrossRef][Medline] [Order article via Infotrieve]
  7. Lecut, C., Arocas, V., Ulrichts, H., Elbaz, A., Villeval, J. L., Lacapere, J. J., Deckmyn, H., and Jandrot-Perrus, M. (2004) J. Biol. Chem. 279, 52293–52299[Abstract/Free Full Text]
  8. Gardiner, E. E., Arthur, J. F., Kahn, M. L., Berndt, M. C., and Andrews, R. K. (2004) Blood 104, 3611–3617[Abstract/Free Full Text]
  9. Stephens, G., Yan, Y., Jandrot-Perrus, M., Villeval, J.-L., Clemetson, K. J., and Phillips, D. R. (2005) Blood 105, 186–191[Abstract/Free Full Text]
  10. Bergmeier, W., Rabie, T., Strehl, A., Piffath, C. L., Prostredna, M., Wagner, D. D., and Nieswandt, B. (2004) Thromb. Haemostasis 91, 951–958[Medline] [Order article via Infotrieve]
  11. Rabie, T., Strehl, A., Ludwig, A., and Nieswandt, B. (2005) J. Biol. Chem. 280, 14462–14468[Abstract/Free Full Text]
  12. Bergmeier, W., Piffath, C. L., Cheng, G., Dole, V. S., Zhang, Y., von Andrian, U. H., and Wagner, D. D. (2004) Circ. Res. 95, 677–683[Abstract/Free Full Text]
  13. Clemetson, J. M., Polgar, J., Magnenat, E., Wells, T. N. C., and Clemetson, K. J. (1999) J. Biol. Chem. 274, 29019–29024[Abstract/Free Full Text]
  14. Jandrot-Perrus, M., Busfield, S., Lagrue, A.-H., Xiong, X., Debili, N., Chickering, T., Couedic, J.-P. L., Goodearl, A., Dussault, B., Fraser, C., Vainchenker, W., and Villeval, J.-L. (2000) Blood 96, 1798–1807[Abstract/Free Full Text]
  15. Arthur, J. F., Gardiner, E. E., Matzaris, M., Taylor, S. G., Wijeyewickrema, L., Ozaki, Y., Kahn, M. L., Andrews, R. K., and Berndt, M. C. (2005) Thromb. Haemostasis 93, 716–723[Medline] [Order article via Infotrieve]
  16. Andrews, R. K., Gardiner, E. E., Shen, Y., and Berndt, M. C. (2004) IUBMB Life 56, 13–18[Medline] [Order article via Infotrieve]
  17. Siljander, P. R.-M., Munnix, I. C., Smethurst, P. A., Deckmyn, H., Lindhout, T., Ouwehand, W. H., Farndale, R. W., and Heemskerk, J. W. (2004) Blood 103, 1333–1341[Abstract/Free Full Text]
  18. Baker, J., Griggs, R. K., Falati, S., and Poole, A. W. (2004) Platelets 15, 207–214[CrossRef][Medline] [Order article via Infotrieve]
  19. Massberg, S., Gawaz, M., Gruner, S., Schulte, V., Konrad, I., Zohlnhofer, D., Heinzmann, U., and Nieswandt, B. (2003) J. Exp. Med. 197, 41–49[Abstract/Free Full Text]
  20. Kuijpers, M. J., Schulte, V., Oury, C., Lindhout, T., Broers, J., Hoylaerts, M. F., Nieswandt, B., and Heemskerk, J. W. (2004) J. Physiol. (Lond.) 558, 403–415[Abstract/Free Full Text]
  21. Berlanga, O., Tulasne, D., Bori, T., Snell, D. C., Miura, Y., Jung, S., Moroi, M., Frampton, J., and Watson, S. P. (2002) Eur. J. Biochem. 269, 2951–2960[Medline] [Order article via Infotrieve]
  22. Gibbins, J., Asselin, J., Farndale, R., Barnes, M., Law, C. L., and Watson, S. P. (1996) J. Biol. Chem. 271, 18095–18099[Abstract/Free Full Text]
  23. Suzuki-Inoue, K., Tulasne, D., Shen, Y., Bori-Sanz, T., Inoue, O., Jung, S. M., Moroi, M., Andrews, R. K., Berndt, M. C., and Watson, S. P. (2002) J. Biol. Chem. 277, 21561–21566[Abstract/Free Full Text]
  24. Moroi, M., and Jung, S. M. (2004) Thromb. Res. 114, 221[CrossRef][Medline] [Order article via Infotrieve]
  25. Ezumi, Y., Shindoh, K., Tsuji, M., and Takayama, H. (1998) J. Exp. Med. 188, 267–276[Abstract/Free Full Text]
  26. Gibbins, J. M., Okuma, M., Farndale, R., Barnes, M., and Watson, S. P. (1997) FEBS Lett. 413, 255–259[CrossRef][Medline] [Order article via Infotrieve]
  27. Briant, L., Signoret, N., Gaubin, M., Robert-Hebmann, V., Zhang, X., Murali, R., Greene, M. I., Piatier-Tonneau, D., and Devaux, C. (1997) J. Biol. Chem. 272, 19441–19450[Abstract/Free Full Text]
  28. Brieher, W. M., Yap, A. S., and Gumbiner, B. M. (1996) J. Cell Biol. 135, 487–496[Abstract/Free Full Text]
  29. Newton, J. P., Hunter, A. P., Simmons, D. L., Buckley, C. D., and Harvey, D. J. (1999) Biochem. Biophys. Res. Commun. 261, 283–291[CrossRef][Medline] [Order article via Infotrieve]
  30. Miller, J., Knorr, R., Ferrone, M., Houdei, R., Carron, C. P., and Dustin, M. L. (1995) J. Exp. Med. 182, 1231–1241[Abstract/Free Full Text]
  31. Cornish, A. L., Freeman, S., Forbes, G., Ni, J., Zhang, M., Cepeda, M., Gentz, R., Augustus, M., Carter, K. C., and Crocker, P. R. (1998) Blood 92, 2123–2132[Abstract/Free Full Text]
  32. Horii, K., Kahn, M. L., and Herr, A. B. (2006) Blood 108, 936–942[Abstract/Free Full Text]
  33. Berlanga, O., Bori-Sanz, T., James, J. R., Frampton, J., Davis, S. J., Tomlinson, M. G., and Watson, S. P. (2007) J. Thromb. Haemost. 5, 1026–1033[CrossRef][Medline] [Order article via Infotrieve]
  34. Chen, H., Locke, D., Liu, Y., Liu, C., and Kahn, M. L. (2002) J. Biol. Chem. 277, 3011–3019[Abstract/Free Full Text]
  35. Andrews, R. K., Kroll, M. H., Ward, C. M., Rose, J. W., Scarborough, R. M., Smith, A. I., Lopez, J. A., and Berndt, M. C. (1996) Biochemistry 35, 12629–12639[CrossRef][Medline] [Order article via Infotrieve]
  36. Boylan, B., Berndt, M. C., Kahn, M. L., and Newman, P. J. (2006) Blood 108, 908–914[Abstract/Free Full Text]
  37. Morton, L. F., Hargreaves, P. G., Farndale, R. W., Young, R. D., and Barnes, M. J. (1995) Biochem. J. 306, 337–344[Medline] [Order article via Infotrieve]
  38. Grobelny, D., Poncz, L., and Galardy, R. E. (1992) Biochemistry 31, 7152–7154[CrossRef][Medline] [Order article via Infotrieve]
  39. Andrews, R. K., Munday, A. D., Mitchell, C. A., and Berndt, M. C. (2001) Blood 98, 681–687[Abstract/Free Full Text]
  40. Gardiner, E., Karunakaran, D., Shen, Y., Arthur, J., Andrews, R., and Berndt, M. (2007) J. Thromb. Haemost. 5, 1530–1537[CrossRef][Medline] [Order article via Infotrieve]
  41. Stomski, F. C., Sun, Q., Bagley, C. J., Woodcock, J., Goodall, G., Andrews, R. K., Berndt, M. C., and Lopez, A. F. (1996) Mol. Cell. Biol. 16, 3035–3046[Abstract]
  42. Kadokura, H., Tian, H., Zander, T., Bardwell, J. C., and Beckwith, J. (2004) Science 303, 534–537[Abstract/Free Full Text]
  43. Locke, D., Liu, C., Peng, X., Chen, H., and Kahn, M. L. (2003) J. Biol. Chem. 278, 15441–15448[Abstract/Free Full Text]
  44. Andrews, R. K., Gardiner, E. E., Asazuma, N., Berlanga, O., Tulasne, D., Nieswandt, B., Smith, A. I., Berndt, M. C., and Watson, S. P. (2001) J. Biol. Chem. 276, 28092–28097[Abstract/Free Full Text]
  45. Pasquet, J. M., Bobe, R., Gross, B., Gratacap, M. P., Tomlinson, M. G., Payrastre, B., and Watson, S. P. (1999) Biochem. J. 342, 171–177[CrossRef][Medline] [Order article via Infotrieve]
  46. Rabie, T., Varga-Szabo, D., Bender, M., Pozgaj, R., Lanza, F., Saito, T., Watson, S. P., and Nieswandt, B. (2007) Blood 110, 529–535[Abstract/Free Full Text]
  47. Andrews, R. K., Suzuki-Inoue, K., Shen, Y., Tulasne, D., Watson, S. P., and Berndt, M. C. (2002) Blood 99, 4219–4221[Abstract/Free Full Text]
  48. Guo, W., Shi, L., and Javitch, J. A. (2003) J. Biol. Chem. 278, 4385–4388[Abstract/Free Full Text]
  49. Powell, M. S., Barnes, N. C., Bradford, T. M., Musgrave, I. F., Wines, B. D., Cambier, J. C., and Hogarth, P. M. (2006) J. Immunol. 176, 7489–7494[Abstract/Free Full Text]
  50. Maxwell, K. F., Powell, M. S., Hulett, M. D., Barton, P. A., McKenzie, I. F., Garrett, T. P., and Hogarth, P. M. (1999) Nat. Struct. Biol. 6, 437–442[CrossRef][Medline] [Order article via Infotrieve]
  51. Moroi, M., Jung, S. M., Okuma, M., and Shinmyozu, K. (1989) J. Clin. Investig. 84, 1440–1445[Medline] [Order article via Infotrieve]
  52. Arai, M., Yamamoto, N., Moroi, M., Akamatsu, N., Fukutake, K., and Tanoue, K. (1995) Br. J. Haematol. 89, 124–130[Medline] [Order article via Infotrieve]
  53. Smethurst, P. A., Onley, D. J., Jarvis, G. E., O'Connor, M. N., Knight, C. G., Herr, A. B., Ouwehand, W. H., and Farndale, R. W. (2007) J. Biol. Chem. 282, 1296–1304[Abstract/Free Full Text]
  54. Kato, K., Furihata, K., Cheli, Y., Radis-Baptista, G., and Kunicki, T. J. (2006) J. Thromb. Haemost. 4, 1107–1113[CrossRef][Medline] [Order article via Infotrieve]
  55. Cvejic, S., and Devi, L. A. (1997) J. Biol. Chem. 272, 26959–26964[Abstract/Free Full Text]
  56. Kato, M., Iwashita, T., Takeda, K., Akhand, A. A., Liu, W., Yoshihara, M., Asai, N., Suzuki, H., Takahashi, M., and Nakashima, I. (2000) Mol. Biol. Cell 11, 93–101[Abstract/Free Full Text]
  57. Takeda, K., Kato, M., Wu, J., Iwashita, T., Suzuki, H., Takahashi, M., and Nakashima, I. (2001) Antioxid. Redox Signal. 3, 473–482[CrossRef][Medline] [Order article via Infotrieve]
  58. Hisamitsu, T., Pang, T., Shigekawa, M., and Wakabayashi, S. (2004) Biochemistry 43, 11135–11143[CrossRef][Medline] [Order article via Infotrieve]
  59. Cumming, R. C., Andon, N. L., Haynes, P. A., Park, M., Fischer, W. H., and Schubert, D. (2004) J. Biol. Chem. 279, 21749–21758[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/42/30434    most recent
M701330200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arthur, J. F.
Right arrow Articles by Gardiner, E. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arthur, J. F.
Right arrow Articles by Gardiner, E. E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement