Originally published In Press as doi:10.1074/jbc.M700832200 on June 26, 2007
J. Biol. Chem., Vol. 282, Issue 42, 30889-30900, October 19, 2007
Klotho-related Protein Is a Novel Cytosolic Neutral
-Glycosylceramidase*
Yasuhiro Hayashi
,
Nozomu Okino
,
Yoshimitsu Kakuta
,
Toshihide Shikanai¶||,
Motohiro Tani**,
Hisashi Narimatsu¶, and
Makoto Ito
1
From the
Department of Bioscience and Biotechnology, Graduate School of Bioresource and Bioenvironmental Sciences, and **Department of Chemistry, Faculty of Science, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan, the ¶Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology, Central 2, 1-1-1 Umezono, Tsukuba, Ibaraki 305-8568, Japan, ||Mitsui Knowledge Industry Co., Ltd., 2-7-14, Higashi-Nakano, Nakano-Ku, Tokyo, 164-8555, Japan, and
CREST, JST, Japan
Received for publication, January 29, 2007
, and in revised form, June 8, 2007.
 |
ABSTRACT
|
|---|
Using C6-NBD-glucosylceramide (GlcCer) as a substrate, we detected the activity of a conduritol B epoxide-insensitive neutral glycosylceramidase in cytosolic fractions of zebrafish embryos, mouse and rat brains, and human fibroblasts. The candidates for the enzyme were assigned to the Klotho (KL), whose family members share a
-glucosidase-like domain but whose natural substrates are unknown. Among this family, only the KL-related protein (KLrP) is capable of degrading C6-NBD-GlcCer when expressed in CHOP cells, in which Myc-tagged KLrP was exclusively distributed in the cytosol. In addition, knockdown of the endogenous KLrP by small interfering RNA increased the cellular level of GlcCer. The purified recombinant KLrP hydrolyzed 4-methylumbelliferyl-glucose, C6-NBD-GlcCer, and authentic GlcCer at pH 6.0. The enzyme also hydrolyzed the corresponding galactosyl derivatives, but each kcat/Km was much lower than that for glucosyl derivatives. The x-ray structure of KLrP at 1.6Å resolution revealed that KLrP is a (
/
)8 TIM barrel, in which Glu165 and Glu373 at the carboxyl termini of
-strands 4 and 7 could function as an acid/base catalyst and nucleophile, respectively. The substrate-binding cleft of the enzyme was occupied with palmitic acid and oleic acid when the recombinant protein was crystallized in a complex with glucose. GlcCer was found to fit well the cleft of the crystal structure of KLrP. Collectively, KLrP was identified as a cytosolic neutral glycosylceramidase that could be involved in a novel nonlysosomal catabolic pathway of GlcCer.
 |
INTRODUCTION
|
|---|
Glucosylceramide (GlcCer)2 is a precursor for ganglio-, lacto/neolacto-, and globo/isoglobo-series glycosphingolipids (GSLs). The synthesis of GlcCer is catalyzed by GlcCer synthase-1, mainly located on the cytosolic face of the Golgi apparatus (1, 2). The GlcCer generated is then translocated to the luminal surface of the Golgi membrane by an unknown mechanism, where it is converted to lactosylceramide (LacCer) by LacCer synthase. This is followed by a step-by-step extension of sugar chains by corresponding glycosyltransferases to generate complex GSLs. Finally, the GSLs are transported through the trans-Golgi network to the plasma membrane, where the sugar moiety faces the extracellular space, and the Cer moiety is embedded in the upper layer of the membrane. Catabolism of GlcCer primarily takes place in the lysosomes where acid
-glucosidase (glucocerebrosidase, GBA1; EC 3.2.1.4
[EC]
5) cleaves the
-glucosyl linkage between Cer and glucose with the assistance of a noncatalytic protein, saposin C, and negatively charged lipids (3, 4). The enzyme is specifically and irreversibly inhibited by conduritol B epoxide (CBE). An inherited deficiency of the enzyme causes Gaucher disease, the most common lysosomal storage disease, in which GlcCer is accumulated in lysosomes of laden tissue macrophages. However, the accumulation of GlcCer in other cell types is not obvious in patients with Gaucher disease despite the significant decrease of GBA1 activity, and thus the existence of an alternative catabolic pathway for GlcCer was speculated (5, 6).
Among the
-glucosidases reported, lactase phlorizin hydrolase (LPH, EC 3.2.1.62/108) was shown to hydrolyze GlcCer (7). The enzyme, sensitive to CBE, is exclusively present in the microvilli of intestinal epithelial cells and possibly functions as a kind of digestive enzyme. Very recently, two research groups reported an alternative pathway (8, 9), the catabolism of GlcCer by
-glucosidase 2 (GBA2), which has been known as a bile acid
-glucosidase (10). The enzyme, relatively nonsensitive to CBE, seems to be a membrane-bound enzyme of the ER (8) or located at or close to the cell surface (9). Unexpectedly, GBA2 knock-out mice exhibited a normal metabolism of bile acid. Alternatively, GlcCer was found to be accumulated in the testes, brain, and liver, causing male infertility possibly because of abnormal sperm (8). GBA2 was likely to be the same enzyme that was previously described as a nonlysosomal CBE-insensitive glucosylceramidase (11), which was extremely sensitive to inhibition by hydrophobic deoxynojirimycin analogues (12).

View larger version (23K):
[in this window]
[in a new window]
|
FIGURE 1. Evidence for the presence of a cytosolic neutral GCase. A, HPLC showing the generation of C6-NBD-Cer in the assay of LacCer synthase of human primary fibroblasts. The lysate of human fibroblasts was incubated at 37 °C for 1 h with 50 pmol of C6-NBD-GlcCer and 5 nmol of UDP-Gal in 50 mM Hepes buffer, pH 7.5, containing 6.5 nmol of lecithin in the presence or absence of 0.5 mM CBE. The reaction products were analyzed by reverse phase HPLC (13). B, assay of neutral GCase activity in the lysates of rat brain, zebrafish embryos, puffer fish liver, and slime mold. The lysates were incubated at 37 °C for 1 h with 50 pmol of C6-NBD-GlcCer in 50 mM MES buffer, pH 6.0, containing 0.25% sodium cholate in the presence of 0.5 mM CBE. C, pH dependence of GCase activity in the presence or absence of CBE. The GCase activity was measured at 37 °C for 1 h with 100 pmol of C6-NBD-GlcCer in 150 mM GTA buffer with different pH values containing 0.25% sodium cholate in the presence (closed circle) or absence (open circle) of CBE. D, localization of CBE-insensitive neutral CGase in rat brain. Rat brain was homogenized in 0.25 M sucrose, and the homogenate was centrifuged at 10,5000 x g for 60 min. The supernatant and precipitate were separately subjected to the neutral GCase activity as described above. The activities of lactate dehydrogenase and acid glucocerebrosidase were measured as markers for the cytosolic fraction and membrane fraction, respectively, as described under "Experimental Procedures." In a typical experiment, 80% of the dehydrogenase activity and 70% of the acid glucocerebrosidase activity were recovered in the cytosolic fraction and the membrane fraction, respectively.
|
|
During the course of the development of a sensitive assay for glycosyltransferases using fluorescent substrates and HPLC (13), activity for the hydrolysis of C6-NBD-GlcCer was detected in zebrafish embryos, mouse and rat brains, and human fibroblasts in the presence of CBE at neutral pH. The CBE-insensitive activity of rat brains was present in not only membrane-bound fractions (possibly GBA2) but also cytosolic fractions (this study). Using a bioinformative approach, the Klotho (KL) family emerged as a candidate for the novel GlcCer-degrading enzyme because they share a
-glucosidase-like domain, although their natural substrates remain unknown. It has been reported that mutation of the KL gene in mice leads to a syndrome resembling aging, and thus KL seems to be involved in the suppression of aging (14). Among the KL family proteins, including KL (14),
KL (15), KL lactase phlorizin hydrolase (16), and KL-related protein (KLrP) (17), only KLrP was found to be capable of degrading C6-NBD-GlcCer in the presence of CBE at neutral pH when expressed in CHOP cells. A kinetic analysis uncovered that KLrP hydrolyzed C6-NBD-GlcCer and 4MU-Glc as well as C6-NBD-GalCer and 4MU-GalCer, although the kcat/Km for the former was relatively higher than that for the latter. This result indicated that KLrP should be defined as a "
-glycosylceramidase" (GCase) rather than a "
-glucosylceramidase" or "
-glucocerebrosidase." We report here that KLrP is a novel cytosolic neutral GCase and present the results of kinetic, cellular, and x-ray crystal analyses of the enzyme. This is the first report describing the crystal structure of KLrP.
 |
EXPERIMENTAL PROCEDURES
|
|---|
Materials—Human primary fibroblasts were obtained from Dr. K. Ohno (Tottori University, Tottori, Japan). CHOP cells (Chinese hamster ovary-derived cells expressing polyoma LT antigen) were donated by Dr. J. W. Dennis (Samuel Lunenfeld Research Institute, Mt. Sinai Hospital, Toronto, Canada) through Dr. K. Nara (Mitsubishi Kagaku Institute of Life Sciences, Tokyo, Japan). HEK293 cells, human embryonic kidney cells (JCRB9068; established by F. L. Graham), were obtained from the Human Science Research Resource Bank. GlcCer, LacCer, and GM1a were purchased from Wako Pure Chemical Industries (Osaka, Japan). GalCer, sulfatides, GlcSph, and GalSph were purchased from Matreya, and
-GalCer (Gala1-1'Cer) was purchased from Alexis Biochemicals. Horseradish peroxidase-labeled anti-mouse IgG antibody was purchased from Nacalai Tesque (Kyoto, Japan). Cy3-labeled anti-mouse IgG antibody, C6-NBD-GlcCer, C6-NBD-GalCer, and C6-NBD-LacCer were obtained from Sigma. The anti-Myc antibody and C6-NBD-Cer were purchased from Invitrogen. Precoated Silica Gel 60 TLC plates were purchased from Merck. [14C]GlcCer and [14C]GalCer, labeled at C1 of stearic acid, were synthesized as described (18). All other reagents were of the highest purity available.

View larger version (25K):
[in this window]
[in a new window]
|
FIGURE 2. Neutral GCase activities of CHOP cells transformed with cDNA encoding KL family proteins. A, neutral GCase activity of cell lysates of CHOP transfectants in the presence or absence of 0.5 mM CBE. KL, KL, KLPH (KL lactase phlorizin hydrolase), KLrP, and mock represent the transfectants with cDNA encoding each KL family protein or empty vector (mock). B, galactosylcermidase activity of cell lysates of CHOP transfectants in the presence or absence of 0.5 mM CBE. The activities of neutral GCase and galactosylceramidase were measured using C6-NBD-GlcCer and C6-NBD-GalCer, respectively, as described under "Experimental Procedures." C, Western blotting of KL family proteins expressed in CHOP cells. The proteins were extracted and stained with horseradish peroxidase-labeled anti-Myc antibody.
|
|
Cloning of cDNA Encoding Proteins of the KL Family—The complete open reading frames for KL (NM_013823
[GenBank]
.1), KL
(NM_031180
[GenBank]
.2), KL lactase phlorizin hydrolase (NM_145835
[GenBank]
.1), and KLrP (GBA3, NM_020973
[GenBank]
.2) were amplified from a cDNA library derived from human embryonic kidney-derived HEK293 cells and mouse liver using specific primers containing restriction sites and an extended Kozak sequence in front of the start codon. The PCR product was subcloned into pcDNA3.1/Myc-His(+) (Invitrogen) or pET23b(+) (Novagen).
Cell Culture and Transfection—CHOP cells were grown at 37 °C in
-minimal essential medium supplemented with 10% fetal bovine serum, 100 µg/ml streptomycin, and 100 units/ml penicillin in a humidified incubator containing 5% CO2. HEK293 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 60 µg/ml kanamycin in a humidified incubator containing 5% CO2. cDNA transfection was carried out using LipofectamineTM Plus (Invitrogen) according to the manufacturer's instructions.
Assay of Neutral GCase Activity in Vitro—An aliquot of 100 pmol of C6-NBD-GlcCer or C6-NBD-GalCer was incubated at 37 °C for 30 min with an appropriate amount of enzyme in 20 µl of 50 mM MES buffer, pH 6.0, containing 0.25% sodium cholate in the presence or absence of 0.5 mM CBE. The reaction was stopped by adding 100 µl of chloroform/methanol (2:1; v/v). The reaction mixture was then dried using a SpeedVac concentrator, dissolved in 15 µl of chloroform/methanol (2:1; v/v), and applied to a TLC plate, which was developed with chloroform/methanol/H2O (65:25:4, v/v/v). The TLC plate was scanned with a Shimadzu CS-9300 chromatoscanner (excitation 470 nm, emission 530 nm). Alternatively, 100 pmol of [14C]GlcCer was used for the assay instead of the fluorescent substrates. After incubation at 37 °C for the periods indicated, reaction mixture was applied onto a TLC plate, which was developed with chloroform/methanol/H2O (65:25:4, v/v/v). [14C]Cer released and [14C]GlcCer unhydrolyzed on the TLC were quantified with FLA5000.
Determination of Substrate Specificity of KLrP—Twenty nmol of various substrates (GlcCer, GalCer,
-GalCer, GlcSph, GalSph, sulfatides, LacCer, and GM1a) were incubated with an appropriate amount of enzyme in 20 µl of 50 mM MES buffer, pH 6.0, containing 1% sodium cholate. After incubation, the reaction was stopped by adding 100 µl of chloroform/methanol (2:1; v/v). The reaction mixture was then dried using a SpeedVac concentrator, dissolved in 15 µl of chloroform/methanol (2:1; v/v), and applied to a TLC plate, which was developed with chloroform, methanol, 0.02% CaCl2 (6.5:4:1, v/v/v) except in experiments using GM1a and sulfatide as a substrate. For these substrates, chloroform, methanol, 0.02% CaCl2 (2:3:1, v/v/v) was used as a developing solvent. GSLs and sugars were visualized by spraying TLC plates with orcinol-H2SO4 reagent and scanning them with a Shimadzu CS-9300 chromatoscanner with the reflectance mode set at 540 nm.
Assay of Lactate Dehydrogenase Activity—An aliquot of 1 µmol of sodium pyruvate was incubated at 37 °C for 30 min with an appropriate amount of enzyme in 1 ml of 50 mM phosphate buffer, pH 7.5, and 0.2 mM NADH. The reaction was stopped by boiling for 5 min. The reaction mixture was then examined with an Ultraspec 3000 (Amersham Biosciences) with absorbance at 340 nm.

View larger version (35K):
[in this window]
[in a new window]
|
FIGURE 3. Subcellular localization of Myc-tagged KLrP in CHOP cells and degradation of C6-NBD-GlcCer in vivo. A, fluorescence microscopy of Myc-tagged KLrP in CHOP cells. Cells were co-transfected with a plasmid vector containing KLrP and that containing enhanced green fluorescent protein (Clontech) as a cytosolic marker, cultured for 18 h, and then fixed with 3% paraformaldehyde. The cells were permeabilized with 0.1% Triton X-100 and then stained with anti-Myc antibody followed by anti-mouse IgG-Cy3. The Myc signals were examined under a fluorescence microscope. B, degradation of C6-NBD-GlcCer in vivo. CHOP cells (0.5 x 105) were incubated with 2.5 µM C6-NBD-GlcCer in -minimal essential medium for 3 h in a 5% CO2 incubator. Cells were collected, and lipids were extracted with isopropyl alcohol/hexane/water (55/35/10, v/v/v) and then analyzed by TLC as described under "Experimental Procedures."
|
|

View larger version (19K):
[in this window]
[in a new window]
|
FIGURE 4. Effects of KLrP siRNA on neutral GCase activity and GSL metabolism in HEK293 cells. A, effects on neutral GCase activity. HEK293 cells were transfected with BLOCK-iT Fluorescent Oligo (control), KLrP siRNA-332, or siRNA-564. Seventy-two h after transfection, cells were harvested, and neutral GCase activity was measured using C6-NBD-GlcCer as a substrate as described under "Experimental Procedures." Values were averaged from three independent experiments with S.D. B and C, effects on GSL metabolism. HEK293 cells were transfected with BLOCK-iT Fluoresecnt Oligo (control), KLrP siRNA-332, or siRNA-564. Sixty-eight h after transfection, the medium was replaced with Dulbecco's modified Eagle's medium supplemented with 5% fetal bovine serum containing 0.2 µCi of [14C]Gal for 9 h. Cells were harvested, and GSLs were extracted and analyzed as described under "Experimental Procedures." Values were averaged from six independent experiments with S.D.
|
|
Immunocytochemistry and Fluorescence Microscopy—Cells transfected with the cDNA were cultured on a coverglass and then fixed with 3% paraformaldehyde in PBS for 15 min. After being rinsed with PBS and 50 mM NH4Cl in PBS, cells were permeabilized with 0.1% Triton X-100 in PBS. After treatment with blocking buffer (5% skim milk in PBS) for 15 min, the samples were incubated with anti-Myc antibody (diluted 2000 times with blocking buffer) at 4 °C overnight, followed by incubation with Cy3-labeled anti-mouse IgG antibody at room temperature for 2 h. Samples were observed with a confocal laserscanning microscope (Digital Eclipse C1; Nikon).
Catabolism of Fluorescent GlcCer in Vivo—CHOP cells (0.5 x 105) were seeded in a 12-well microplate and incubated at 37 °C for 24 h to allow them to attach to the plate. Then cells were transformed with expression vector pcDNA3.1 containing KLrP (KLrP overexpressor) or empty vector (mock transfectant) and then incubated at 37 °C for 3 h in
-minimal essential medium containing 1 nmol of C6-NBD-GlcCer. After the incubation, cells were harvested by centrifugation (800 x g for 5 min) and washed three times with PBS. Total lipids were extracted with 200 µl of isopropyl alcohol/hexane/water (55:35: 10, v/v/v) for 10 min with sonication. After centrifugation at 20,000 x g for 5 min, the upper layer was dried under N2 gas, dissolved in 25 µl of chloroform/methanol (2:1, v/v), and then applied to a TLC plate that was developed with chloroform/methanol/H2O (65:25:4, v/v/v). Fluorescent lipids on the TLC plate were visualized under a UV illuminator.

View larger version (35K):
[in this window]
[in a new window]
|
FIGURE 5. Purification and characterization of the recombinant KLrP. A, SDS-PAGE of the KLrP stained with Coomassie Brilliant Blue. KLrP was purified from the lysate of E. coli BL21(DE3)pLyS cells transformed with pET23/KLrP as described under "Experimental Procedures." Lane 1, standard markers; lane 2, cell lysate; lane 3, after purification with Hi-Trap Chelating column; lane 4, after purification with SuperdexTM 200 10/300 GL. B, pH dependence of GCase activity of the purified KLrP. Aliquots of 100 pmol of C6-NBD-GlcCer were incubated with 1 milliunits (0.1 µg) of the recombinant KLrP at 37 °C for 15 min in a 50 mM concentration of the various buffers shown in the inset of B. C, inhibitory effects of CBE on KLrP (closed circle) and GBA1 (open circle). Aliquots of 100 pmol of C6-NBD-GlcCer were incubated with 1 milliunit of enzyme at various concentrations of CBE. D, hydrolysis of authentic GlcCer and GalCer by the recombinant KLrP. Aliquots of 100 pmol of [14C]GlcCer (d18:1, [14C]C18:0) or [14C]GalCer (d18:1, [14C]C18:0) were incubated with various amounts of KLrP at 37 °C for 30 min. The reaction products were applied to the TLC plate, which was developed with chloroform/methanol/H2O (65:25:4, v/v/v), followed by visualization with FLA5000.
|
|
RNA Interference—Gene silencing of the KLrP in HEK293 cells was performed using stealth RNA interference (Invitrogen) according to the instructions of the manufacturer. The sequence-specific DNA oligonucleotide was designed using the sequence of human KLrP cDNA as described below. Two sets of siRNA corresponding to the sequences of the 332-nucleotide (siRNA-332) GGGTTACTCCCATTGTGACCCTCTA and the 564-nucleotide (siRNA-564) TGGAGGTTATCAGGCAGCTCATAAT, from the initiation codon of KLrP cDNA, were used. BLOCK-iT Fluorescent Oligo (Invitrogen), a fluorescence-labeled, double-stranded RNA duplex with the same length, charge, and configuration as standard siRNA, was used as a control siRNA (19, 20). HEK293 cells were transfected with the siRNA using OligofectamineTM reagent (Invitrogen) according to the instructions of the manufacturer.
Metabolic Labeling and Extraction of GlcCer—HEK293 cells were incubated at 37 °C for the period indicated in Dulbecco's modified Eagle's medium supplemented with 5% fetal bovine serum containing 0.2 µCi of [14C]Gal for 9 h. Cells were harvested by centrifugation (800 x g for 5 min) and washed with PBS. Lipids were extracted with 200 µl of isopropyl alcohol/hexane/water (55:35:10, v/v/v) for 10 min with sonication. After centrifugation at 20,000 x g for 5 min, the upper layer was dried under N2 gas, dissolved in 25 µl of chloroform/methanol (2:1, v/v), and then applied to a TLC plate, which was developed with chloroform/methanol/H2O (65:25:4, v/v/v). Radioactive GlcCer on the TLC plate was detected with an imaging analyzer FLA5000 (Fuji Film).
Expression and Purification of Recombinant KLrP—Escherichia coli strain BL21(DE3)pLysS cells were transformed with pET23b containing the KLrP cDNA and grown at 25 °C for 24 h with shaking in 200 ml of Luria-Bertani medium supplemented with 100 µg/ml carbenicillin and 35 µg/ml chloramphenicol. Then cells were harvested by centrifugation (8,000 x g for 10 min) and suspended in extraction solution (0.15 M NaCl in 20 mM sodium phosphate buffer, pH 7.4). After sonication for 1 min, cell debris was removed by centrifugation (8,000 x g for 10 min). The supernatant obtained was applied to a Hi-Trap Chelating HP column (Amersham Biosciences), which was chelated with Ni2+, and then the column was washed with 20 mM sodium phosphate buffer, pH 7.4, containing 0.15 M NaCl and 30 mM imidazole. The enzyme was eluted from the column with 20 mM sodium phosphate buffer, pH 7.5, containing 0.15 M NaCl and 100 mM imidazole. The eluted fractions were pooled and then loaded onto a column of SuperdexTM 200 10/300 GL (Amersham Biosciences) equilibrated with 25 mM MES buffer, pH 6.0, containing 100 mM NaCl at a flow rate of 0.5 ml/min using a BioCAD sprint system (PE Biosystems). The purified enzyme was dialyzed against deionized water before use.
Crystallization of KLrP and Data Collection—The purified recombinant KLrP was concentrated to 5 mg/ml in 25 mM MES buffer, pH 6.0, containing 100 mM NaCl. Initial screening for crystallization of KLrP was performed with the hanging drops by vapor diffusion method at 20 °C by mixing equal volumes of protein (0.5 µl) and reservoir solution (0.5 µl), using crystallization screen kit Crystal Screens (Hampton Research). The best crystal for x-ray diffraction analysis was obtained within 1 week, using 0.1 M Tris-HCl buffer, pH 8.5, containing 0.2 M magnesium chloride, 27.5% PEG3350, 5% glycerol, 0.5 M glucose or 0.5 M galactose (Crystal Screens, number 85 modified). X-ray diffraction data were collected using the synchrotron radiation source at the BL38B1 station of Spring-8 (Hyogo, Japan). Data were processed using HKL2000 (21). The crystal of KLrP in a complex with Glc (KLrP·Glc) diffracted up to 1.6 Å and belongs to the orthorhombic space group P21P21P21 with unit cell dimensions of a = 66.04 Å, b = 83.98 Å, and c = 94.89 Å. The crystal of KLrP in a complex with Gal (KLrP/Gal) diffracted up to 1.8 Å and belongs to the orthorhombic space group P21P21P21 with unit cell dimensions of a = 66.24 Å, b = 83.80 Å, and c = 93.60 Å. The data statistics are summarized in Table 2.

View larger version (24K):
[in this window]
[in a new window]
|
FIGURE 6. Detergent dependence and substrate specificity of recombinant KLrP. A and B, detergent dependence of purified KLrP. Aliquots of 20 nmol of native GlcCer were incubated at 37 °C for 3 h with 1.5 µg of recombinant KLrP in 20 µl of 50 mM MES buffer, pH 6.0, containing various amounts of sodium cholate. In the inset of B, C6-NBD-GlcCer was used as a substrate instead of native GlcCer. C, substrate specificity of KLrP for various GSLs. Aliquots of 20 nmol of GSLs were incubated with 1.5 µg of recombinant KLrP at 37°C for 3 h in 20 µl of 50 mM MES buffer, pH 6.0, containing 1% (w/v) of sodium cholate. The hydrolysis extent of substrates was described under "Experimental Procedures." Values were averaged from three independent experiments with S.D.
|
|
Structural Determination and Model Refinement of KLrP—The crystal structure of KLrP·Glc or that in a complex with Gal (KLrP·Gal) was determined by molecular replacement using an aphid Brevicoryne brassicae myrosinase (Protein Data Bank code 1WCG) as a search model with the program molrep (22). Structure refinement was done using Refmac (23) with diffraction data from 21.4 to 1.6 Å. After the first step of refinement, the atomic model of the protein was rebuilt using the program ARP/wARP (24). Iterative cycles of refinement and manual rebuilding in Coot (25) were carried out until the free R-factor converged. The stereochemical checks were carried out using PROCHECK (26). Refinement statistics are summarized in Table 2.
Gas-Liquid Chromatography (GC) of Fatty Acids—Purified recombinant KLrP (3 mg) was freeze-dried and dissolved in 1 ml of 5% HCl-MeOH and then heated at 80 °C for 12 h in a sealed tube. After cooling, the solution was extracted three times with hexanes. The hexane extracts were dried under N2 gas, dissolved in 2 µl of hexane, and then injected into a Shimadzu GC-14 GC (Shimadzu Co., Kyoto, Japan) equipped with a flame ionization detector and capillary column (HR-SS-10, 30 m x 0.25 mm; Shinwa Chemical Industries Ltd., Kyoto, Japan). The methyl esters detected by GC were identified by conventional methods using the retention time of a PUFA-3 standard mixture (Matrea, Inc.).
 |
RESULTS
|
|---|
Detection of Cytosolic Neutral GCase Activity—During the assay of the LacCer synthase activity of human primary fibroblasts using C6-NBD-GlcCer as an acceptor substrate and UDP-Gal as a donor substrate at pH 6.0, C6-NBD-Cer was detected on HPLC in addition to the expected product C6-NBD-LacCer (Fig. 1A). The generation of C6-NBD-Cer, which was prevented by boiling the lysate for 5 min, was significantly decreased but not completely eliminated by the addition of CBE, a potent inhibitor for acid glucocerebrosidase (GBA1) (Fig. 1A). Interestingly, the hydrolysis of C6-NBD-GlcCer to C6-NBD-Cer in the presence of CBE was observed when lysates of human fibroblasts, mouse (data not shown) and rat brains, zebrafish embryos, and puffer fish liver, but not slime mold, were used as an enzyme source (Fig. 1B). The neutral GCase activity of human fibroblasts reached a maximum at around pH 5 in the absence of CBE and at pH 6-7 in the presence of CBE (Fig. 1C). The CBE-insensitive GCase activity of rat brain was mainly recovered from the cytosolic fraction (lactate dehydrogenase-rich fraction) rather than the membrane fraction (acid glucocerebrosidase-rich fraction) (Fig. 1D). It is worth noting that a cytosolic protein capable of hydrolyzing GlcCer has yet to be reported.
Candidates for a Novel Neutral GCase—We have isolated the gene encoding a neutral GCase from the bacterium Paenibacillus sp. TS12 (27); however, no homologous sequence has been found in the human gene data base. When CAZy (a data base describing the families of structurally related catalytic and carbohydrate-binding modules or functional domains of enzymes that degrade, modify, or create glycosidic bonds) was searched using the key words "beta/glucosidase/human," several candidate proteins were found in glycohydrolase (GH) family 1, 9, and 30. Notably, proteins assigned to the KL family in GH1 emerged as possible candidates for the neutral GCase, because they share the
-glucosidase-like domain (GH1 domain), although their natural substrates have yet to be clarified. Furthermore, its orthologues were found in data bases of rat, zebrafish, and puffer fish, but not slime mold, consistent with the detection of the activity (Fig. 1B). Thus, we attempted to examine the neutral GCase activity of KL family proteins, including KL (14),
KL (15), KL lactase phlorizin hydrolase (16), and KLrP (17), when they were expressed in CHOP cells. As a result, neutral GCase activity was found to increase in the cell lysates of the overexpressors of KLrP but not other KL family proteins (Fig. 2A), although each protein was expressed at almost the same level in CHOP cells (Fig. 2C). Interestingly, the increase in the neutral GCase activity of KLrP-overexpressing cells was much greater in the presence of CBE than in the absence (Fig. 2A), suggesting that the activity of CBE-sensitive GBA1 was not completely neglected even at neutral pH under the assay conditions used. CBE-insensitive
-galactosylceramidase activity, which was assayed using C6-NBD-GalCer instead of C6-NBD-GlcCer, was also increased in overexpressors of KLrP but not other Klotho family proteins (Fig. 2B). However, no increase in activity was observed when C6-NBD-LacCer was used as a substrate instead of C6-NBD-GalCer (data not shown).

View larger version (49K):
[in this window]
[in a new window]
|
FIGURE 7. X-ray crystal structure of KLrP. A and B, structure of KLrP in a complex with Glc (KLrP·Glc) is shown by molecular surface gray and a ribbon diagram. Glc is shown with carbon atoms as green and oxygen atoms as red. All images here were prepared using program Pymol (available on the World Wide Web). C, conformation of Glc and two catalytic glutamate residues (Glu165 as an acid/base catalyst and Glu373 as a nucleophile) in KLrP·Glc. The distance of carboxyl oxygens between Glu165 and Glu373 is calculated to be 5.3 Å. D, point mutation of two catalytic residues. Purified wild-type KLrP (WT) and mutants (E165D, E373D, E165Q, and E373Q) were subjected to 10% SDS-PAGE (top) and a neutral GCase assay (bottom). Myc-tagged KLrP and its mutants were stained with Coomassie Brilliant Blue. For the assay of GCase, 100 pmol of C6-NBD-GlcCer was incubated with 1 µg of enzyme in 50 mM MES buffer, pH 6.0, containing 0.25% sodium cholate at 37 °C for 12 h.
|
|
Subcellular Localization and in Vivo Activity of KLrP in CHOP Cells—To explore the distribution of KLrP, Myc-tagged KLrP was overexpressed in CHOP cells with a cytosolic marker, enhanced green fluorescent protein. The signal of KLrP was exclusively expressed in the cytosol and completely merged with that of enhanced green fluorescent protein (Fig. 3A). This result is very consistent with the putative structure of KLrP, which possesses neither a signal sequence nor a transmembrane domain (supplemental Fig. 1A) and also the cellular localization of KLrP in rat brains (Fig. 1D). Next, we examined whether C6-NBD-GlcCer could be hydrolyzed by the enzyme in vivo when the substrate was added to a culture of CHOP cells that were transformed with KLrP cDNA or empty vector (mock transfectants). Interestingly, the C6-NBD-GlcCer incorporated into the cells was catabolized to C6-NBD-Cer much faster in KLrP overexpressors than in mock transfectants (Fig. 3B).
Effects of siRNA for KLrP on GlcCer Metabolism—To verify whether endogenous KLrP is involved in the metabolism of GlcCer, two sets of siRNA were examined to suppress the endogenous activity of KLrP. Interestingly, the siRNA-564 inhibited the activity of endogenous GCase in HEK293 cells, whereas siRNA-332 did not affect the activity (Fig. 4A). Next, the cellular metabolism of GlcCer was examined after RNA interference. As a result, it was found that the radioactive band corresponding to ceramide monohexoside was significantly increased by treatment of the cells with siRNA-564 but not siRNA-332 when cells were metabolically labeled with [14C]Gal (Fig. 4, B and C). The radioactive band was likely to be [14C]GlcCer, since RF of the band is almost identical to that of authentic [14C]GlcCer (d18:1, C18:0) but not [14C]GalCer (d18:1, C18:0) on a borate-impregnated TLC plate, which is authentically used for the separation of GlcCer from GalCer (supplemental Fig. 2). Furthermore, whole cellular GSLs also increased in siRNA-564-transfected cells but not siRNA-332-transfected cells in comparison with control cells. These results strongly suggested that KLrP is crucially responsible for the metabolism of GlcCer and consequently regulates the content of whole cellular GSLs starting from GlcCer as a precursor.
Purification and Characterization of the Recombinant KLrP—The KLrP was expressed in E. coli strain BL21(DE3)pLysS and then purified from the soluble fraction using HiTrap Chelating and Superdex 200 columns as described under "Experimental Procedures." In a typical experiment, 0.6 mg of the purified KLrP, which showed a single protein band having a molecular mass of 57 kDa on SDS-PAGE (Fig. 5A, lane 4), was obtained from 200 ml of culture. The purified KLrP was then used for characterization (Figs. 5 and 6) and kinetic (Table 1) and x-ray crystal analyses (Figs. 7, 8, 9 and 10 and Table 2) as described below. The neutral GCase activity of the purified KLrP was found to be maximum at pH 6.0-7.0 when C6-NBD-GlcCer was used as a substrate, indicating that the protein is a neutral GCase (Fig. 5B). The activity was not inhibited by CBE until 10-5 M and slightly inhibited at 10-2 M, whereas GBA1 was strongly inhibited by CBE with an ID50 of 7 x 10-5 M (Fig. 5C). To address whether the purified protein can hydrolyze not only fluorescent short-chain GSLs but also authentic GSLs, 14C-labeled GlcCer and GalCer (C1 of stearic acids was labeled with the isotope) were used for assay. As a result, the purified protein was found to hydrolyze [14C]GlcCer as well as [14C]GalCer to produce [14C]Cer, although the hydrolysis for the former was much faster than that for the latter (Fig. 5D). The extent of hydrolysis of native GlcCer with the enzyme depended on the concentration of detergents in the reaction mixture (Fig. 6A). The optimum concentration of sodium cholate was 1.0-2.5% for GlcCer, whereas that for C6-NBD-GlcCer was 0.25% (Fig. 6B). The difference of the optimum concentration of detergent may stem from the solubility of the substrate used. As shown in Fig. 6C, GlcCer was the best substrate for KLrP, followed by GalSph, GlcSph, and GalCer; however, no hydrolysis of
-GalCer, sulfatides, LacCer, or GM1a was observed under the conditions used. Kinetic parameters of recombinant KLrP for various substrates were calculated according to Hanes-Woolf plots (Table 1). Km values for 4MU-Glc and 4MU-Gal were 49.3 and 145 µM, respectively, values similar to those reported previously (28). KLrP hydrolyzed C6-NBD-GlcCer and authentic GlcCer (d18:1, C18:0) with a kcat/Km of 1.57 and 0.03, respectively, in the presence of 0.25% sodium cholate in the reaction mixture. It is worth noting that the enzyme hydrolyzed not only GlcCer and GlcSph but also GalCer and GalSph; therefore, KLrP should be defined as a "
-glycosylceramidase" rather than a "
-glucosylceramidase" or "
-glucocerebrosidase." However, each kcat/Km for GalCer was much lower than that for the corresponding GlcCer (Table 1).
View this table:
[in this window]
[in a new window]
|
TABLE 1 Kinetic parameters for the recombinant KLrP
The reaction mixtures containing various concentrations of substrates were incubated in 50 mM MES buffer, pH 6.0, at 37 °C for 15 min (for 4MU-Glc, 4MU-Gal, C6-NBD-GlcCer, and C6-NBD-GalCer), 30 min (for [14C]GlcCer), and 90 min (for [14C]GalCer), respectively. The concentration of KLrP was 5, 25, and 75 µg/ml, respectively. When GSL substrates were used, 0.25% sodium cholate was included in the reaction mixture. The kinetic parameters were calculated using Hanes-Woolf plots.
|
|

View larger version (40K):
[in this window]
[in a new window]
|
FIGURE 8. Identification of lipids bound to the active site of KLrP and model structure of KLrP with GlcCer. A, the electron densities for Glc and two unknown compounds in the active site of the crystal structure of KLrP. B, GC analysis of lipids extracted from the purified recombinant KLrP with hexane. The hexane-extracted sample was analyzed by GC as described under "Experimental Procedures." C, the substrate-binding cleft of KLrP occupied with Glc and two fatty acids. One molecule each of Glc (green), palmitic acid form I (blue), form II (light blue), and oleic acid (yellow) was superimposed on the corresponding electron density in the cleft. D, model structure of the catalytic domain of KLrP with GlcCer.
|
|
X-ray Crystal Structure of KLrP—Fig. 7A shows the x-ray crystal structure of KLrP in a complex with glucose (KLrP·Glc) at a resolution of 1.6 Å, which was built using collective synchrotron data (Table 2). As expected from the deduced primary structure belonging to a family of the GH-A clan, KLrP·Glc shows a (
/
)8TIM barrel in which Glu165 and Glu373 at the carboxyl termini of
-strands 4 and 7 could function as an acid/base catalyst and a nucleophile, respectively (Fig. 7B). Actually, neutral GCase activity was greatly reduced in the mutants E165D and E373D, in which each catalytic Glu was replaced with Asp, whereas almost no activity was detected in the mutants E165Q and E373Q, in which each catalytic Glu was replaced with Gln (Fig. 7D). The distance between the carboxyl oxygen atoms of two catalytic residues was 5.3 Å, indicating that the reaction proceeds with the anomeric carbon retained upon cleavage rather than inverted (Fig. 7C).
Identification of Lipids Bound to the Active Site of KLrP and Model Structure of KLrP with GlcCer—In addition to the electron density of GlcCer, two compounds showing well resolved electron density were found in the active site of KLrP·Glc, and they were assumed to be fatty acids judging from their electron density (Fig. 8A). To identify these two molecules, the hexane extract of the purified recombinant KLrP was subjected to GC after methanolysis of the sample as described under "Experimental Procedures." As a result, two molecules were assigned to be a palmitic acid (C16:0) and an oleic acid (C18:1) (Fig. 8B). The models of palmitic acid and oleic acid were very applicable to the electron densities observed (Fig. 8C). In KLrP·Glc, palmitic acid is likely to be located at two different positions, form I and form II, whereas oleic acid is located at one position, judging from electron densities. These fatty acids may be derived from the E. coli cells used as the host to prepare the recombinant KLrP. Collectively, the substrate-binding cleft of KLrP·Glc was occupied with one molecule each of glucose, palmitic acid, and oleic acid, assuming the binding of GlcCer to the active site of KLrP. Actually, when GlcCer was superimposed on the catalytic domain of the crystal structure of KLrP·Glc, ceramide and sugar moieties of GlcCer were found to fit with the electron densities of fatty acids and glucose occupied in the cleft, respectively (Fig. 8D). Interestingly, not only GlcCer with saturated fatty acids (d18:1, C18:0) but also that with unsaturated fatty acids (d18:1, C24:1) were found to fit convincingly in the cleft (data not shown). The latter GlcCer was found in the spleen of patients with Gaucher disease (29). These results indicate that GlcCer fits in the substrate-binding cleft convincingly and possibly adopts a suitable conformation with two catalytic glutamate residues.

View larger version (34K):
[in this window]
[in a new window]
|
FIGURE 9. Close-up view of the substrate-binding cleft of KLrP·Glc and residues interacting with Glc and fatty acids. A, molecular surface gray model of KLrP·Glc with fatty acids. Green, Glc; blue, palmitic acid; yellow, oleic acid. B, schematic expression of amino acid residues interacting with Glc and fatty acids.
|
|

View larger version (55K):
[in this window]
[in a new window]
|
FIGURE 10. Comparison of the active sites of KLrP·Glc and KLrP·Gal. A, KLrP·Glc. Palmitic acid is likely to be located at two different positions, form I (blue) and form II (light blue) at one position. The distance between the C1 of Glc and the carboxyl residue of palmitic acid is 3.9 Å for form I and 5.6 Å for form II of the fatty acid. B, KLrP·Gal. Light blue, palmitic acid. The distance between the C1 of Gal and carboxyl residue of the palmitic acid is 9.8 Å. Glu165 and Glu424 are an acid/base catalyst and nucleophile of KLrP, respectively.
|
|
Close-up View of Substrate-binding Cleft of KLrP·Glc and Residues Interacting with Glc and Fatty Acids—Fig. 9A shows the model structure of the substrate binding cleft of KLrP·Glc with fatty acids by molecular surface gray. In the model, the Glc residue seems to be located in the inmost small pocket, the space of which is only large enough for one sugar residue, consistent with the enzyme hydrolyzing GlcCer but not LacCer. The distance between Glc and surrounding amino acid residues was found to be less than 3.5 Å, suggesting that residues are bound to Glc via hydrogen bonds. On the other hand, fatty acids appear to be located in the relatively large pocket near the surface (Fig. 9A), in which they are likely to interact with hydrophobic residues (Fig. 9B).
Comparison of KLrP·Glc with KLrP·Gal—The overall structure of the KLrP in a complex with Gal (KLrP·Gal) was almost the same as that of KLrP·Glc (data not shown). Interestingly, fatty acids were found to be trapped in the active site region of both crystal structures. Although palmitic acid is likely to be located at two different positions in KLrP·Glc (Fig. 10A), the fatty acid seems to be located at one distinct position in KLrP·Gal (Fig. 10B). The positioning of the carboxyl residues of fatty acids at the reducing ends (C1) of glycosides was some-what different (Fig. 10, A and B) (i.e. the carboxyl residues were much nearer to the C1 of Glc in KLrP·Glc (3.9 Å for form I and 5.6 Å for form II) than C1 of Gal in the KLrP·Gal (9.8 Å)), suggesting that GlcCer could be better located in the substrate-binding cleft than GalCer. It is worth noting that the C1 of Glc or Gal is linked to Cer or 4MU by a
-glycosidic linkage, which is susceptible to hydrolysis by KLrP. This result may explain in part why glucosyl derivatives are hydrolyzed by the enzyme much faster than galactosyl derivatives (Table 1).
 |
DISCUSSION
|
|---|
KL is a protein that seems to be involved in the suppression of aging (i.e. mutation of the KL gene in mice leads to a syndrome resembling aging) (14). Interestingly, the KL gene encodes a putative type I membrane protein that shares homology with the
-glucosidase assigned to the family GH1. A secreted form of KL protein was also found, which is produced by alternative RNA splicing (30) and/or post-translational cleavage (31), suggesting that KL may also act as a humoral factor. Novel proteins structurally related to the KL protein have been found and designated
KL, KL lactase phlorizin hydrolase, and KLrP (supplemental Fig. 1B). All possess one or two glucosidase-like (GH1) domains (supplemental Fig. 1A). However, in vivo substrates for KL family proteins have not yet been identified. KLrP possesses one
-glucosidase-like domain and shows 42 and 46% similarity with KL and LPH at the amino acid level, respectively; however, it does not possess a signal sequence or a transmembrane domain, suggesting that KLrP is a cytosolic protein (supplemental Fig. 1A). On the other hand, a cytosolic
-glucosidase (EC 3.2.1.2
[EC]
1) capable of hydrolyzing nonphysiological glycosides, such as 4MU-glycosides and paranitrophenyl-glycosides, and flavonoid glucosides has been cloned from guinea pig (32) and human (33); however, the endogenous substrates of this enzyme also remain to be identified. Very interestingly, the primary structure of the cytosolic
-glucosidase is identical to that of KLrP, being tentatively designated GBA3.
Independently, in this study, we detected CBE-insensitive neutral GCase activity in human fibroblasts, rat and mouse brains, zebrafish embryos, and puffer fish liver, but not slime mold, by a sensitive and reliable assay method using C6-NBD-GlcCer and HPLC (13). To identify the novel GCase, proteins that share
-glycosidase but not
-glycosidase domains were initially selected from human data bases. Among the candidates, the human proteins that have their homologues in the slime mold Dictyostelium discoidum were eliminated, because this organism showed no GCase activity under the conditions used (Fig. 1A). Next, the proteins, the natural substrates of which have yet to be revealed, were selected. Finally, KL family proteins emerged as a candidate for the novel neutral GCase. Then the GCase activity of KL family proteins was carefully examined using C6-NBD-GlcCer as a substrate after expression in CHOP cells. Overall, KLrP was found to be the only protein capable of hydrolyzing C6-NBD-GlcCer among the KL family in this study.
KLrP hydrolyzed C6-NBD-GlcCer with a Kcat/Km equivalent to that of 4MU-Glc; however, it hydrolyzed authentic GlcCer (d18:1, C18:0) with a much lower Kcat/Km. The difference between C6-NBD-GlcCer and natural GlcCer in susceptibility to hydrolysis by the enzyme may stem from the solubility of the substrates (i.e. C6-NBD-GlcCer seems to be much more soluble than natural GlcCer under the conditions used). Alternatively, attachment of NBD to the
-terminal of the fatty acyl chain of Cer may increase the susceptibility of the substrate to enzymes like a neutral ceramidase (34).
Recently, the x-ray crystal structure of human acid
-glucocerebrosidase (GBA1; EC 3.2.1.4
[EC]
5) has been solved (35, 36). The enzyme, which belongs to GH family 30 and the GH-A clan, consists of three domains, with domains II and III connected by a flexible hinge and domain I tightly interacting with domain III. Domain III is a (
/
)8 TIM barrel in which Glu235 and Glu340 located near the carboxyl termini of
-strand 4 and 7 function as an acid/base catalyst and nucleophile, respectively. Similarly, KLrP was shown to be a (
/
)8 TIM barrel, in which Glu167 and Glu373 at the carboxyl termini of strands 4 and 7 could function as an acid/base catalyst and nucleophile, respectively. However, in contrast to GBA1, KLrP does not have a distinct domain structure. Furthermore, the present study provides insights into why the enzyme hydrolyzes
-glucosyl derivatives much faster than
-galactosyl derivatives. The crystal structure of KLrP in a complex with Glc or Gal was found to swallow up fatty acids in the active site of the enzyme, and the carboxyl residues of fatty acids were much closer to the C1 of Glc in KLrP·Glc than the C1 of Gal in KLrP·Gal, indicating that GlcCer seems to fit more appropriately to the substrate-binding cleft than GalCer. Thus, the model of the active site of the KLrP with GlcCer (Figs. 8D and 9A) is more convincing than that with GalCer (data not shown).
From both the present study and reports published previously, at least four proteins have been identified as GlcCer-degrading glycosidases in mammals (Table 3). The first is a CBE-sensitive acid glucocerebrosidase (GBA1), which is a housekeeping enzyme catalyzing the catabolism of GlcCer in lysosomes (5, 6). The second is lactase-phlorizin hydrolase, which was exclusively present in the small intestine and possibly involved in the digestion of dietary GlcCer (7). The third is a CBE-insensitive membrane-bound GCase (GBA2), which was previously described as the bile acid
-glucosidase (10). The fourth is a KLrP, CBE-insensitive cytosolic GCase (this work), which was previously described as a broad specificity
-glycosidase (GBA3) (32, 33). LPH and KLrP belong to GH1, whereas GBA1 is GH30; however, all three proteins are members of GH clan A. On the other hand, GBA2 has not been assigned to any GH family.
It is not clear whether any specific disease is associated with a deficiency of KLrP. Although polymorphisms were found in the gene of KLrP (GBA3) of patients with Gaucher disease, it seems unlikely that they are related to the variable phenotype of patients with this disease (37). Interestingly, Korkotian et al. (38) reported that GlcCer could escape from lysosomes in type 2 and 3 Gaucher disease patients and might affect the Ca2+ homeostasis of neuronal cells by modulating the ryanodine receptor in the ER (38). Thus, the possibility that KLrP could be partly involved in Gaucher disease by degrading nonlysosomal GlcCer cannot be ruled out.
The physiological role of KLrP is still to be uncovered, but the enzyme could be involved in the metabolism of GlcCer at the cytosolic face of the Golgi apparatus and possibly at the ER where GlcCer is synthesized by GlcCer synthase-1 (1, 2, 39). Consequently, KLrP could regulate the content of not only GlcCer but also whole GSLs containing a basic frame of GlcCer in cells and simultaneously participate in the generation of Cer from GlcCer on the surface of the Golgi apparatus and/or ER. KLrP is also likely to be involved in the digestion of dietary GlcCer after absorption from the intestine, because KLrP is expressed in the human small intestine. However, KLrP could be involved in GSL metabolism in various tissues, because KLrP mRNA was expressed most intensely in the liver, followed by the intestine, colon, spleen, and kidney (17). In conclusion, KLrP was identified as a cytosolic neutral GCase, which could be involved in a novel nonlysosomal catabolism of GlcCer.
 |
FOOTNOTES
|
|---|
The atomic coordinates and structure factors (code 2E9L and 2E9M) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).
* This research was supported in part by CREST, Japan Science and Technology Agency (to M. I.), and Basic Research B 19380061 from the Ministry of Education, Culture, Sports, Science and Technology of the Japanese Government (to M. I.). This work was also supported in part by a grant from the National Project on Protein Structural and Functional Analyses from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (to Y. K.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. 1 and 2. 
1 To whom correspondence should be addressed: Dept. of Bioscience and Biotechnology, Graduate School of Bioresource and Bioenvironmental Sciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan. Tel.: 81-92-642-2898; Fax: 81-92-642-2907; E-mail: makotoi{at}agr.kyushu-u.ac.jp.
2 The abbreviations used are: GlcCer, glucosylceramide; Cer, ceramide; CBE, conduritol B epoxide; GalCer, galactosylceramide; GBA,
-glucosidase; GC, gas-liquid chromatography; GCase, glycosylceramidase; GH, glycohydrolase; GSL, glycosphingolipid; KL, Klotho; KLrP, Klotho-related protein; LacCer, lactosylceramide; LPH, lactase phlorizin hydrolase; NBD, 4-nitrobenzo-2-oxa-1,3-diazole; 4MU, 4-methylumbelliferyl; GlcSph, glucosylsphingosine; GalSph, galactosylsphingosine; MES, 4-morpholineethanesulfonic acid; PBS, phosphate-buffered saline; HPLC, high pressure liquid chromatography. 
 |
ACKNOWLEDGMENTS
|
|---|
We are grateful to Dr. Y. Hirabayashi and Dr. K. Ohno for donating glycolipids and human fibroblasts, respectively. We also thank K. Hasegawa and H. Sakai of the Japan Synchrotron Radiation Research Institute for kind assistance with the x-ray diffraction data collection on beam line BL38B1 at SPring-8.
 |
REFERENCES
|
|---|
- Futerman, A. H., and Pagano, R. E. (1991) Biochem. J. 280, 295-302[Medline]
[Order article via Infotrieve]
- Ichikawa, S., and Hirabayashi, Y. (1998) Trends Cell Biol. 8, 198-202[CrossRef][Medline]
[Order article via Infotrieve]
- O'Brien, J. S., and Kishimoto, Y. (1991) FASEB J. 5, 301-308[Abstract]
- Kolter, T., and Sandhoff, K. (2005) Annu. Rev. Cell Dev. Biol. 21, 81-1035.[CrossRef][Medline]
[Order article via Infotrieve]
- Barranger, J. A., and Ginns, E. I. (1989) in The Metabolic Basis of Inherited Disease, Vol. II (Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D. eds) pp. 1677-1698, McGraw-Hill Inc., New York
- Beutler, E., and Grabowski, G. A. (2001) in The Metabolic and Molecular Bases of Inherited Disease III (Scriver, C. R., Beaudet, A. L., Valle, D., and Sly, W. S., eds) pp. 3635-3668, McGraw-Hill Inc., New York
- Kobayashi, T., and Suzuki, K. (1981) J. Biol. Chem. 256, 7768-7773[Abstract/Free Full Text]
- Yildiz, Y., Matern, H., Thompson, B., Allegood, J. C., Warren, R. L., Ramirez, D. M. O., Hammer, R. E., Hamra, F. K., Matern, S., and Russell, D. W. (2006) J. Clin. Invest. 116, 2985-2994[CrossRef][Medline]
[Order article via Infotrieve]
- Boot, R. G., Vierhoek, M., Donker-Koopman, W., Strijland, A., van Marle, J., Overkleeft, H. S., Wennekes, T., and Aerts, J. M. F. G. (2006) J. Biol. Chem. 282, 1305-1312[CrossRef][Medline]
[Order article via Infotrieve]
- Marten, H., Boermans, H., Lottspeich, F., and Matern, S. (2001) J. Biol. Chem. 276, 37929-37933[Abstract/Free Full Text]
- van Weely, S., Brandsma, M., Strijland, A., Tager, J. M., and Aerts, J. M. F. G. (1993) Biochem. Biophys. Acta. 1181, 55-62[Medline]
[Order article via Infotrieve]
- Overkleeft, H. S., Renkema, G. H., Neele, J., Vianello, P., Hung, I. O., Strijland, A., van der Burg, A. M., Koomen, G. J., Pandit, U. K., and Aerts, J. M. F. G. (1998) J. Biol. Chem. 273, 26522-26527[Abstract/Free Full Text]
- Hayashi, Y., Horibata, Y., Sakaguchi, K., Okino, N., and Ito, M. (2005) Anal. Biochem. 345, 181-186[CrossRef][Medline]
[Order article via Infotrieve]
- Kuro-o, M., Matsumura, Y., Aizawa, H., Kawaguchi, H., Suga, T., Utsugi, T., Ohyama, Y., Kurabayashi, M., Kaname, T., Kume, E., Iwasaki, H., Iida, A., Shiraki-Iida, T., Nishikawa, S., Nagai, R., and Nabeshima, Y. (1997) Nature 390, 45-51[CrossRef][Medline]
[Order article via Infotrieve]
- Ito, S., Kinoshita, S., Shiraishi, N., Nakagawa, S., Sekina, S., Fujimori, T., and Nabeshima, Y. (2000) Mech. Dev. 98, 115-119[CrossRef][Medline]
[Order article via Infotrieve]
- Ito, S., Fujimori, T., Hayashizaki, Y., and Nabeshima, Y. (2002) Biochim. Biophys. Acta 1576, 341-345[Medline]
[Order article via Infotrieve]
- Yahata, K., Mori, K., Arai, H., Koide, S., Ogawa, Y., Mukoyama, M., Sugawara, A., Ozaki, S., Tanaka, I., Nabeshima, Y., and Nakao, K. (2000) J. Mol. Med. 78, 389-394[CrossRef][Medline]
[Order article via Infotrieve]
- Mitsutake, S., Kita, K., Nakagawa, T., and Ito, M. (1998) J. Biochem. (Tokyo) 123, 859-863[Abstract/Free Full Text]
- Kolachala, V. L., Obertone, T. S., Wang, L., Merlin, D., and Sitaraman, S. V. (2006) Biochim. Biophys. Acta 1760, 1102-1108[Medline]
[Order article via Infotrieve]
- Sitaraman, S. V., Wang, L., Wong, M., Bruewer, M., Hobert, M., Yun, C. H., Merlin, D., and Madara, J. L. (2002) J. Biol. Chem. 277, 33188-33195[Abstract/Free Full Text]
- Otwinowski, Z., and Minor, W. (1997) Methods Enzymol. 276, 307-326
- Vagin, A., and Teplyakov, A. (1997) J. Appl. Crystallogr. 30, 1022-1025[CrossRef]
- Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Acta Crystallogr. Sect. D 53, 240-255[CrossRef][Medline]
[Order article via Infotrieve]
- Perrakis, A., Morris, R., and Lamzin, V. S. (1999) Nat. Struct. Biol. 6, 458-463[CrossRef][Medline]
[Order article via Infotrieve]
- Emsley, P., and Cowtan, K. (2004) Acta Crystallogr. Sect. D 60, 2126-2132[CrossRef][Medline]
[Order article via Infotrieve]
- Laskowski, R. A., MacArthur, M. W., Moss, D. S., and Thornton, J. M. (1993) J. Appl. Crystallogr. 26, 283-291[CrossRef]
- Sumida, T., Sueyoshi, N., and Ito, M. (2002) J. Biochem. (Tokyo) 132, 237-243[Abstract/Free Full Text]
- Daniels, L. B., Coyle, P. J., Chiao, Y. B., and Glew, R. H. (1981) J. Biol. Chem. 256, 13004-13013[Abstract/Free Full Text]
- Koerner, T. A. W., Cary, L. W., Jr., Li, S. C., and Li, Y. T. (1979) J. Biol. Chem. 254, 2326-2328[Abstract/Free Full Text]
- Matsumura, Y., Aizawa, H., Shiraki-Iida, T., Nagai, R., Kuro-o, M., and Nabeshima, Y. (1998) Biochem. Biophys. Res. Commun. 242, 626-630[CrossRef][Medline]
[Order article via Infotrieve]
- Imura, A., Iwano, A., Tohyama, O., Tsuji, Y., Nozaki, K., Hashimoto, N., Fujimori, T., and Nabeshima, Y. (2004) FEBS Lett. 565, 143-147[CrossRef][Medline]
[Order article via Infotrieve]
- Hays, W. S., Jenison, S. A., Yamada, T., Pastuszyn, A., and Glew, R. H. (1996) Biochem. J. 319, 829-837[Medline]
[Order article via Infotrieve]
- Graaf, M. D., van Veen, I. C., van der Meulen-Muileman, I. H., Gerritsen, W. R., Pinedo, H. M., and Haisma, H. J. (2001) Biochem. J. 356, 907-910[CrossRef][Medline]
[Order article via Infotrieve]
- Tani, M., Okino, N., Mitsutake, S., and Ito, M. (1999) J. Biochem. (,Tokyo) 125, 746-749