Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M702535200 on August 29, 2007

J. Biol. Chem., Vol. 282, Issue 42, 30509-30517, October 19, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/42/30509    most recent
M702535200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marron, M. B.
Right arrow Articles by Brindle, N. P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marron, M. B.
Right arrow Articles by Brindle, N. P. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Regulated Proteolytic Processing of Tie1 Modulates Ligand Responsiveness of the Receptor-tyrosine Kinase Tie2*

Marie B. Marron{ddagger}12, Harprit Singh{ddagger}1, Tariq A. Tahir{ddagger}, Jais Kavumkal{ddagger}, Hak-Zoo Kim§, Gou Young Koh§, and Nicholas P. J. Brindle{ddagger}3

From the {ddagger}Department of Cardiovascular Sciences, University of Leicester, Robert Kilpatrick Clinical Sciences Bld., P. O. Box 65, Leicester, LE2 7LX United Kingdom and §Biomedical Center and Department of Biological Sciences, Korea Advanced Institute of Science and Technology, 373-1, Guseong-dong, Daejeon 305-701, Korea

Received for publication, March 23, 2007 , and in revised form, August 29, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Regulated ectodomain shedding followed by intramembrane proteolysis has recently been recognized as important in cell signaling and for degradation of several type I transmembrane proteins. The receptor-tyrosine kinase Tie1 is known to undergo ectodomain cleavage generating a membrane-tethered endodomain. Here we show Tie1 is a substrate for regulated intramembrane proteolysis. After Tie1 ectodomain cleavage the newly formed 45-kDa endodomain undergoes additional proteolytic processing mediated by {gamma}-secretase to generate an amino-terminal-truncated 42-kDa fragment that is subsequently degraded by proteasomal activity. This sequential processing occurs constitutively and is stimulated by phorbol ester and vascular endothelial growth factor. To assess the biological significance of regulated Tie1 processing, we analyzed its effects on angiopoietin signaling. Activation of ectodomain cleavage causes loss of phosphorylated Tie1 holoreceptor and generation of phosphorylated receptor fragments in the presence of cartilage oligomeric protein angiopoietin 1. A key function of {gamma}-secretase is in preventing accumulation of these phosphorylated fragments. We also find that regulated Tie1 processing modulates ligand responsiveness of the Tie-1-associated receptor Tie2. Activation of Tie1 ectodomain cleavage increases cartilage oligomeric protein angiopoietin 1 activation of Tie2. This correlates with increased ability of Tie2 to bind ligand after shedding of the Tie1 extracellular domain. A similar enhancement of ligand activation of Tie2 is seen when Tie1 expression is suppressed by RNA interference. Together these data indicate that Tie1, via its extracellular domain, limits the ability of ligand to bind and activate Tie2. Furthermore the data suggest that regulated processing of Tie1 may be an important mechanism for controlling signaling by Tie2.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Regulated sequential proteolytic processing has recently emerged as an important mechanism in signal transduction and degradation of transmembrane proteins (1, 2). Such processing has been described for a number of transmembrane proteins, including Notch, amyloid precursor protein and the receptortyrosine kinase ErbB-4 and involves an initial metalloprotease-mediated ectodomain shedding followed by secondary cleavage of the remaining membrane-associated fragment (3–8). These sequential cleavage events have been designated RIP4 for regulated intramembrane proteolysis (1, 2).

The initiating and key regulatory step in RIP is ectodomain cleavage, and in most cases this is catalyzed by members of a disintegrin and metalloprotease (ADAM) family, although matrix metalloproteases and the aspartyl proteases beta-site amyloid precursor protein-cleaving enzymes 1 and 2 have also been implicated to a lesser degree (9, 10). For both Notch and ErbB-4 ectodomain shedding requires ADAM17, also known as tumor necrosis factor-{alpha}-converting enzyme (TACE) (4, 11). This protease has also been implicated in beta-amyloid precursor protein cleavage (6). After loss of ectodomain, the remaining transmembrane and intracellular domain fragments of RIP substrates are cleaved by the {gamma}-secretase complex to release the intracellular domain into the cytosol (1, 2). The {gamma}-secretase complex comprises catalytic presenilin 1 or 2 together with nicastrin, Pen-2, and Aph-1 (12). Released intracellular domains for some proteins can modulate cell function and for these RIP constitutes a key signal transduction mechanism, communicating events at the plasma membrane with intracellular compartments. For example, once released from the membrane, the intracellular domain of Notch translocates to the nucleus where it modulates transcription (5, 13).

The receptor-tyrosine kinase Tie1 undergoes regulated ectodomain proteolysis (14). A metalloprotease cleaves the receptor ectodomain, generating a 45-kDa membrane-anchored Tie1 endodomain that comprises the transmembrane and intracellular portions of the receptor (15, 16). It is not known how, or indeed even if this endodomain is further processed. 45-kDa Tie1 endodomain is found in tissues in which angiogenesis and vessel remodeling occurs, such as placenta (15), and it has also been reported in breast tumors (17). Ectodomain cleavage of Tie1 is stimulated by phorbol ester, vascular endothelial growth factor (VEGF), tumor necrosis factor-{alpha}, and changes in shear stress (16, 18).

Tie1 is expressed primarily in vascular endothelial cells where it is essential for blood vessel formation and maintenance (19). Targeted disruption of the TIE1 gene in mice indicates the receptor has roles in the later stages of blood vessel development where it is required for vessel maturation and stability, and mice deficient in Tie1 die between midgestation and around the time of birth with severe hemorrhage and edema due to vessel wall defects (20–22). Expression of Tie1 persists in adult vasculature (23), and it is up-regulated in situations of disturbed flow (24). Despite its importance, the cellular functions and signaling pathways regulated by this receptor are poorly understood, principally because a ligand capable of binding and activating Tie1 has not yet been identified. However the receptor is known to interact physically with the closely related receptor-tyrosine kinase Tie2, and the two receptors exist in hetero-oligomeric complexes at the cell surface (18, 25, 26). The Tie2 receptor appears to be more active than Tie1 and regulates several endothelial functions including promotion of endothelial survival, migration, and suppression of monolayer permeability (27). Tie2 is stimulated by the ligand angiopoietin-1 (Ang1), one of a family of four ligands, Ang1–4, identified for Tie2 (28–30). These secreted glycoproteins have a coiled:coil region in their amino-terminal domain and a carboxyl-terminal fibrinogen-related domain (28–30). Binding to Tie2 occurs via the fibrinogen-related domain, and the coiled: coil motifs are required for homo-oligomerization of the ligands (31). Stimulation of Tie2 by Ang1 results in tyrosine phosphorylation of the receptor and activation of downstream signaling intermediates including phosphatidylinositol 3-kinase and Akt (32, 33). Recently, Ang1 has also been found to activate Tie1 (26). The ligand appears unable to bind directly to the Tie1 extracellular domain (28), and the principal route of activation may be via transphosphorylation by Ang1-activated Tie2, although Ang1 is also able to partially activate Tie1 in the absence of Tie2 by an unknown mechanism (26).

Regulated ectodomain cleavage of Tie1 was originally described 10 years ago (14); however, its biological significance still remains unclear. In this study we investigate the possibility that Tie1 may be a new RIP substrate undergoing regulated sequential proteolysis. Furthermore, we seek to define the biological significance of regulated Tie1 processing.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents—TAPI-2, lactacystin, and N-acetyl-Leu-Leu-Nle-CHO (ALLN) were purchased from Calbiochem. Sulfo-NHS-SS-biotin was from Pierce. The {gamma}-secretase inhibitors L-685,458 and L-405,484 were kind gifts from Merck Sharp and Dohme (The Neuroscience Research Centre), and L-685,458 was also purchased from Calbiochem. Affinity-purified polyclonal antibodies raised against the carboxyl terminus of Tie1 were obtained from Santa Cruz Biotechnology, Inc. Anti-Tie1 and Tie2 ectodomain antibodies were from R & D Systems. Anti-phospho-Tyr-1102/1108-Tie2 was from Merck, and antibodies against Akt and phospho-Ser-473-Akt were from Cell Signaling Technology. VEGF-A165 was purchased from Pepro-Tech. Comp-Ang1, an Ang1 variant with improved stability, has been described previously (34). All other reagents were as described previously (26).

Cells—Human dermal microvascular endothelial cells (HMEC-1) have been described by Ades et al. (35) and were obtained from the Centers for Disease Control and Prevention (Atlanta, GA). HMEC-1 were maintained in MCDB 131 containing 100 µg/ml streptomycin, 100 units/ml penicillin, 10% fetal calf serum, 2 mM L-glutamine, 10 ng/ml EGF, and 1 µg/ml cortisol. Human umbilical vein endothelial cells (HUVEC) were isolated as previously described (25) and maintained in Medium 199 containing 100 µg/ml streptomycin, 100 units/ml penicillin, 20% fetal calf serum, 5 units/ml heparin, and 50 µg/ml endothelial cell growth supplement. Before experiments, cells were washed in PBS and incubated in serum-free medium for 30 min. Unless otherwise stated PMA was used at a final concentration of 10 ng/ml, VEGF at 100 ng/ml, L-658,458 at 20 nM, TAPI-2 at 100 µM, lactacystin at 20 µM, ALLN at 10 µM, and COMP-Ang1 at 340 ng/ml.

Immunoblotting—Cells were washed in PBS and lysed with ice-cold lysis buffer (50 mM Tris, pH 7.4, 50 mM NaCl, 1 mM sodium fluoride, 1 mM EGTA, 1 mM sodium orthovanadate, 1% TritonX-100, complete protease inhibitor mixture), cleared of particulate material by centrifugation at 13,000 x g for 10 min, and assayed for protein content. In some experiments, indicated under "Results," the cell-impermeable cross-linker 3,3'-dithiobis(sulfosuccinimidylpropionate) was added to a final concentration of 0.5 mM in PBS for 30 min before quenching with 20 mM Tris in PBS, washing, and cell lysis. For analysis of whole cell proteins, lysates were mixed with Laemmli sample buffer containing 100 mM dithiothreitol and boiled for 5 min. In some cases whole cell lysates were prepared by direct addition of Laemmli sample buffer containing 100 mM dithiothreitol. Equal amounts of protein were resolved by SDS-PAGE. For immunoprecipitates, lysates containing equal amounts of protein were pre-cleared by incubation with protein-G-agarose for 30 min and centrifuged at 13,000 x g for 5 min, and the supernatants were removed and immunoprecipitated by the addition of 2 µg of the indicated antibody for 2–3 h in the presence of protein-G-agarose. Immunoprecipitates were recovered by centrifugation at 13,000 x g for 5 min and washed 3 times with wash buffer (as lysis buffer but with 0.1% Triton X-100). Proteins were eluted by the addition of Laemmli sample buffer containing 100 mM dithiothreitol and boiled for 5 min before SDS/PAGE. Proteins were transferred to nitrocellulose membranes and probed with the antibodies indicated. Immunoreactive proteins were visualized with peroxidase-conjugated secondary antibodies and chemiluminescent detection (36).

Release of Cell Surface Tie1 Ectodomain—Cells were washed in PBS and incubated for 30 min on ice with 250 ng/ml sulfo-NHS-SS-biotin in PBS to label cell surface proteins. Cells were then washed 3 times in ice-cold medium containing 0.1% bovine serum albumin, and the reaction was quenched in 10 mM HEPES, pH 7.4 150 mM NaCl, 0.7 mM CaCl2, 0.5 mM MgCl2, and rinsed in PBS before incubation at 37 °C in serum-free medium. At the times indicated under "Results" medium was removed and centrifuged, and released biotinylated proteins were recovered by incubation with streptavidin-agarose, resolved by SDS/PAGE, and detected by immunoblotting. Total cell surface-biotinylated receptor was determined by lysing cells at time 0, recovering biotinylated protein, SDS/PAGE, and immunoblotting as above.

Receptor Internalization—To measure receptor internalization, cell surface proteins were biotinylated by washing cells in PBS and incubating for 30 min on ice with 250 ng/ml sulfo-NHS-SS-biotin in PBS. Cells were then washed 3 times in ice-cold medium containing 0.1% bovine serum albumin, and the reaction was quenched in 10 mM HEPES, pH 7.4 150 mM NaCl, 0.7 mM CaCl2, 0.5 mM MgCl2, and rinsed in PBS. Internalization was initiated by incubation at 37 °C in serum-free medium. Internalization was terminated by placing cells on ice, and the remaining surface proteins were debiotinylated by incubating for three 20-min periods in 100 mM mercaptoethanesulfonic acid in 50 mM Tris, pH 8.6, 100 mM NaCl, 1 mM EDTA, 0.2% bovine serum albumin. Cells were then washed with Hepes-buffered saline and quenched in 100 mM iodoacetamide for 10 min before washing again in Hepes-buffered saline and cell lysis. Internalized biotinylated proteins were recovered with streptavidin-agarose before SDS/PAGE and immunoblotting.

Immunofluorescence—Receptors were examined at the cell surface by immunofluorescence. To aid in visualization, receptors were patched using a technique similar to that described by Constantinescu et al. (37), except endogenous receptors were examined. Essentially, endothelial cells were grown on cover-slips as previously described (38). After treatment with control vehicle or PMA, as indicated under "Results," cells were placed on ice, medium was removed, and cells were washed in ice-cold PBS and incubated for 10 min in ice-cold blocking medium (Dulbecco's modified Eagle's medium containing 2% (w/v) bovine serum albumin and 2% donkey serum). Tie1 or Tie2 were labeled by the addition of antibodies recognizing receptor ectodomains in blocking medium and incubated for 40 min on ice before washing in Dulbecco's modified Eagle's medium and incubation with fluorescently labeled secondary antibody for 40 min. After washing cells were fixed in 4% (w/v) formalin and viewed under an Olympus BH2 microscope with epifluorescence. Images were captured by CCD camera (Digital Pixel) and IP Lab Software (Scanalytics).

siRNA Transfections—Annealed, purified, and desalted double-stranded siRNA oligonucleotides against Tie1 (AGGAGAAGCAGACAGACGUGAUCUGGA), Tie2 (CGAACCAUGAAGAUGCGUCAACAAGCU), and control randomized siRNA (AGUCCAUAAUGAGAAUCAACCGAUUAU) were obtained from MWG Biotech. In experiments with siRNA-transfected cells, endothelial cells at ~80% confluence were transfected with 100 nM siRNA using Lipofectamine as directed in the manufacturer's protocol 48 h before treatments and cell lysis. Transfection efficiency was greater than 90% as judged by rhodamine-conjugated double-stranded siRNA.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Tie1 has been reported to undergo regulated proteolytic cleavage of its extracellular domain to generate a cell-associated receptor fragment of ~45 kDa composed of the transmembrane and intracellular domains (14–16). In experiments aimed at determining whether any additional truncation products were generated in cells, we noted the presence of another Tie1 immunoreactive species of ~42 kDa on prolonged exposure of immunoblots in which proteins have been well resolved. An example of this is shown in Fig. 1A for HMEC-1 cells stimulated with PMA. The doublet of ~145 kDa, representing an upper band of fully glycosylated surface-expressed and a lower band of intracellular partially glycosylated full-length Tie1 destined for the cell surface as well as the 45-kDa truncation product has been described previously (14–16). Consistent with previous reports we find PMA to stimulate loss of the upper 145-kDa band and increased 45-kDa Tie1 (Fig. 1A). In addition, a 42-kDa protein was observed in both control and stimulated cells, although the level was consistently higher in stimulated cells. Similar observations were made with HUVEC after activation with VEGF (Fig. 1B). Again, VEGF stimulated loss of the upper 145-kDa Tie1 band, although not as extensively as PMA treatment, as well as increasing 45-kDa Tie1. It is noteworthy that scanning blots from a number of experiments revealed a slight decrease in the intracellular, lower 145-kDa Tie1 band in response to both PMA and VEGF (Fig. 1, A and B, lower panels). Presumably this reflects increased mobilization of this precursor form to the cell surface and subsequent cleavage. The 42-kDa protein was present at low levels compared with full-length and 45-kDa Tie1. Under basal conditions the upper 145-, lower 145-, 45-, and 42-kDa forms of Tie1 accounted for 36.4 ± 2.4, 36.6 ± 1.9, 21.2 ± 3.9, and 5.6 ± 2 (mean and standard error) of total Tie1 respectively, determined by densitometric scanning of blots from 7 different experiments.


Figure 1
View larger version (42K):
[in this window]
[in a new window]

  		FIGURE 1.
Tie1 cleavage products in endothelial cells stimulated with phorbol ester or VEGF. A, HMEC-1 were challenged with control vehicle (Cont.) or PMA as indicated for 30 min. B, HUVEC were challenged with control vehicle (Cont.) or VEGF as indicated for 30 min. Cells were lysed, and proteins were resolved by SDS/PAGE as detailed under "Experimental Procedures." Tie1 was detected by immunoblotting with an antibody recognizing the carboxyl terminus of the protein. VEGF and PMA induced cleavage of full-length Tie1 (indicated by an asterisk) resulting in increased levels of 45-kDa Tie1 endodomain (indicated by a single-headed arrow) and an additional 42-kDa Tie1 truncation product (indicated by an arrowhead). A nonspecific band is indicated by ns and has previously been reported (15). The relative mobilities of molecular mass markers are indicated in kDa. Below each blot the region around 45-kDa Tie1 is shown, exposed to film for increased time to aid in visualization of 42-kDa Tie1. The percentage change in the upper 145-kDa (U), lower 145-kDa (L), and 45- and 42-kDa forms of Tie1 in response to PMA (lower panel A) or VEGF (lower panel B) was quantitated by scanning immunoblots from four and three independent experiments, respectively. Data are presented as the means and S.E. Changes in the upper 145-, 45-, and 42-kDa Tie1 were statistically significant compared with control (p < 0.05, Student's t test).

 
The finding of a 42-kDa form of Tie1 suggested that the 45-kDa Tie1 endodomain may undergo further proteolytic processing. Recent studies have revealed that for a number of proteins that undergo ectodomain shedding the resulting endodomain is subjected to additional proteolytic cleavage, giving rise to further truncation products (39–45). A potential candidate for this secondary cleavage event is the {gamma}-secretase complex. Inhibitors of {gamma}-secretase activity have been shown to suppress generation of truncated endodomain leading to accumulation of the membrane-bound substrate (45, 46). Therefore, we investigated whether {gamma}-secretase plays a role in the proteolytic processing of the Tie1 endodomain by using L-685,458, a {gamma}-secretase inhibitor (47). Endothelial cells were treated with different concentrations of the {gamma}-secretase inhibitor, and Tie1 endodomain was examined by immunoblotting. In unstimulated endothelial cells, the {gamma}-secretase inhibitor caused an accumulation of the 45-kDa endodomain in a concentration-dependent manner (Fig. 2A). Suppression of ectodomain shedding by treatment of endothelial cells with metalloprotease inhibitor TAPI-2 blocked the effect of {gamma}-secretase inhibitor on 45-kDa endodomain accumulation (Fig. 2B). The {gamma}-secretase inhibitor also further increased 45-kDa endodomain levels and caused loss of the 42-kDa form of Tie1 in endothelial cells stimulated with VEGF (Fig. 2C). This suppression of proteolysis of the 45-kDa Tie1 endodomain was not observed when cells were incubated in the presence of similar concentrations of L-405,484 (data not shown), a derivative of L-685,458, with 105 times less inhibitory potency (47). Together these data show that Tie1 undergoes multiple processing steps involving initial ectodomain shedding followed by {gamma}-secretase-mediated cleavage of the endodomain that is generated. This processing occurs constitutively at a basal rate and is stimulated by PMA and VEGF.

Although inhibition of {gamma}-secretase was found to result in accumulation of the 45-kDa Tie1 endodomain, the 42-kDa product of the cleavage was present at low levels, often barely detectable in unstimulated cells. This suggests the cleavage product may be readily degraded after formation. To test this, endothelial cells where treated with the proteasomal inhibitors ALLN or lactacystin. Both compounds produced an accumulation of the 42-kDa Tie1 intracellular domain (Fig. 2D). ALLN appeared also to have some effects on 45-kDa Tie1 consistent with partial inhibition of {gamma}-secretase, and others have previously reported some inhibitory effects of this compound on {gamma}-secretase (48). Inhibition of lysosomal function by incubation with NH4Cl did not result in accumulation of any detectable cleavage products (data not shown). The antibody used to detect 45- and 42-kDa Tie1 in these experiments recognizes the carboxyl terminus of the receptor. Therefore, the carboxyl-terminal regions of 45 and 42 kDa Tie1 are intact, signifying that 45-kDa Tie1 must be truncated at its amino terminus to generate the 42-kDa form. These data indicate that {gamma}-secretase-mediated processing of Tie1 endodomain produces an amino-terminal truncated 42-kDa form of Tie1 that is readily eliminated by proteasomal degradation.


Figure 2
View larger version (65K):
[in this window]
[in a new window]

  		FIGURE 2.
Tie1 undergoes {gamma}-secretase-mediated cleavage after ectodomain processing. A, HUVEC were challenged with the indicated concentrations of the {gamma}-secretase inhibitor L-685,458 for 4 h before lysis. Proteins were resolved by SDS/PAGE, and Tie1 was detected with an antibody recognizing the carboxyl terminus of the protein. B, endothelial cells were treated with the metalloprotease inhibitor TAPI-2 for 12 h followed by L-658,458 for 4 h (TAPI+Inhib.), L-658,458 for 4 h followed by TAPI-2 for 12 h (Inhib.+TAPI), or L-658,458 for 4 h (Inhib.). Cells were then lysed, proteins were resolved by SDS/PAGE, and Tie1 was detected by immunoblotting. C, endothelial cells were untreated or treated with L-685,458 (Inhib.) for 4 h and then treated with control vehicle (Cont.) or 100 ng/ml VEGF as indicated for the final 30 min of incubation. Cells were lysed, proteins were resolved by SDS/PAGE, and Tie1 was detected by immunoblotting. The position of full-length Tie1 is indicated by an asterisk, the Tie1 45-kDa endodomain is indicated by single-headed arrow, and the 42-kDa Tie1 fragment is indicated by an arrowhead. Below blot C the region around 45-kDa Tie1 is shown exposed to film for increased time to aid visualization of 42-kDa Tie1. D, endothelial cells were incubated with control vehicle (Cont.), L-685,458 (Inhib.), ALLN, or lactacystin (Lact.) for 4 h as indicated. Cells were then lysed, and proteins were resolved by SDS/PAGE. Tie1 was detected by immunoblotting.

 
It was important to determine the kinetics and extent to which Tie1 undergoes ectodomain cleavage in endothelial cells. To do this cell surface protein was biotinylated at 4 °C, and after quenching of the biotinylation reaction, cells were brought to 37 °C. Cleaved Tie1 ectodomain released into the medium was recovered at various times with streptavidin-agarose, resolved by SDS/PAGE, and visualized by immunoblotting with anti-Tie1 ectodomain antibodies. Biotinylated Tie1 ectodomain of ~100 kDa was released from the endothelial surface in a time-dependent manner (Fig. 3A). In a series of 3 independent experiments, we found 96 ± 4% of initial cell surface Tie1 to have been released from cells within 10 min. Ectodomain release was not affected by Ang1 (data not shown); however, the initial rate of Tie1 ectodomain release was increased by PMA (Fig. 3A, lower panel). In contrast to Tie1, we could detect no release of Tie2 ectodomain from cells under the conditions of this study either in unstimulated or PMA-activated cells, although biotinylated Tie2 could clearly be detected on the endothelial cells (Fig. 3A, middle panel).


Figure 3
View larger version (44K):
[in this window]
[in a new window]

  		FIGURE 3.
Kinetics of Tie1 cleavage and internalization. A, HUVEC cell surface proteins were biotinylated at 4 °C as described under "Experimental Procedures" before incubation at 37 °C in the absence or presence of PMA as indicated. At the times indicated the medium was removed, and biotinylated proteins were recovered from the medium on streptavidin-agarose and resolved by SDS/PAGE, and Tie1 or Tie2 were detected by immunoblotting. C, control vehicle. Cell lysates were also prepared at time 0, and biotinylated receptor was recovered and detected as above (TB). The amount of released Tie1 ectodomain was quantitated by scanning blots from three independent experiments and is presented in the graph as the mean and S.E. and is shown as the percentage of cell surface-biotinylated Tie1 at time 0 for cells treated with control vehicle ({blacksquare}) and PMA ({blacktriangleup}). B, internalization of Tie1 was determined as described under "Experimental Procedures" in the absence and presence of PMA at the times indicated. Internalized Tie1 was quantitated by scanning blots from three independent experiments and is presented in the graph as the mean and S.E. and is shown as the percentage of cell surface-biotinylated Tie1 at time 0 for cells treated with control vehicle ({blacksquare}) and PMA ({blacktriangleup}). C, internalization of Tie1 was determined as described under "Experimental Procedures" in the absence and presence of Ang1 at the times indicated. Internalized Tie1 was quantitated by scanning blots from three independent experiments, presented in the graph as the mean and S.E., and is shown as the percentage of cell surface-biotinylated Tie1 at time 0 for cells treated with control vehicle ({blacksquare}) and Ang1 ({blacktriangledown}). The position of full-length Tie1 is indicated by an asterisk, and the released Tie1 ectodomain is indicated by a double-headed arrow. The relative mobilities of molecular mass markers are indicated in kDa.

 
Another potential mechanism by which Tie1 could be lost from the cell surface is via receptor internalization. To examine this, further experiments were performed. Again, cell surface protein was biotinylated at 4 °C, and after quenching of the biotinylation reaction, cells were brought to 37 °C. At various times cells were returned to 4 °C, and biotin was stripped from the cell surface before lysis and recovery of the remaining (internalized) biotinylated proteins with streptavidin-agarose beads followed by SDS/PAGE and detection of Tie1 by immunoblotting. As shown in Fig. 3B, internalized Tie1 was detected at low levels and was similar under basal and PMA-stimulated conditions. Tie2 internalization was also detected and again was similar in the absence and presence of PMA (Fig. 3B, middle panel). Quantitation of Tie1 internalization in 3 independent experiments demonstrated low levels of internalization, with 8.5 ± 1.1% of initial surface receptor being internalized within 10 min. Together with the results presented in Fig. 3A, these data indicate that the predominant mechanism for removal of Tie1 from the cell surface is ectodomain cleavage. Additional experiments performed in parallel showed Tie1 internalization was not influenced by Ang1 (Fig. 3C). This contrasted to the situation with Tie2, where in 3 independent experiments we found 22.0 ± 1.5% of initial cell surface Tie2 was internalized in 10 min under basal conditions, and this was increased to 47.9 ± 9.6% in the presence of ligand.


Figure 4
View larger version (53K):
[in this window]
[in a new window]

  		FIGURE 4.
Effects of Tie1 ectodomain cleavage on phospho-Tie1. A, HMEC-1 were treated with control vehicle, COMP-Ang1 for 30 min, COMP-Ang1 (Ang1) for 30 min in the presence of PMA for the final 15 min of incubation before cell lysis and immunoprecipitation of Tie1 with an antibody recognizing the intracellular domain. B, HMEC-1 were transfected with control siRNA or siRNA directed against Tie2 as indicated. 48 h post-transfection cells were stimulated with COMP-Ang1 for 30 min in the presence of PMA before cell lysis and immunoprecipitation of Tie1 with an antibody recognizing the intracellular domain. C, control vehicle. C, HMEC-1 were treated with control vehicle, COMP-Ang1 for 30 min, COMP-Ang1 for 30 min in the presence of PMA or PMA and L-685,458 (Inhib.) as indicated before cell lysis and immunoprecipitation of Tie1 with an antibody recognizing the intracellular domain. Blots were probed with anti-phosphotyrosine (PY) and anti-Tie1 (Tie1) as indicated. In panel B whole cell lysates were probed for Tie2 as indicated. The relative mobilities of molecular mass markers are shown in kDa. Note: blots in panel C were exposed to film for a shorter period than blots in panels A and B to observe differences in band intensities compared with the Inhib. track.

 
Recently it has been found that Tie1 can be activated by the ligand Ang1 (26). We, therefore, sought to determine the biological significance of regulated Tie1 processing for signaling by Ang1. Cells were stimulated with COMP-Ang1, and ectodomain cleavage was induced by the addition of PMA before cell lysis and immunoprecipitation of Tie1. COMP-Ang1 did not stimulate cleavage, but cleavage could still occur in the presence of Ang1 in response to PMA (Fig. 4A). To examine the impact of Tie1 cleavage on receptor activation, we analyzed tyrosine phosphorylation status of immunoprecipitated receptor. COMP-Ang1 stimulated tyrosine phosphorylation of full-length Tie1 with little effect on phosphorylation of truncation products (Fig. 4A). However, when PMA was added to induce cleavage there was a loss of the phosphorylated full-length receptor and a concomitant appearance of tyrosine-phosphorylated truncation products, predominantly the 45-kDa cleavage product (Fig. 4A). To test the role of Tie2 in phosphorylation of Tie1 cleavage products, we examined 45- and 42-kDa tyrosine phosphorylation in cells in which expression of Tie2 was suppressed by transfection with siRNA (Fig. 4B). In the absence of Tie2, Tie1 truncation products exhibited markedly decreased tyrosine phosphorylation.

The finding that the cell-associated products of Tie1 ectodomain shedding were tyrosine-phosphorylated suggested that an important function of {gamma}-secretase processing may be to prevent accumulation of phosphorylated Tie1 fragments. This was investigated by examining tyrosine phosphorylation status of the truncated receptor immunoprecipitated from cells in which {gamma}-secretase was inhibited (Fig. 4C). Under basal conditions 45-kDa Tie1 was present and had virtually undetectable levels of tyrosine phosphorylation. As before, activation of cells with COMP-Ang1 alone had little effect on phosphorylation of truncation products; however, phospho-Tie1 cleavage products, primarily 45-kDa Tie1, were evident when cells were stimulated with ligand in the presence of PMA to induce ectodomain cleavage. {gamma}-Secretase inhibition led to a dramatic increase in accumulation of tyrosine-phosphorylated 45-kDa Tie1 in Ang1 stimulated cells in which ectodomain cleavage was activated by PMA (Fig. 4C). Together these data show that in the presence of Ang1, Tie1 cleavage results in the loss of full-length receptor and the corresponding formation of phosphorylated cell-associated truncation products, predominantly 45-kDa Tie1. Furthermore, they demonstrate that a key function of {gamma}-secretase is to limit accumulation of the truncated Tie1 phosphoproteins.

Because Tie1 interacts with Tie2 in endothelial cells (18, 25, 26), we hypothesized that a further biological consequence of regulated Tie1 processing, specifically ectodomain release, would be to modulate Ang1 signaling through Tie2. To investigate this, endothelial cells were activated with COMP-Ang1, and Tie1 ectodomain cleavage was induced by the addition of PMA. Tie2 was immunoprecipitated, and its phosphorylation status was determined by immunoblotting (Fig. 5, A and B). Tie1 ectodomain cleavage resulted in a marked increase in COMP-Ang1-induced Tie2 phosphorylation, and this was inhibited if Tie1 cleavage was prevented by inclusion of TAPI-2 (Fig. 5, A and B). To discount the possibility that the effects on Tie2 activation are due to increased access of the immunoprecipitating antibody to Tie2, similar experiments were performed, except that Tie2 phosphorylation status was assessed directly without prior immunoprecipitation by anti-phospho-Tie2 immunoblotting. Again, ectodomain cleavage resulted in increased COMP-Ang1-induced Tie2 phosphorylation (Fig. 5C). These data show that a key biological effect of regulated Tie1 cleavage is to modulate ligand activation of Tie2. To test whether a physiological activator of Tie1 cleavage affects ligand activation of Tie2 similarly to PMA, we examined the effect of VEGF. Tie1 cleavage was activated by VEGF, although not as extensively as with PMA (Fig. 5D). In the presence of VEGF, there was an increase in COMP-Ang1-induced Tie2 phosphorylation, and this was inhibited if Tie1 cleavage was blocked by inclusion of TAPI-2 (Fig. 5, D and E).


Figure 5
View larger version (40K):
[in this window]
[in a new window]

  		FIGURE 5.
Tie1 ectodomain cleavage enhances ligand-activation of Tie2. A, HMEC-1 were treated with control vehicle, COMP-Ang1 for 30 min, and COMP-Ang1 for 30 min in the presence of PMA with or without TAPI-2 as indicated before cell lysis. Tie1 was detected in whole cell lysates by immunoblotting. Tie2 was immunoprecipitated, and blots were probed with anti-phosphotyrosine (pTie2) and Tie2. B, the effects of PMA-induced Tie1 cleavage were determined in three independent experiments, and phospho-Tie2 was quantitated by scanning of blots. C, endothelial cells were treated as indicated before preparation of cell lysates. Phospho-Tie2 (pTie2) and Tie2 were detected by immunoblotting of whole cell lysates. D, HUVEC were treated with control vehicle, COMP-Ang1 for 30 min, and COMP-Ang1 for 30 min in the presence of VEGF with or without TAPI-2 as indicated before cell lysis. Tie1 was detected in whole cell lysates by immunoblotting. Tie2 was immunoprecipitated, and blots were probed with anti-phosphotyrosine (pTie2) and Tie2. E, the effects of VEGF-induced Tie1 cleavage were determined in three independent experiments, and phospho-Tie2 was quantitated by scanning of blots. Data are presented as the means and S.E. pTie2 is normalized to the level of Tie2 and shown as the percentage of maximal receptor phosphorylation. The asterisk indicates a statistically significant effect of PMA or VEGF (p < 0.05, Student's t test). The relative mobilities of molecular mass markers are shown in kDa.

 
We were interested in defining the mechanism by which Tie1 ectodomain cleavage enhances ligand activation of Tie2. As shown in Fig. 3, activation of Tie1 cleavage results in increased release of the receptor ectodomain from the cell surface causing loss of full-length Tie1, for example as seen in Fig. 1 and confirmed in Fig. 6A by immunoblotting. To visualize cell surface Tie1, we also used immunofluorescence microscopy, which revealed both Tie1 and Tie2 ectodomains present on the surface of cells in control conditions but predominantly only Tie2 at the surface of PMA activated cells (Fig. 6B). Based on these findings and the fact that Tie2 exists in hetero-oligomeric complex with Tie1 on the endothelial surface (18, 25, 26), we postulated that the extracellular domain of Tie1 can act to restrict the ability of Tie2 to access ligand. We further hypothesized that the mechanism by which ectodomain cleavage enhances ligand activation of Tie2 is by relieving this restriction. To test this we examined the ability of COMP-Ang1 to interact with Tie2 in cells in which Tie1 ectodomain cleavage was stimulated. Endothelial cells were treated with PMA to activate ectodomain cleavage or PMA but in the presence of TAPI-2 to prevent cleavage before challenging with COMP-Ang1 followed by retrieval of the ligand by immunoprecipitation. As shown in Fig. 6C, COMP-Ang1 bound more Tie2 from cells in which Tie1 ectodomain cleavage was activated than from cells treated similarly but in which ectodomain cleavage was prevented by TAPI-2. In three independent experiments this PMA-induced Tie1 cleavage led to a 53.6 ± 5.0% (p < 0.05, Student's t test) increase in the amount of Tie2 binding to ligand. Together these data show activation of ectodomain cleavage causes release of Tie1 extracellular domain from the cell surface and increases the ability of ligand to access and bind Tie2. This model predicts that, like ectodomain cleavage, removal of full-length Tie1 would also relieve restrictions on ligand accessing Tie2 and lead to enhancement of Tie2 activation. To test this we analyzed the effects of down-regulation of Tie1 by siRNA. Endothelial cells transfected with control siRNA or siRNA targeting Tie1 were activated with COMP-Ang1, and Tie2 phosphorylation status was determined. Cells transfected with Tie1 siRNA had virtually undetectable levels of Tie1 (Fig. 7A). COMP-Ang1 stimulated Tie2 phosphorylation in both control siRNA and Tie1 siRNA-transfected cells; however, the effect was significantly increased in cells lacking Tie1 (Fig. 7, A and B). Finally, to confirm that the enhancement of ligand activation of Tie2 seen on loss of Tie1 is transduced to downstream signaling, we examined the serine/threonine kinase Akt, a key mediator of angiopoietin-stimulated Tie2 action in endothelial cells (32, 33). COMP-Ang1 activated serine 473 phosphorylation in Akt (Fig. 7C). In the absence of Tie1 there was a dramatic amplification of the effects of the ligand on phospho-Akt levels (Fig. 7, C and D). Together with Fig. 6, these data show that Tie1 exerts an inhibitory effect on Tie2, acting to suppress ligand activation of the receptor. Loss of full-length Tie1 or even only Tie1 ectodomain is sufficient to relieve this inhibition thereby enhancing COMP-Ang1 activation of Tie2 and downstream signaling.


Figure 6
View larger version (67K):
[in this window]
[in a new window]

  		FIGURE 6.
Release of Tie1 ectodomain from the cell surface increases binding of COMP-Ang1 to Tie2. A, HMEC-1 were treated with control vehicle (C) or PMA for 30 min before collection of medium and cell lysis. Tie1 was detected in whole cell lysates (WCL) and medium by immunoblotting. B, cell surface expression of Tie1 and Tie2 was detected by immunofluorescence as described under "Experimental Procedures" using antibodies specific for Tie1 or Tie2 extracellular domains as indicated in cells treated with control vehicle or PMA for 30 min. C, cells treated for 30 min with PMA in the absence (AP) and presence (APT) of TAPI-2 were challenged with COMP-Ang1 for 15 min before removing media, cross-linking, and immunoprecipitation (IP) of COMP-Ang1 with anti-FLAG, which recognizes the amino-terminal epitope tag in the ligand. Immunoprecipitates were probed for bound Tie2, and its phosphorylation status was determined by anti-phosphotyrosine immunoblotting (pTie2). Whole cell lysates were also probed for Tie2 as indicated. The percentage increase in Tie2 binding to ligand in cells treated with PMA alone to induce Tie1 cleavage was quantitated by scanning blots of Tie2 co-immunoprecipitating with ligand in three independent experiments and is shown in the graph as the mean and S.E. Cells treated with PMA alone (solid bar) exhibited significantly increased binding of Tie2 to ligand compared with cells in which cleavage was inhibited (open bar). Asterisk indicates p < 0.05, Student's t test. The relative mobilities of molecular mass markers are shown in kDa.

