HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 282, Issue 42, 30562-30569, October 19, 2007

This Article Abstract Full Text (PDF) All Versions of this Article: 282/42/30562    most recent M706326200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Jain, S. Articles by Oelkers, P. Search for Related Content PubMed PubMed Citation Articles by Jain, S. Articles by Oelkers, P. Social Bookmarking                      What's this?

Identification of a Novel Lysophospholipid Acyltransferase in Saccharomyces cerevisiae^*

Shilpa Jain, NaTaza Stanford, Neha Bhagwat, Brian Seiler, Michael Costanzo, Charles Boone, and Peter Oelkers¹

From the Department of Bioscience and Biotechnology, Drexel University, Philadelphia, Pennsylvania 19104 and the Banting and Best Department of Medical Research and Department of Molecular Genetics and Microbiology, Terrence Donnelly Center for Cellular and Biomolecular Research, University of Toronto, Toronto, Ontario M5S 3E1, Canada

Received for publication, July 31, 2007 , and in revised form, August 21, 2007.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The incorporation of unsaturated acyl chains into phospholipids during de novo synthesis is primarily mediated by the 1-acyl-sn-glycerol-3-phosphate acyltransferase reaction. In Saccharomyces cerevisiae, Slc1 has been shown to mediate this reaction, but distinct activity remains after its removal from the genome. To identify the enzyme that mediates the remaining activity, we performed synthetic genetic array analysis using a slc1 strain. One of the genes identified by the screen, LPT1, was found to encode for an acyltransferase that uses a variety of lysophospholipid species, including 1-acyl-sn-glycerol-3-phosphate. Deletion of LPT1 had a minimal effect on 1-acyl-sn-glycerol-3-phosphate acyltransferase activity, but overexpression increased activity 7-fold. Deletion of LPT1 abrogated the esterification of other lysophospholipids, and overexpression increased lysophosphatidylcholine acyltransferase activity 7-fold. The majority of this activity co-purified with microsomes. To test the putative role for this enzyme in selectively incorporating unsaturated acyl chains into phospholipids in vitro, substrate concentration series experiments were performed with the four acyl-CoA species commonly found in yeast. Although the saturated palmitoyl-CoA and stearoyl-CoA showed a lower apparent K_m, the monounsaturated palmitoleoyl-CoA and oleoyl-CoA showed a higher apparent V_max. Arachidonyl-CoA, although not abundant in yeast, also had a high apparent V_max. Pulse-labeling of lpt1 strains showed a 30% reduction in [³H]oleate incorporation into phosphatidylcholine only. Therefore, Lpt1p, a member of the membrane-bound o-acyltransferase gene family, seems to work in conjunction with Slc1 to mediate the incorporation of unsaturated acyl chains into the sn-2 position of phospholipids.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
It has long been known that phospholipids commonly contain an asymmetrical distribution of acyl chains (1, 2). Saturated acyl chains are usually found at the sn-1 position and unsaturated acyl chains at sn-2. The reason for this asymmetry may be that the liquid crystal transition temperature (T_c) for phospholipids with two saturated acyl chains, such as distearoyl phosphatidylcholine (58 °C), is much higher than that for 1-stearoyl-2-oleoyl phosphatidylcholine (3 °C) (3). The incorporation of unsaturated acyl chains prevents membranes from assuming the gel phase at common physiological temperatures.

During the de novo synthesis of phospholipids (Fig. 1A), acyl chains are incorporated into the sn-2 position by 1-acyl-sn-glycerol-3-phosphate acyltransferase (AGPAT),² also known as lysophosphatidic acid acyltransferase. The acyl-CoA substrate specificity for the reaction in rat liver microsomes (4) and by overexpressed human AGPAT1 (5, 6) and AGPAT2 (6, 7) shows only a mild, if any, preference for unsaturated species. Thus, whereas the reaction produces a necessary intermediate, phosphatidic acid, in the synthesis of phospholipids and triglycerides, the substrate specificity does not match the acyl chain composition of most phospholipids. However, the reaction clearly has physiological importance because mutations in AGPAT2 result in the dramatic lack of many, but not all, adipose depots in congenital general lipodystrophy (8). Given this necessity of AGPAT2 function, it is surprising that there are nine AGPAT paralogs in humans. AGPAT6 has been implicated in triglyceride synthesis in mammary glands (9). AGPAT8 encodes for an endoplasmic reticulum glycerol-3-phosphate acyltransferase (10), and AGPAT9 is highly homologous to lysophosphatidylcholine acyltransferase 1 (LPCAT1) (11). Whether the members of this gene family are responsible for all AGPAT activity in mammals cannot be practically determined. The only AGPAT gene family member in the Saccharomyces cerevisiae is SLC1. SLC1 deletion mutants contain no AGPAT activity in lipid particles and 50% activity in microsomes (12). Clearly, a unique AGPAT exists in the yeast genome.

The product of AGPAT, PA, can be used to synthesize phospholipids by two pathways (Fig. 1A) (reviewed in Ref. 13). Additionally, after de novo synthesis, phospholipids can undergo remodeling (Fig. 1B). This involves deacylation at the sn-2 position by phospholipase A₂ and reacylation by acyl-CoA-dependent lysophospholipid acyltransferase (Lands' Cycle) (14). There are many possible physiological functions of this remodeling that may be organism- and cell type-specific. In addition to incorporating unsaturated acyl chains for membrane fluidity, specific incorporation of the polyunsaturated arachidonyl into the sn-2 position may prime phospholipase A₂-inducible signal cascades that involve eicosanoid synthesis (15). Alternatively, preferential incorporation of saturated acyl chains occurs during surfactant production in lungs (16). The remodeling enzymes may also re-esterify exogenous lysophospholipids generated by extracellular lipases. For instance, yeast can absorb and esterify lysophosphatidylethanolamine (lysoPE) (17). In mammals, this process may prevent the inflammation that lysophospholipids can induce (18). To date, the only cloned lysophospholipid acyltransferases are the mouse LPCAT1 and lyso-platelet-activating factor acyltransferase/LPCAT2 (19–21). These are primarily expressed in lungs, have a mild preference for saturated acyl-CoA, are specific for lysophosphatidylcholine (lysoPC), and have conserved motifs in common with the AGPAT gene family. In yeast, acyl-CoA-independent LPCAT (i.e. transacylase) activity is mediated by Taffazin (22), and acyl-CoA dependent LPCAT activity has been reported (2, 23), but the enzyme had not been identified.

View larger version (10K): [in this window] [in a new window]   FIGURE 1. Pathways for phospholipid synthesis in yeast. A, de novo synthesis. B, remodeling/salvage pathways. Some substrates and products were omitted because of space constraints. DAG, diacylglycerol.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Materials—Synthetic complete medium and yeast nitrogen base were obtained from Q-biogene (MP Biomedicals). Myristoyl lysophosphatidylethanolamine and oleoyl lysophosphatidylserine were from Avanti%20Polar%20Lipids">Avanti Polar Lipids (Alabaster, AL). [1-¹⁴C]Palmitoyl-lysoPC (55 mCi/mmol) was from Perkin-Elmer Life Sciences. Nourseothricin was obtained from Werner BioAgents. All other chemicals were obtained from either Sigma or Fisher.

Yeast Strains—Molecular biology and yeast genetic procedures were performed according to conventional protocols (25). Deletion mutant strains for SLC1 and LPT1 were generated by homologous recombination in a W303-1B haploid (MATa ade2-1, can1-1, trp1-1, ura3-1, his3-11, 15, leu2-3, 112) (26) by transformation with PCR-derived products containing 50 bp of gene-specific sequence flanking the Kluyveromyces lactis URA3 sequence (27, 28): for LPT1, LPT1F, 5'-ATGTACAATCCTGTGGACGCTGTTTTAACAAAGATAATTACCAACTATGGACATGGCAATTCCCGGGGA-TCGL and LPT1R, 5'-CTACTCTTCCTTTTTTGAAATAGGCTTTGGTGAGTAACCACTAAAACTCATCAACATGGTGGTCAGCTGGAATT; and for SLC1, SLC1F, 5'-ATGAGTGTGATAGGTAGGTTCTTGTATTACTTGAGGTCCGTGTTGGTCGTACATGGCAATTCCCGGGGATCG and SLC1R, 5'-TTAATGCATCTTTTTTACAGATGAACCTTCGTTATGGGTATTGACATCGTTCAACATGGTGGTCAGCTGGAATT. Successful deletion was confirmed by PCR using gene-specific primers. Yeast were grown in YP medium (1% yeast extract, 2% peptone) with 2% glucose (yYPD) or in synthetic complete (SC) medium (29).

Synthetic Lethality Screen—SGA was performed as described previously (24). A MAT slc1::NatMX4 can1::STE2pr-Sp_his5 lyp1 strain was crossed to an array containing the set of 5,000 viable deletion mutant strains.

Yeast Expression Plasmid Construction—A PCR product including the LPT1 open reading frame, 90 bp of 5'-flanking sequence, and 46 bp of 3'-flanking sequence was generated using the primers: 175-1, CAAAATACAGGCACAGGTCAAGC; 175-2, GACAACAAGACTGTGACTTCCAC, and W303-1B genomic DNA. The 2.0-kb PCR product was cloned into pCR2.1 TOPO (Invitrogen) and subsequently subcloned (NotI/SacI) into pRS423GP to create pRS423GP-LPT1.

Pulse Labeling—Pulse labeling of yeast was performed for 30 min with log phase cultures cultured in YPD with [³H]oleate as described previously (30). Phospholipids were resolved by thin layer chromatography in chloroform:methanol:acetic acid:water (50:25:8:4), and neutral lipids were resolved as described previously (30). Each lane was cut according to lipid standards and counted by liquid scintillation. Assays were performed on a minimum of two independent strains of each genotype on two different days. Statistical analysis was performed using t tests.

Preparation of Cell Lysates, Mitochondria, and Microsomes–Yeast cells were grown in YP containing either 2% glucose or 3% glycerol at 30 °C into early stationary phase (A₆₆₀ = 1.0). SC-His medium containing 2% galactose was used for yeast harboring a plasmid. The cells were harvested and washed, and cell lysates were prepared as described previously (30). The mitochondria were prepared using a previously published protocol (31). Briefly, the cells were grown in YP medium containing 3% glycerol, harvested, and lysed, and crude mitochondria were precipitated by centrifugation at 12,000 x g. Resuspension of the pellet, followed by sucrose step gradients allowed purified mitochondria to be collected. The microsomes were purified from the 12,000 x g supernatant by precipitation by centrifugation at 100,000 x g for 1 h (30). Lowry assays were used to measure protein concentration.

AGPAT and LPLAT Assays, Spectrophotometric Method–AGPAT activity was measured by the reaction of thiol groups of the released CoA with 5,5'-dithiobis(nitrobenzoic acid) resulting in absorbance at 412 nm (32). The reaction mixture contained 100 mM Tris-HCl, pH 7.4, 1.5 mM 5,5'-dithiobis(nitrobenzoic acid), 50 µM lysophosphatidic acid (lysoPA), 50 µM acyl CoA, and cell lysate (210–840 µg) in a total volume of 1 ml. The reaction was monitored in real time for 3 min in a Spectronic Genesys 2 spectrophotometer at room temperature. A molar absorbance of 13,600 M^–1 cm^–1 was used to calculate relative specific activity. Lysophospholipid acyltransferase (LPLAT) activity was measured by replacing lysoPA with lysoPC, lysoPE, lysoPI, or lysoPS.

View larger version (9K): [in this window] [in a new window]   FIGURE 2. Alignment of LPT1 and 3 human members of the MBOAT gene family. The four amino acid sequences are aligned over the MBOAT motif (Pfam PFO3062). Positions where 3 of 4 amino acids are conserved are boxed. In parentheses are the positions of the first amino acids in each sequence.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
SGA Screen with slc1 Identified LPT1—To identify the second AGPAT in S. cerevisiae, a SGA screen (24) was carried out using an slc1 query strain. The primary screen identified 52 nonessential genes that resulted in a synthetic lethal/sick phenotype when disrupted in combination with deletion of SLC1 (data not shown). Although the primary screen often contains a number of false positive interactions, some functionally relevant genes were identified including the fatty acid elongase gene, ELO2. The screen also identified two genes, PMT5 and YOR175C, that were previously shown to exhibit genetic interactions with SLC1 (33). PMT5 encodes for a component of the dolichyl-phosphate-mannose-protein mannosyltransferase complex, whereas a function for YOR175c (from here on referred to as LPT1)³ was uncharacterized previously. To confirm the synthetic-lethal interaction, independent slc1 and lpt1 haploid strains were generated and mated to form compound heterozygous diploids. Following meiosis, 80 haploid spores were isolated by tetrad dissection. Sixty spores were viable, and all were of the wild-type, slc1 or lpt1 genotype. In line with Hardy Weinberg equilibrium, of the progeny were therefore inviable and slc1lpt1, confirming the synthetic lethal interaction.

Lpt1p Primary Structure—The LPT1 gene encodes for a predicted protein of 619 amino acids and 72.2 kDa. Computer algorithm analysis predicts seven transmembrane domains (33). The C-terminal four amino acids, KKEE, agree with the conserved ER retention signal KKXX (34). This is consistent with studies that have shown Lpt1p to co-purify with ribosomes (35) and a Lpt1p-green fluorescent protein chimera to localize to the endoplasmic reticulum (36). In terms of homology, Lpt1p belongs to the membrane-bound o-acyltransferase (MBOAT) family of proteins (37). Within the MBOAT domain (Pfam PFO3062), Lpt1p shares 25% identity with three characterized members of the MBOAT family in humans (Fig. 2). The presence of this domain in Lpt1p is consistent with it being an acyltransferase.

Determining Whether Altering LPT1 Expression Alters AGPAT Activity—Initial experiments characterizing the acyltransferase activity in yeast cell lysates were performed by measuring the release of coenzyme A from acyl-CoA substrates. Assays with and without lysoPA were performed in parallel so that lysoPA-independent CoA generation could be measured and subtracted. This "background" activity was not different between wild-type and lpt1 samples. Two acyl-CoA species, palmitoyl-CoA and oleoyl-CoA, were provided to represent saturated and monounsaturated substrates. To establish the amount of Slc1-independent AGPAT activity in yeast, slc1 cell lysates were assayed and showed a 60% reduction, with either acyl-CoA, compared with wild-type yeast (Fig. 3A). In contrast, lpt1 cell lysates showed no statistically significant changes in AGPAT activity. However, overexpression of LPT1 resulted in a 7-fold increase in AGPAT activity (Fig. 3B). This suggests that Lpt1p can mediate the reaction, but in the early stationary phase of growth, from which these cells were harvested, Slc1 is the primary AGPAT.

Lpt1p Esterifies Other Lysophospholipids—Because yeast have been shown to mediate LPCAT activity (2, 23), we tested whether Lpt1p is also responsible for that activity. Similar assays to the above were performed by replacing lysoPA with lysoPC. Activity was seen with wild-type yeast cell lysates supplied with palmitoyl-CoA, oleoyl-CoA, and arachidonyl-CoA representing saturated, monounsaturated, and polyunsaturated substrates (Fig. 4A). Unsaturated acyl-CoAs showed 4–7-fold higher activity than the saturated palmitoyl-CoA. No activity was observed in lpt1 cell lysates with any of the acyl-CoAs, suggesting that Lpt1p is the main, if not only, LPCAT in yeast. Similar assays using [¹⁴C]lysoPC and oleoyl-CoA showed essentially no activity with lpt1 cell lysates (0.2 ± 0.2 nmol/min/mg) and robust activity in wild-type lysates (55.6 ± 4.7 nmol/min/mg). To address the possibility that Lpt1p is an accessory protein, necessary for the expression and/or activity of the true LPCAT, Lpt1p was overexpressed in wild-type yeast. LPCAT activity was increased 7-fold compared with wild-type yeast harboring an empty vector (Fig. 4B), consistent with Lpt1p being the catalyst of the observed activity. LysoPC-independent activity was modestly increased (11.5 versus 6.9 nmol/min/mg) with LPT1 overexpression.

Because Lpt1p may be the only LPCAT in yeast, we hypothesized that it will have broad substrate specificity regarding lysophospholipids. Replacing lysoPC with lysoPE, lysophosphatidylinositol (lysoPI), or lysophosphatidylserine (lysoPS) showed distinct acyltransferase activity (Fig. 5, A and B). Comparing the enzyme activities of each lysophospholipid with oleoyl-CoA suggests that Lpt1p has a substrate preference of lysoPC = lysoPI = lysoPS > lysoPE (Figs. 4 and 5). Because Lpt1p can use multiple lysophospholipids as substrates, it should be referred to as a LPLAT.

View larger version (17K): [in this window] [in a new window]   FIGURE 3. In vitro AGPAT assays. A, cell lysates from wild-type (WT), lpt1 and slc1 haploids, grown to late logarithmic phase, were assayed for AGPAT activity by the spectrophotometric method described under "Experimental Procedures." The assay contained 50 µM 1-oleoyl lysophosphatidic acid, 50 µM acyl-CoA, 1.5 mM 5,5'-dithiobis(nitrobenzoic acid), 0.42–0.84 mg cell lysate, and 100 mM Tris-HCl, pH 7.4. Black bars, palmitoyl-CoA; gray bars, oleoyl-CoA. The data represent the means ± S.E. (n = 3–5). The asterisk indicates statistically significant difference compared with wild-type strain (p < 0.05). B, similar assays were performed with cell lysates from wild-type cells transformed with pRS423GP or pRS423GP-LPT1.

View larger version (15K): [in this window] [in a new window]   FIGURE 4. In vitro LPCAT assays. A, cell lysates from wild-type (WT), lpt1, and slc1 haploids, grown to late logarithmic phase, were assayed for LPCAT activity by the spectrophotometric method described under "Experimental Procedures" and in Fig. 2 legend except lysoPA was replaced with lysoPC. Black bars, palmitoyl-CoA; gray bars, oleoyl-CoA; striped bars, arachidonyl-CoA. The data represent the means ± S.E. (n = 3–4). The asterisks indicate statistically significant difference compared with wild-type strain (p < 0.01). B, similar assays were performed with cell lysates from wild-type cells transformed with pRS423GP or pRS423GP-LPT1.

View larger version (8K): [in this window] [in a new window]   FIGURE 5. Lysophospholipid substrate specificity of Lpt1p. lysoPE (A), lysoPI (B), and lysoPS (C) were used as acyl acceptors, and LPLAT activity was determined by the spectrophotometric method using cell lysates prepared from wild-type (WT) yeast. Black bars, palmitoyl-CoA; gray bars, oleoyl-CoA. The data represent the means ± S.E. (n = 3). An asterisk indicates a statistically significant difference (p < 0.01) between wild type and lpt1.

View larger version (16K): [in this window] [in a new window]   FIGURE 6. Acyl-CoA substrate specificity of Lpt1p. Cell lysates from lpt1 yeast transformed with pRS423GP/LPT1 were assayed for LPCAT activity by the radioactive substrate method described under "Experimental Procedures." The reaction contained 50 µM [1-14C]palmitoyl lysophosphatidylcholine, 1–110 µM of acyl-CoA, 3 µg of cell lysate, and 100 mM Tris-HCl, pH 7.4, and incubated for 5 min at 28 °C. A, palmitoyl-CoA; B, palmitoleoyl-CoA; C, stearoyl-CoA; D, oleoyl-CoA; E, arachidonyl-CoA. The data represent the means ± S.E. (n = 3–5).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
AGPAT mediates the second step in de novo triglyceride and phospholipid synthesis. This pathway seems to be well conserved through evolution as evidenced by all of the enzymes of the pathway in S. cerevisiae identified to date having a human homolog (38). These studies were initiated to identify a novel AGPAT in yeast that would allow a more complete analysis of phospholipid metabolism in this model organism and potentially identify novel human homologs. Because AGPAT activity is required for the de novo synthesis of phospholipids, a major component of cellular membranes, if there is only one additional AGPAT in yeast besides SLC1, a synthetic lethality screen should identify this gene. Systematically crossing slc1 haploids with each of the 5000 viable single-gene deletion haploids identified a total of 52 synthetic-lethal interactions. One of the identified genes was ELO2 (FEN1), which encodes for an acyl-CoA elongase required for ceramide synthesis (39). Interestingly, a gain of function mutation, SLC1-1, complements yeast that have deficient sphingolipid synthesis. Viability is conferred by the synthesis of atypical PI species that contain very long chain acyl groups, presumably with similar biophysical properties to sphingolipids (40). Perhaps the nonmutated SLC1 produces a small amount of such PI species that are required when acyl-CoA elongation is limited.

LPT1 was also identified in the screen and chosen for further characterization because of its containing a motif found in a family of MBOATs (37). In S. cerevisiae, the family members are the acyl-CoA sterol acyltransferases, Are1, Are2 (41), and the glycosylphosphatidylinositol anchor remodeling protein Gup1 (42), and its paralog, Gup2. In humans, the family includes ACAT1, ACAT2, and DGAT1. Lpt1p does not share sequence similarity with Slc1 or any other AGPAT. It also does not share sequence similarity to the lysophosphatidylcholine acyltransferases LPCAT1 (20) and LPCAT2 (21) recently identified in mouse lung nor the human lysophosphatidylglycerol acyltransferase (43). Lpt1p does, however, share 25% overall amino acid sequence identity to three uncharacterized human gene translation products. Whether these are functional homologs is under current investigation.

View larger version (18K): [in this window] [in a new window]   FIGURE 7. Incorporation of [3H]oleate into phospholipids and neutral lipids. Wild-type and lpt1 yeast were grown in YPD to logarithmic phase and pulse-labeled with [3H]oleate for 30 min. A, incorporation into the major phospholipids. Black bars, PC; white bars, PE; striped bars, PS/PI. B, neutral lipids were measured as described under "Experimental Procedures." Dark gray bars, diglyceride;, light gray bars, triglyceride; cross-hatched bars, ergosterol ester. The data in cpm represent the means ± S.E. (n = 4). An asterisk indicates statistically significant difference between wild type and lpt1 (p < 0.05).

Subsequent experiments found that Lpt1p has a more pronounced role in esterifying lysophospholipids besides lysoPA. Deletion of LPT1 completely abrogated LPCAT activity and overexpression of LPT1 in a wild-type yeast strain increased this activity 7-fold. Cell fractionation studies detected the majority (65%) of whole cell LPCAT activity in microsomes, consistent with Lpt1p residing in the ER (35, 36). Although others detected acyl-CoA dependent LPCAT activity in yeast mitochondria (22), we recovered little acyl-CoA dependent activity (2%) in wild-type mitochondria and none in lpt1 mitochondria. Supplying wild-type yeast lysates with lysoPE, lysoPI, and lysoPS also showed acyl-CoA-dependent acyltransferase activity. No activity was observed in lpt1 lysates even with providing saturated and unsaturated acyl-CoA species. The substrate preference for lysophospholipids seems to be lysoPC = lysoPI = lysoPS > lysoPE. However, these differences may reflect a difference in solubility in the assay buffer and/or ability to intercalate into membranes during the assay and not a difference in enzyme affinity. The ability to esterify lysoPE agrees with the recent finding that yeast can transport exogenous lysoPE and esterify it (17). The use of lysoPI as an acyl acceptor has been rarely described in the literature: in rat brain (44), pancreas (45), and cow brain (46). This broad use of acyl acceptors by Lpt1p prompted using the term LPLAT to describe its activity. Although no evidence was found for Lpt1p-independent LPLAT activity in yeast, other such enzymes may exist that are not expressed under the growth conditions used here, require assay components that were not supplied, or use other substrates such as short or very long acyl-CoAs.

As for the four long chain acyl-CoA species commonly found in yeast (47), their utilization was studied in depth with substrate concentration series experiments. Because these substrates likely undergo kinetically distinct steps, such as membrane insertion, prior to interacting with Lpt1p, all of the kinetic parameters are considered to be apparent. With lysoPC as the acyl acceptor, the saturated acyl-CoAs showed low K_m and low V_max values, and the monounsaturated acyl-CoAs showed relatively high K_m and high V_max values. For oleoyl-CoA, the K_m is lower and the V_max higher compared with a previous study of yeast LPCAT (K_m = 152 µM, V_max = 11 nmol/min/mg) (23). The values also differed from the rat liver LPCAT activity with unsaturated acyl-CoA (K_m = 1–10 µM; V_max = 8–13 nmol/min/mg) (48). Because V_max is proportional to the turnover rate of the enzyme and K_m is proportional to the enzyme affinity for substrate, V_max/K_m yields a single value for comparing substrate utilization. This value tended to be higher for unsaturated acyl-CoA species than saturated species. The presence, and not number, of double bonds seems to be critical for substrate utilization because arachidonyl-CoA has four and was actively used.

Comparing the kinetic parameters to the Michaelis-Menten plots indicates some discordance. The reason may be that at high acyl-CoA concentration, activity is limited by a detergent effect. Perhaps a better way to analyze the kinetic data is to compare the activity at physiological cellular concentrations of each acyl-CoA. Because yeast have 0.1 nmol of each acyl-CoA in 10⁹ cells (47) and the average volume of a yeast haploid is 70 µm³, the cellular concentration of each acyl-CoA is 2 µM. If this gross estimate is correct, then Lpt1p likely mediates similar activity with saturated and unsaturated acyl-CoA inside cells. If the physiological acyl-CoA concentrations are 10 µM or higher, then the use of unsaturated acyl-CoAs will predominate.

The physiological function of Lpt1p-mediated LPLAT activity was also investigated by pulse labeling wild-type and lpt1 strains with [³H]oleate. There was a selective reduction in incorporation into PC by 30%. It seems unlikely that this difference is due to decreased AGPAT activity because phosphatidic acid provides a precursor for all the phospholipid species, synthesized via diacylglycerol or CDP-diacylglycerol, and triglyceride. More likely, the difference is due to the deficient LPLAT activity in lpt1. The lack of an effect on incorporation into PE or PI may reflect a low cellular abundance of lyso-species of these phospholipids. Whether S. cerevisiae has a phospholipase A₂ with preference for PC has not been determined. However, yeast actively use PC as an acyl donor for triglyceride synthesis and thus actively produce lysoPC via a phospholipid diacylglycerol acyltransferase reaction mediated by Lro1p (49). This may be the main source of Lpt1p substrates. In addition to constitutive remodeling, Lpt1p may also function to limit the abundance of lysophospholipids and avoid inappropriate stimulation of adenylate cyclase in yeast (50). LPLAT activity also allows exogenous lysophospholipids to be salvaged after uptake and directly utilized for cell membranes (17).

In S. cerevisiae, the preferential incorporation of unsaturated acyl chains into the sn-2 position of phospholipids seems to be achieved by a combination of substrate selectivity during de novo synthesis, primarily by Slc1p, in the Kennedy Pathway and remodeling by Lpt1p in the Lands cycle. This is supported by a deletion of both genes being lethal and the preference of both reactions for unsaturated acyl-CoA substrates. Within the family of membrane-bound o-acyltransferases, LPT1 and its orthologs may comprise a novel branch with important roles regarding phospholipid composition.

	FOOTNOTES

 
^* This work is supported in part by grants from the Canadian Institute of Health Research, Genome Canada, and Genome Ontario (to C. B.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ To whom correspondence should be addressed: Drexel University, 3141 Chestnut St., Philadelphia, PA 19104. Fax: 215-895-1273; E-mail: pmo24{at}drexel.edu.

² The abbreviations used are: AGPAT, 1-acyl-sn-glycerol-3-phosphate acyltransferase; LPCAT, lysophosphatidylcholine acyltransferase; SGA, synthetic genetic array; LPLAT, lysophospholipid acyltransferase; MBOAT, membrane-bound o-acyltransferase; ACAT, acyl-CoA cholesterol acyltransferase; DGAT, acyl-CoA diacylglycerol acyltransferase; PA, phosphatidic acid; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PI, phosphatidylinositol; PS, phosphatidylserine.

³ While this paper was under review, two papers describing the same gene have been electronically published. Riekhof et al. (51) named it ALE1, and Benghezal et al. (52) named it SLC4.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Hanahan, D. J., Brockerhoff, H., and Barron, E. J. (1960) J. Biol. Chem. 235, 1917–1923[Free Full Text]
2. Yamada, K., Okuyama, H., Endo, Y., and Ikezawa, H. (1977) Arch. Biochem. Biophys. 183, 281–289[CrossRef][Medline] [Order article via Infotrieve]
3. Phillips, M. C., Hauser, H., and Paltauf, F. (1972) Chem. Phys. Lipids 8, 127–133[CrossRef][Medline] [Order article via Infotrieve]
4. Lands, W. E., Inoue, M., Sugiura, Y., and Okuyama, H. (1982) J. Biol. Chem. 257, 14968–14972[Abstract/Free Full Text]
5. Aguado, B., and Campbell, R. D. (1998) J. Biol. Chem. 273, 4096–4105[Abstract/Free Full Text]
6. Hollenback, D., Bonham, L., Law, L., Rossnagle, E., Romero, L., Carew, H., Tompkins, C. K., Leung, D. W., Singer, J. W., and White, T. (2006) J. Lipid Res. 47, 593–604[Abstract/Free Full Text]
7. Eberhardt, C., Gray, P. W., and Tjoelker, L. W. (1997) J. Biol. Chem. 272, 20299–20305[Abstract/Free Full Text]
8. Agarwal, A. K., Arioglu, E., de Almeida, S., Akkoc, N., Taylor, S. I., Bowcock, A. M., Barnes, R. I., and Garg, A. (2002) Nat. Genet. 31, 21–23[CrossRef][Medline] [Order article via Infotrieve]
9. Beigneux, A. P., Vergnes, L., Qiao, X., Quatela, S., Davis, R., Watkins, S. M., Coleman, R. A., Walzem, R. L., Philips, M., Reue, K., and Young, S. G. (2006) J. Lipid Res. 47, 734–744[Abstract/Free Full Text]
10. Agarwal, A. K., Barnes, R. I., and Garg, A. (2006) Arch. Biochem. Biophys. 449, 64–76[CrossRef][Medline] [Order article via Infotrieve]
11. Agarwal, A. K., Sukumaran, S., Bartz, R., Barnes, R. I., and Garg, A. (2007) J. Endocrinol. 193, 445–457[Abstract/Free Full Text]
12. Athenstaedt, K., and Daum, G. (1997) J. Bacteriol. 179, 7611–7616[Abstract/Free Full Text]
13. de Kroon, A. I. (2007) Biochim. Biophys. Acta 1771, 343–352[Medline] [Order article via Infotrieve]
14. Lands, W. E. (1960) J. Biol. Chem. 235, 2233–2237[Free Full Text]
15. Chilton, F. H., Hadley, J. S., and Murphy, R. C. (1987) Biochim. Biophys. Acta 917, 48–56[Medline] [Order article via Infotrieve]
16. Post, M., Schuurmans, E. A., Batenburg, J. J., and Van Golde, L. M. (1983) Biochim. Biophys. Acta 750, 68–77[Medline] [Order article via Infotrieve]
17. Riekhof, W. R., and Voelker, D. R. (2006) J. Biol. Chem. 281, 36588–36596[Abstract/Free Full Text]
18. Kougias, P., Chai, H., Lin, P. H., Lumsden, A. B., Yao, Q., and Chen, C. (2006) Med. Sci. Monit. 12, RA5–16[Medline] [Order article via Infotrieve]
19. Chen, X., Hyatt, B. A., Mucenski, M. L., Mason, R. J., and Shannon, J. M. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 11724–11729[Abstract/Free Full Text]
20. Nakanishi, H., Shindou, H., Hishikawa, D., Harayama, T., Ogasawara, R., Suwabe, A., Taguchi, R., and Shimizu, T. (2006) J. Biol. Chem. 281, 20140–20147[Abstract/Free Full Text]
21. Shindou, H., Hishikawa, D., Nakanishi, H., Harayama, T., Ishii, S., Taguchi, R., and Shimizu, T. (2007) J. Biol. Chem. 282, 6532–6539[Abstract/Free Full Text]
22. Testet, E., Laroche-Traineau, J., Noubhani, A., Coulon, D., Bunoust, O., Camougrand, N., Manon, S., Lessire, R., and Bessoule, J. J. (2005) Biochem. J. 387, 617–626[CrossRef][Medline] [Order article via Infotrieve]
23. Richard, M. G., and McMaster, C. R. (1998) Lipids 33, 1229–1234[CrossRef][Medline] [Order article via Infotrieve]
24. Tong, A. H., Evangelista, M., Parsons, A. B., Xu, H., Bader, G. D., Page, N., Robinson, M., Raghibizadeh, S., Hogue, C. W., Bussey, H., Andrews, B., Tyers, M., and Boone, C. (2001) Science 294, 2364–2368[Abstract/Free Full Text]
25. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1998) Current Protocols in Molecular Biology, John Wiley & Sons, New York
26. Thomas, B. J., and Rothstein, R. (1989) Cell 56, 619–630[CrossRef][Medline] [Order article via Infotrieve]
27. Rothstein, R. (1991) Methods Enzymol. 194, 281–301[CrossRef][Medline] [Order article via Infotrieve]
28. Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983) J. Bacteriol. 153, 163–168[Abstract/Free Full Text]
29. Adams, A., Gottschling, D. E., Kaiser, C., and Stearns, T. (1997) Methods in Yeast Genetics: A Laboratory Course Manual, pp. 148–149, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
30. Oelkers, P., Cromley, D., Padamsee, M., Billheimer, J. T., and Sturley, S. L. (2002) J. Biol. Chem. 277, 8877–8881[Abstract/Free Full Text]
31. Meisinger, C., Sommer, T., and Pfanner, N. (2000) Anal. Biochem. 287, 339–342[CrossRef][Medline] [Order article via Infotrieve]
32. Yamashita, S., Hosaka, K., Miki, Y., and Numa, S. (1981) Methods Enzymol. 71, 528–536[Medline] [Order article via Infotrieve]
33. Krogh, A., Larsson, B., von Heijne, G., and Sonnhammer, E. L. (2001) J. Mol. Biol. 305, 567–580[CrossRef][Medline] [Order article via Infotrieve]
34. Nilsson, T., Jackson, M., and Peterson, P. A. (1989) Cell 58, 707–718[CrossRef][Medline] [Order article via Infotrieve]
35. Fleischer, T. C., Weaver, C. M., McAfee, K. J., Jennings, J. L., and Link, A. J. (2006) Genes Dev. 20, 1294–1307[Abstract/Free Full Text]
36. Huh, W. K., Falvo, J. V., Gerke, L. C., Carroll, A. S., Howson, R. W., Weissman, J. S., and O'Shea, E. K. (2003) Nature 425, 686–691[CrossRef][Medline] [Order article via Infotrieve]
37. Hofmann, K. (2000) Trends Biochem. Sci. 25, 111–112[CrossRef][Medline] [Order article via Infotrieve]
38. Turkish, A., and Sturley, S. L. (2007) Am. J. Physiol. 292, G953–G957[CrossRef]
39. Oh, C. S., Toke, D. A., Mandala, S., and Martin, C. E. (1997) J. Biol. Chem. 272, 17376–17384[Abstract/Free Full Text]
40. Nagiec, M. M., Wells, G. B., Lester, R. L., and Dickson, R. C. (1993) J. Biol. Chem. 268, 22156–22163[Abstract/Free Full Text]
41. Yang, H., Bard, M., Bruner, D. A., Gleeson, A., Deckelbaum, R. J., Aljinovic, G., Pohl, T. M., Rothstein, R., and Sturley, S. L. (1996) Science 272, 1353–1356[Abstract]
42. Bosson, R., Jaquenoud, M., and Conzelmann, A. (2006) Mol. Biol. Cell 17, 2636–2645[Abstract/Free Full Text]
43. Yang, Y., Cao, J., and Shi, Y. (2004) J. Biol. Chem. 279, 55866–55874[Abstract/Free Full Text]
44. Pik, J. R., and Thompson, W. (1978) Can. J. Biochem. 56, 765–768[Medline] [Order article via Infotrieve]
45. Rubin, R. P. (1983) Biochem. Biophys. Res. Commun. 112, 502–507[CrossRef][Medline] [Order article via Infotrieve]
46. Sanjanwala, M., Sun, G. Y., and MacQuarrie, R. A. (1989) Arch. Biochem. Biophys. 271, 407–413[CrossRef][Medline] [Order article via Infotrieve]
47. Schjerling, C. K., Hummel, R., Hansen, J. K., Borsting, C., Mikkelsen, J. M., Kristiansen, K., and Knudsen, J. (1996) J. Biol. Chem. 271, 22514–22521[Abstract/Free Full Text]
48. Lands, W. E., and Merkl, I. (1963) J. Biol. Chem. 238, 898–904[Free Full Text]
49. Oelkers, P., Tinkelenberg, A., Erdeniz, N., Cromley, D., Billheimer, J. T., and Sturley, S. L. (2000) J. Biol. Chem. 275, 15609–15612[Abstract/Free Full Text]
50. Resnick, R. J., and Tomaska, L. (1994) J. Biol. Chem. 269, 32336–32341[Abstract/Free Full Text]
51. Riekhof, W. R., Wu, J., Jones, J. L., and Voelker, D. R. (July 24, 2007) J. Biol. Chem. 10.1074/jbc.M705256200[Abstract/Free Full Text]
52. Benghezal, M., Roubaty, C., Veepuri, V., Knudsen, J., and Conzelmann, A. (August 3, 2007) J. Biol. Chem. 10.1074/jbc.M702719200[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				K. Yuki, H. Shindou, D. Hishikawa, and T. Shimizu Characterization of mouse lysophosphatidic acid acyltransferase 3: an enzyme with dual functions in the testis J. Lipid Res., May 1, 2009; 50(5): 860 - 869. [Abstract] [Full Text] [PDF]

				G. M. Carman and G.-S. Han Regulation of phospholipid synthesis in yeast J. Lipid Res., April 1, 2009; 50(Supplement): S69 - S73. [Abstract] [Full Text] [PDF]

				H. Shindou and T. Shimizu Acyl-CoA:Lysophospholipid Acyltransferases J. Biol. Chem., January 2, 2009; 284(1): 1 - 5. [Abstract] [Full Text] [PDF]

				M. A. Gijon, W. R. Riekhof, S. Zarini, R. C. Murphy, and D. R. Voelker Lysophospholipid Acyltransferases and Arachidonate Recycling in Human Neutrophils J. Biol. Chem., October 31, 2008; 283(44): 30235 - 30245. [Abstract] [Full Text] [PDF]

				K. Stalberg, A. C. Neal, H. Ronne, and U. Stahl Identification of a novel GPCAT activity and a new pathway for phosphatidylcholine biosynthesis in S. cerevisiae J. Lipid Res., August 1, 2008; 49(8): 1794 - 1806. [Abstract] [Full Text] [PDF]

				S. Matsuda, T. Inoue, H.-C. Lee, N. Kono, F. Tanaka, K. Gengyo-Ando, S. Mitani, and H. Arai Member of the membrane-bound O-acyltransferase (MBOAT) family encodes a lysophospholipid acyltransferase with broad substrate specificity. Genes Cells, August 1, 2008; 13(8): 879 - 888. [Abstract] [Full Text] [PDF]

				A. K. Ghosh, G. Ramakrishnan, and R. Rajasekharan YLR099C (ICT1) Encodes a Soluble Acyl-CoA-dependent Lysophosphatidic Acid Acyltransferase Responsible for Enhanced Phospholipid Synthesis on Organic Solvent Stress in Saccharomyces cerevisiae J. Biol. Chem., April 11, 2008; 283(15): 9768 - 9775. [Abstract] [Full Text] [PDF]

				Y. Zhao, Y.-Q. Chen, T. M. Bonacci, D. S. Bredt, S. Li, W. R. Bensch, D. E. Moller, M. Kowala, R. J. Konrad, and G. Cao Identification and Characterization of a Major Liver Lysophosphatidylcholine Acyltransferase J. Biol. Chem., March 28, 2008; 283(13): 8258 - 8265. [Abstract] [Full Text] [PDF]

				H.-C. Lee, T. Inoue, R. Imae, N. Kono, S. Shirae, S. Matsuda, K. Gengyo-Ando, S. Mitani, and H. Arai Caenorhabditis elegans mboa-7, a Member of the MBOAT Family, Is Required for Selective Incorporation of Polyunsaturated Fatty Acids into Phosphatidylinositol Mol. Biol. Cell, March 1, 2008; 19(3): 1174 - 1184. [Abstract] [Full Text] [PDF]

				D. Hishikawa, H. Shindou, S. Kobayashi, H. Nakanishi, R. Taguchi, and T. Shimizu Discovery of a lysophospholipid acyltransferase family essential for membrane asymmetry and diversity PNAS, February 26, 2008; 105(8): 2830 - 2835. [Abstract] [Full Text] [PDF]

				W. R. Riekhof, J. Wu, M. A. Gijon, S. Zarini, R. C. Murphy, and D. R. Voelker Lysophosphatidylcholine Metabolism in Saccharomyces cerevisiae: THE ROLE OF P-TYPE ATPases IN TRANSPORT AND A BROAD SPECIFICITY ACYLTRANSFERASE IN ACYLATION J. Biol. Chem., December 21, 2007; 282(51): 36853 - 36861. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 282/42/30562    most recent M706326200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Jain, S. Articles by Oelkers, P. Search for Related Content PubMed PubMed Citation Articles by Jain, S. Articles by Oelkers, P. Social Bookmarking                      What's this?