 


Figure 7
View larger version (33K):
[in this window]
[in a new window]

  		FIGURE 7.
Down-regulation of Tie1 enhances COMP-Ang1-activation of Tie2. A, HMEC-1 were transfected with control (C) siRNA or siRNA directed against Tie1. 48 h post-transfection cells were stimulated with COMP-Ang1 for 30 min (as indicated), and Tie2 phosphorylation was determined by immunoblotting. B, the effects of down-regulation of Tie1 on COMP-Ang1 activation of Tie2 was determined in three independent experiments, and phospho-Tie2 was quantitated by scanning of blots. Data are presented as the means and S.E. pTie2 is normalized to the level of Tie2 and shown as the percentage of receptor phosphorylation in control siRNA (Si)-transfected cells stimulated with COMP-Ang1. C, HMEC-1 transfected with control siRNA or siRNA directed against Tie1 were stimulated with COMP-Ang1 for 30 min (as indicated), and phospho-Ser-473-Akt (pAkt) and Akt were examined by immunoblotting whole cell lysates. D, the effect of down-regulation of Tie1 on COMP-Ang1 activation of Akt was determined in three independent experiments, and phospho-Ser-473-Akt was quantitated by scanning of blots. Data are presented as the means and S.E. Phospho-Ser-473-Akt is normalized to the level of Akt and shown as the percentage of phospho-Akt in control siRNA-transfected cells stimulated with COMP-Ang1. The relative mobilities of molecular mass markers are shown in kDa. Asterisks indicate a statistically significant difference between control and Tie1 siRNA-transfected cells in response to COMP-Ang1 in panels B and D (p < 0.05, Student's t test).

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The present study extends the range of biological functions influenced by RIP and reveals a novel mechanism for regulating ligand responsiveness of the receptor-tyrosine kinase Tie2. Specifically, our results demonstrate that Tie1 undergoes regulated metalloprotease-mediated ectodomain shedding to generate a 45-kDa receptor stub, which is then acted on by {gamma}-secretase to yield a 42-kDa truncation product destined for proteasomal degradation. A key biological effect of this regulated sequential Tie1 processing is to amplify ligand activation of the associated receptor Tie2. This occurs by a mechanism involving release of the Tie1 extracellular domain from the cell surface, resulting in increased binding of ligand to Tie2. Based on these data, we propose the extracellular domain of Tie1 restricts binding of ligand to Tie2, presumably by spatial hindrance of the ligand binding site on Tie2 in Tie2·Tie1 complexes and thereby inhibits ligand activation of Tie2. Activation of Tie1 ectodomain cleavage causes release of the extracellular domain of Tie1 permitting ligand to access Tie2. This leads to increased ligand binding by Tie2 enhancing angiopoietin-stimulated Tie2 activation and downstream signaling. The {gamma}-secretase step in this sequential processing serves an important role in removing cellular Tie1 cleavage fragments, so preventing accumulation of potentially deleterious activated phosphorylated Tie1 fragments.

Our experiments to examine the extent to which Tie1 undergoes ectodomain cleavage and internalization demonstrate the primary route for loss of receptor from the cell surface is via ectodomain cleavage, even when cells are unstimulated. Under basal conditions full-length Tie1 is still clearly seen in the endothelial cells, suggesting that synthesis of new receptor and supply to cell surface is sufficient to keep pace with loss through degradation. However, the loss of the surface-expressed full-length Tie1 seen in PMA- or VEGF-activated cells indicates that in these circumstances mechanisms for replenishing this full-length receptor cannot keep pace with degradation.

The sequence of ectodomain cleavage followed by {gamma}-secretase-mediated secondary truncation that constitutes RIP (1, 2) has been reported for transmembrane signaling proteins including Notch and ErbB4 (44, 49). Previous work has already established that Tie1 is cleaved by metalloprotease activity, and cleavage is stimulated by PMA, VEGF, tumor necrosis factor-{alpha}, and changes in shear stress (15, 16, 18). Cleavage results in the shedding of the ectodomain and the generation of a membrane-bound 45-kDa Tie1 fragment (15, 16). The present findings that this fragment is then a substrate for {gamma}-secretase activity indicates Tie1 follows the pattern of regulated proteolysis characteristic of RIP. In the case of Tie1, one key function of the {gamma}-secretase step is to remove the 45-kDa receptor fragment generated after ectodomain shedding. This is particularly important for a receptor-tyrosine kinase-like Tie1 as the cleavage fragment contains the tyrosine kinase domain of the receptor. Furthermore, this fragment is tyrosine-phosphorylated in the presence of Ang1. Given the potential for tyrosine phosphoproteins to interact with SH2 and PTB domain-containing signaling proteins, it is likely that levels of this Tie1 phosphoprotein fragment must be tightly controlled to prevent it from disturbing normal signaling. As with other proteins undergoing RIP (46, 50), the newly generated 42-kDa Tie1 product of {gamma}-secretase is targeted to the proteasome and is highly labile. Indeed, it is only readily detected when sufficient substrate is present as a result of stimulated ectodomain shedding, in the present study in response to PMA or VEGF action, or in the presence of a proteasomal inhibitor.

In addition to limiting accumulation of intracellular phosphorylated Tie1 fragments, {gamma}-secretase cleavage has the potential to afford an additional signaling mechanism for Tie1 by allowing the receptor intracellular domain to be released from the membrane to communicate directly with intracellular compartments. Such a mechanism would be analogous to RIP signaling described for ErbB4, for example, where the intracellular domain of this tyrosine kinase is also released from the cell membrane via sequential proteolysis involving {gamma}-secretase (44).

Irrespective of any potential signaling role of Tie1 cleavage product, regulated Tie1 processing has an important impact on angiopoietin signaling. In particular, regulated Tie1 processing modulates responsiveness of Tie2 to COMP-Ang1. In attempting to define the mechanism for this we observed that full-length Tie1 inhibits the ability of Ang1 to activate Tie2. Accordingly, suppression of Tie1 expression by siRNA enhanced ligand activation of Tie2, as did loss of Tie1 ectodomain. By immunoprecipitation of COMP-Ang1 after receptor binding, we found that Tie1 ectodomain cleavage resulted in an increase in the amount of Tie2 interacting with ligand. Together these data show Tie1 ectodomain as part of full-length Tie1 restricts binding of Tie2 to COMP-Ang1. Tie1 ectodomain shedding relieves this restriction, allowing more Tie2 to bind ligand and thereby increasing the level of activated Tie2. Thus, regulated proteolytic processing of Tie1 represents a novel mechanism for amplifying ligand responsiveness of Tie2. It is noteworthy that for many receptors ectodomain release leads to inhibition of signaling by intact receptors because the soluble extracellular domains sequester available ligand (51). For example, shed ectodomain from the hepatocyte growth factor receptor, Met, can bind free ligand and prevent it activating intact receptors (52). Similarly, the soluble ectodomain of VEGFR1, which is expressed as a splice variant of the holoreceptor, inhibits VEGF activation of intact VEGFR1 and VEGFR2 (53). In contrast, this is not the case for Tie1, as the soluble extracellular domain of this receptor is unable to bind angiopoietin ligands (28).

Previous studies have speculated that signaling by Tie2 could be modified by Tie1 (22, 54, 55). Indeed, a detailed study of transgenic Tie1–/– and Tie2–/– mice indicates the two receptors have some inverse effects on remodeling in vascular development, with Tie2 promoting intussusceptive growth, and this being suppressed by Tie1 (22). The present study provides the first direct demonstration that Tie1 can suppress Tie2 activation and reveals a mechanism for this inhibition.

It is interesting to note that negative modulation of Tie2 by Tie1 has some parallels with another ligand/receptor-tyrosine kinase system involved in regulating vascular growth and maintenance, the VEGF/VEGFR system. In vascular endothelial cells expressing VEGFR1 and VEGFR2, the former receptor can suppress VEGF signaling through VEGFR2, although in this case the limitation occurs primarily via the action of VEGFR1 to bind VEGF and thereby limit ligand availability to VEGFR2 (56).

Clearly, signaling by Tie2 is tightly controlled. The receptor is unusual in having naturally occurring antagonists, notably Ang2, which depending on physiological context can suppress Ang1 signaling (29). The current findings reveal another level of control on this receptor, allowing its signaling capacity to be further modulated by factors regulating Tie1 cleavage. Such factors are often associated with vascular activation and remodeling, and the data presented here suggest a mechanism by which angiopoietin signaling could be coordinated with that of other vascular ligands under these conditions. The inhibitory effects of Tie1 on Tie2 raise the additional possibility that Tie2 signaling may also be influenced by factors regulating expression of Tie1, although this would be expected to occur over a longer time period than regulated Tie1 cleavage.


   FOOTNOTES
 
* This work was supported by British Heart Foundation Grants PG//2000122, PG/03/094, and PG/05/028. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Both authors contributed equally to this work. Back

2 Present address: Cardiovascular Research Unit, Section of Cardiovascular Science, School of Medicine and Biomedical Sciences, University of Sheffield, Northern General Hospital, Herries Road, Sheffield, S5 7AU, UK. Back

3 To whom correspondence should be addressed. Tel.: 44-116-252-5802; Fax: 44-116-252-3179; E-mail: npjb1{at}le.ac.uk.

4 The abbreviations used are: RIP, regulated intramembrane proteolysis; ALLN, N-acetyl-Leu-Leu-Nle-CHO (Nle, norleucine); Ang1, angiopoietin-1; HMEC-1, human microvascular endothelial cells; HUVEC, human umbilical vein endothelial cells; VEGF, vascular endothelial growth factor; VEGFR, VEGF receptor; EGF, epidermal growth factor; PBS, phosphate-buffered saline; PMA, phorbol 12-myristate 13-acetate; siRNA, small interfering RNA; TAPI, tumor necrosis factor-{alpha} protease inhibitor. Back


   ACKNOWLEDGMENTS
 
We thank Mark Shearman and Huw Lewis for the initial kind gift of {gamma}-secretase inhibitors and helpful advice and Joanne Jeory and Nisha Patel for technical assistance.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Brown, M. S., Ye, J., Rawson, R. B., and Goldstein, J. L. (2000) Cell 100, 391–398[CrossRef][Medline] [Order article via Infotrieve]
  2. Kopan, R., and Ilagan, M. X. (2004) Nat. Rev. Mol. Cell Biol. 5, 499–504[CrossRef][Medline] [Order article via Infotrieve]
  3. Lieber, T., Kidd, S., and Young, M. W. (2002) Genes Dev. 16, 209–221[Abstract/Free Full Text]
  4. Brou, C., Logeat, F., Gupta, N., Bessia, C., LeBail, O., Doedens, J. R., Cumano, A., Roux, P., Black, R. A., and Israel, A. (2000) Mol. Cell 5, 207–216[CrossRef][Medline] [Order article via Infotrieve]
  5. Schroeter, E. H., Kisslinger, J. A., and Kopan, R. (1998) Nature 393, 382–386[CrossRef][Medline] [Order article via Infotrieve]
  6. Buxbaum, J. D., Liu, K. N., Luo, Y., Slack, J. L., Stocking, K. L., Peschon, J. J., Johnson, R. S., Castner, B. J., Cerretti, D. P., and Black, R. A. (1998) J. Biol. Chem. 273, 27765–27767[Abstract/Free Full Text]
  7. Lammich, S., Kojro, E., Postina, R., Gilbert, S., Pfeiffer, R., Jasionowski, M., Haass, C., and Fahrenholz, F. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 3922–3927[Abstract/Free Full Text]
  8. Vecchi, M., and Carpenter, G. (1997) J. Cell Biol. 139, 995–1003[Abstract/Free Full Text]
  9. Blobel, C. P. (2000) Curr. Opin. Cell Biol. 12, 606–612[CrossRef][Medline] [Order article via Infotrieve]
  10. Hooper, N. M., and Turner, A. J. (2000) Biochem. Soc. Trans. 28, 441–446[Medline] [Order article via Infotrieve]
  11. Rio, C., Buxbaum, J. D., Peschon, J. J., and Corfas, G. (2000) J. Biol. Chem. 275, 10379–10387[Abstract/Free Full Text]
  12. Haass, C., and Steiner, H. (2002) Trends Cell Biol. 12, 556–562[CrossRef][Medline] [Order article via Infotrieve]
  13. Jarriault, S., Brou, C., Logeat, F., Schroeter, E. H., Kopan, R., and Israel, A. (1995) Nature 377, 355–358[CrossRef][Medline] [Order article via Infotrieve]
  14. Yabkowitz, R., Myer, S., Yanagihara, D., Brankow, D., Staley, T., Elliot, G., Hu, S., and Ratzkin, B. (1997) Blood 90, 706–715[Abstract/Free Full Text]
  15. McCarthy, M. J., Burrows, R., Bell, S. C., Christie, G., Bell, P. R. F., and Brindle, N. P. J. (1999) Lab. Investig. 79, 889–895[Medline] [Order article via Infotrieve]
  16. Yabkowitz, R., Meyer, S., Black, T., Elliott, G., Merewether, L. A., and Yamane, H. K. (1999) Blood 93, 1969–1979[Abstract/Free Full Text]
  17. Yang, X. H., Hand, R. A., Livasy, C. A., Cance, W. G., and Craven, R. J. (2003) Tumour Biol. 24, 61–69[CrossRef][Medline] [Order article via Infotrieve]
  18. Chen-Konak, L., Guetta-Shubin, Y., Yahav, H., Shay-Salit, A., Zilberman, M., Binah, O., and Resnick, N. (2003) FASEB J. 17, 2121–2123[Abstract/Free Full Text]
  19. Jones, N., Iljin, K., Dumont, D. J., and Alitalo, K. (2001) Nat. Rev. Mol. Cell Biol. 2, 257–267[CrossRef][Medline] [Order article via Infotrieve]
  20. Puri, M., Rossant, J., Alitalo, K., Bernstein, A., and Partanen, J. (1995) EMBO J. 14, 5884–5891[Medline] [Order article via Infotrieve]
  21. Sato, T., Tozawa, Y., Deutsch, U., Wolburg-Bucholz, K., Fujiwara, Y., Gendron-Maguire, M., Gridley, T., Wolburg, H., Risau, W., and Qin, Y. (1995) Nature 376, 70–74[CrossRef][Medline] [Order article via Infotrieve]
  22. Patan, S. (1998) Microvasc. Res. 56, 1–21[CrossRef][Medline] [Order article via Infotrieve]
  23. Partanen, J., Puri, M., Schwartz, L., Fischer, K.-D., Bernstein, A., and Rossant, J. (1996) Development 122, 3013–3021[Abstract]
  24. Porat, R. M., Grunewald, M., Globerman, A., Itin, A., Barshtein, G., Alhonen, L., Alitalo, K., and Keshet, E. (2003) Circ. Res. 94, 394–401[Medline] [Order article via Infotrieve]
  25. Marron, M. B., Hughes, D. P., Edge, M. D., Forder, C. L., and Brindle, N. P. J. (2000) J. Biol. Chem. 275, 39741–39746[Abstract/Free Full Text]
  26. Saharinen, P., Kerkela, K., Ekman, N., Marron, M., Brindle, N., Lee, G. M., Augustin, H., Koh, G. Y., and Alitalo, K. (2005) J. Cell Biol. 169, 239–243[Abstract/Free Full Text]
  27. Peters, K. G., Kontos, C. D., Lin, P. C., Wong, A. L., Rao, P., Huang, L., Dewhirst, M. W., and Sankar, S. (2004) Recent Prog. Horm. Res. 59, 51–71[Abstract/Free Full Text]
  28. Davis, S., Aldrich, T. H., Jones, P. F., Acheson, A., Compton, D. L., Jain, V., Ryan, T. E., Bruno, J., Radziejewski, C., Maisonpierre, P. C., and Yancopoulos, G. D. (1996) Cell 87, 1161–1169[CrossRef][Medline] [Order article via Infotrieve]
  29. Maisonpierre, P. C., Suri, C., Jones, P. F., Bartunkova, S., Wiegand, S. J., Radziejewski, C., Compton, D., McClain, J., Aldrich, T. H., Papadopoulos, N., Daly, T. J., Davis, S., Sato, T. N., and Yancopoulos, G. D. (1997) Science 277, 55–60[Abstract/Free Full Text]
  30. Valenzuela, D. M., Griffiths, J. A., Rojas, J., Aldrich, T. H., Jones, P. F., Zhou, H., McClain, J., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Huang, T., Papadopoulos, N., Maisonpierre, P. C., Davis, S., and Yancopoulos, G. D. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 1904–1909[Abstract/Free Full Text]
  31. Procopio, W. N., Pelavin, P. I., Lee, W. M., and Yeilding, N. M. (1999) J. Biol. Chem. 274, 30196–30201[Abstract/Free Full Text]
  32. Kim, I., Kim, H. G., So, J.-S., Kim, J. H., Kwak, H. J., and Koh, G. Y. (2000) Circ. Res. 86, 24–29[Abstract/Free Full Text]
  33. Papapetropoulos, A., Fulton, D., Mahboubi, K., Kalb, R. G., O'Connor, D. S., Li, F., Altieri, D. C., and Sessa, W. C. (2000) J. Biol. Chem. 275, 9102–9105[Abstract/Free Full Text]
  34. Cho, C.-H., Kammerer, R. A., Lee, H. J., Steinmetz, M. O., Ryu, Y. S., Lee, S. H., Yasunaga, K., Kim, K.-T., Kim, I., Choi, H.-H., Kim, W., Kim, S. H., Park, S. K., Lee, G. M., and Koh, G. Y. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 5547–5552[Abstract/Free Full Text]
  35. Ades, E. W., Candal, F. J., Swerlick, R. A., George, V. G., Summers, S., Bosse, D. C., and Lawley, T. J. (1992) J. Investig. Dermatol. 99, 683–690[CrossRef][Medline] [Order article via Infotrieve]
  36. Matthews, J. A., Batki, A., Hynds, C., and Kricka, L. J. (1985) Anal. Biochem. 151, 205–209[CrossRef][Medline] [Order article via Infotrieve]
  37. Constantinescu, S. N., Keren, T., Socolovsky, M., Nam, H.-S., Henis, Y. I., and Lodish, H. F. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 4379–4384[Abstract/Free Full Text]
  38. Price, C. J., and Brindle, N. P. J. (2000) Arterioscler. Thromb. Vasc. Biol. 20, 2051–2056[Abstract/Free Full Text]
  39. Song, W., Nadeau, P., Yuan, M., Yang, X., Shen, J., and Yankner, B. A. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 6959–6963[Abstract/Free Full Text]
  40. Ray, W. J., Yao, M., Mumm, J., Schroeter, E. H., Saftig, P., Wolfe, M., Selkoe, D. J., Kopan, R., and Goate, A. M. (1999) J. Biol. Chem. 274, 36801–36807[Abstract/Free Full Text]
  41. De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J. S., Schroeter, E. H., Schrijvers, V., Wolfe, M. S., Ray, W. J., Goate, A., and Kopan, R. (1999) Nature 398, 518–522[CrossRef][Medline] [Order article via Infotrieve]
  42. Annaert, W. G., Levesque, L., Craessaerts, K., Dierinck, I., Snellings, G., Westaway, D., George-Hyslop, P. S., Cordell, B., Fraser, P., and De Strooper, B. (1999) J. Cell Biol. 147, 277–294[Abstract/Free Full Text]
  43. Murphy, M. P., Hickman, L. J., Eckman, C. B., Uljon, S. N., Wang, R., and Golde, T. E. (1999) J. Biol. Chem. 274, 11914–11923[Abstract/Free Full Text]
  44. Ni, C. Y., Murphy, M. P., Golde, T. E., and Carpenter, G. (2001) Science 294, 2179–2181[Abstract/Free Full Text]
  45. Lee, H. J., Jung, K. M., Huang, Y. Z., Bennett, L. B., Lee, J. S., Mei, L., and Kim, T. W. (2002) J. Biol. Chem. 277, 6318–6323[Abstract/Free Full Text]
  46. Taniguchi, Y., Kim, S.-H., and Sisodia, S. S. (2003) J. Biol. Chem. 278, 30425–30428[Abstract/Free Full Text]
  47. Shearman, M. S., Beher, D., Clarke, E. E., Lewis, H. D., Harrison, T., Hunt, P., Nadin, A., Smith, A. L., Stevenson, G., and Castro, J. L. (2000) Biochemistry 39, 8698–8704[CrossRef][Medline] [Order article via Infotrieve]
  48. Zhang, L., Song, L., and Parker, E. M. (1999) J. Biol. Chem. 274, 8966–8972[Abstract/Free Full Text]
  49. Struhl, G., and Adachi, A. (2000) Mol. Cell 6, 625–636[CrossRef][Medline] [Order article via Infotrieve]
  50. Wu, G., Lyapina, S., Das, I., Li, J., Gurney, M., Pauley, A., Chui, I., Deshaies, R. J., and Kitajewski, J. (2001) Mol. Cell. Biol. 21, 7403–7415[Abstract/Free Full Text]
  51. Heaney, M. L., and Golde, D. W. (1998) J. Leukocyte Biol. 64, 135–146[Abstract]
  52. Wajih, N., Walter, J., and Sane, D. C. (2002) Circ. Res. 90, 46–52[Abstract/Free Full Text]
  53. Kendall, R., and Thomas, K. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 10705–10709[Abstract/Free Full Text]
  54. Witzenbichler, B., Maisonpierre, P. C., Jones, P., Yancopoulos, G. D., and Isner, J. M. (1998) J. Biol. Chem. 273, 18514–18521[Abstract/Free Full Text]
  55. Dumont, D., Gradwohl, G., Fong, G., Puri, M., Gertsenstein, M., Auerbach, A., and Breitman, M. (1994) Genes Dev. 8, 1897–1909[Abstract/Free Full Text]
  56. Olsson, A.-K., Dimberg, A., Kreuger, J., and Claesson-Welsh, L. (2006) Nat. Rev. Mol. Cell Biol. 7, 359–371[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol Cancer ResHome page
J. H. Tsai and W. M.F. Lee
Tie2 in Tumor Endothelial Signaling and Survival: Implications for Antiangiogenic Therapy
Mol. Cancer Res., March 1, 2009; 7(3): 300 - 310.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
V. W.M. van Hinsbergh and P. Koolwijk
Endothelial sprouting and angiogenesis: matrix metalloproteinases in the lead
Cardiovasc Res, May 1, 2008; 78(2): 203 - 212.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/42/30509    most recent
M702535200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marron, M. B.
Right arrow Articles by Brindle, N. P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marron, M. B.
Right arrow Articles by Brindle, N. P. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement