|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 282, Issue 44, 31844-31851, November 2, 2007
Molecular Identification of Mammalian Phosphopentomutase and Glucose-1,6-bisphosphate Synthase, Two Members of the
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
-D-phosphohexomutase family and sharing about 20% identity with mammalian phosphoglucomutase 1. Data base searches indicated that vertebrate genomes contained, in addition to PGM2, a homologue (PGM2L1, for PGM2-like 1) sharing about 60% sequence identity with this protein. Both PGM2 and PGM2L1 were overexpressed in Escherichia coli, purified, and their properties were studied. Using catalytic efficiency as a criterion, PGM2 acted more than 10-fold better as a phosphopentomutase (both on deoxyribose 1-phosphate and on ribose 1-phosphate) than as a phosphoglucomutase. PGM2L1 showed only low (<5%) phosphopentomutase and phosphoglucomutase activities compared with PGM2, but was about 5–20-fold better than the latter enzyme in catalyzing the 1,3-bisphosphoglycerate-dependent synthesis of glucose 1,6-bisphosphate and other aldose-bisphosphates. Furthermore, quantitative real-time PCR analysis indicated that PGM2L1 was mainly expressed in brain where glucose-1,6-bisphosphate synthase activity was previously shown to be particularly high. We conclude that mammalian phosphopentomutase and glucose-1,6-bisphosphate synthase correspond to two closely related proteins, PGM2 and PGM2L1, encoded by two genes that separated early in vertebrate evolution. | INTRODUCTION |
|---|
|
|
|---|
The molecular identity of the mammalian phosphopentomutase is still not ascertained. Biochemical characterization of phosphoglucomutase (PGM) isozymes indicated that one of them, designated PGM2 in man (PGM1 in mouse) was more active as a phosphopentomutase than as a phosphoglucomutase, whereas mammalian PGM1 (equivalent to PGM2 in mouse) has a phosphopentomutase activity representing only about 0.2% of its phosphoglucomutase activity (3). Phosphopentomutase has been purified from rat liver to near homogeneity and shown to coelute with a polypeptide of 32.5 kDa (4), the sequence of which was not determined. Analysis of cell hybrids indicated that the PGM2 locus is on human chromosome 4p14-q12 (5). A putative protein sharing
20% identity with PGM1 is encoded by a gene present on human chromosome 4p14. It is designated PGM2 in the databases presumably because its chromosomal localization fits with the PGM2 locus but it has never been shown to act as a phosphopentomutase. Furthermore, its size (612 amino acid residues) is about twice that reported for rat liver phosphopentomutase (4). In view of these contradictory findings, we decided to reinvestigate the identity of human phosphopentomutase, which we formally identify in this report as the protein designated PGM2 in the data bases.
We also show that a closely related protein, PGM2-like 1 (PGM2L1), which shares
60% sequence identity with PGM2, actually corresponds to glucose-1,6-bisphosphate synthase. This enzyme, which had not yet been molecularly identified, catalyzes the 1,3-bisphosphoglycerate-dependent synthesis of glucose 1,6-bisphosphate and other aldose-bisphosphates that serve as cofactors for several sugar phosphomutases and possibly also as regulators of glycolytic enzymes.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Purification of Phosphopentomutase—Phosphopentomutase was purified from human erythrocytes. 80 ml of packed erythrocytes were washed three times with 150 mM NaCl and diluted in 400 ml of a buffer containing 10 mM Tris, pH 8, 1 mM dithiothreitol (DTT), 1 µg/ml leupeptin, and 1 µg/ml antipain. The hemolysate was centrifuged for 20 min at 11,000 x g. The supernatant (300 ml) was diluted twice in buffer A (20 mM Tris, pH 8, 1 mM DTT, 1 µg/ml leupeptin, and 1 µg/ml antipain) and applied to a DEAE-Sepharose column (200 cm3) equilibrated with the same buffer. The column was washed with 400 ml of buffer A, and protein was eluted with a 0–0.25 M NaCl gradient in 1000 ml of buffer A. The most active fractions were pooled (75 ml), brought to 300 ml with buffer B (25 mM MES, pH 6, 1 mM DTT, 25 mM KCl, 5 µg/ml leupeptin, and 5 µg/ml antipain), and applied to a SP-Sepharose column (25 cm3) equilibrated with buffer B. The column was washed with 100 ml of equilibration buffer. Phosphopentomutase was recovered in the flow-through and washing fractions, which were concentrated to 37.5 ml by ultrafiltration in a 200-ml Amicon cell equipped with a PM-10 membrane. This sample was brought to 180 ml with buffer C (25 mM glycine, pH 9, 1 mM DTT, 25 mM KCl, 5 µg/ml leupeptin, and 5 µg/ml antipain) and applied to a Q-Sepharose column (20 cm3) equilibrated with the same buffer. The column was washed with 80 ml of buffer C, and the retained proteins were eluted with a 0–0.75 M NaCl gradient in 300 ml of buffer C. The most active fractions (6.6 ml) were concentrated to 0.5 ml (with Vivaspin-2) and gel-filtered on a Superdex-200 10/300 GL column equilibrated with buffer D (25 mM Hepes, pH 7.4, 1 mM DTT, 5 µg/ml leupeptin, 5 µg/ml antipain, and 100 mM NaCl). Fractions of 0.5 ml were collected. Protein was assayed as described (6) using bovine serum albumin as a standard. The bands co-eluting with the phosphopentomutase activity were cut out from a 12% (w/v) polyacrylamide-SDS gel and digested with trypsin. Peptides were analyzed by nanoelectrospray-ionization tandem mass spectrometry (7) in a LCQ Deca XP Plus ion trap mass spectrometer (ThermoFinnigan, San Jose, CA) fitted with a nanoelectrospray probe. The data were analyzed with the X-calibur software (ThermoFinnigan), and the proteins were identified with TurboSEQUEST in the BioWorks software suite (ThermoFinnigan).
Overexpression and Purification of Human PGM2 and PGM2L1—The open reading frame of human PGM2 and PGM2L1 (GenBankTM accession numbers NP_060760
[GenBank]
and NP_775853
[GenBank]
) were PCR-amplified using a mixture of Taq and Pfu DNA polymerases and human white blood cells cDNA as a template. For PGM2, a 5' primer containing the initiator codon (CAAGCTCACATATGGCGGCTCCAGAAGGCAG) in an NdeI site (in bold) and a 3'-primer containing the putative stop codon (GGCTGGAGATCTTTAGTCTGCTTTTGGCTGCAGAT) flanked by a BglII site (in bold) were used. The 1840-bp PCR-product was digested with NdeI-BglII and cloned into pET-15b expression vector. The insert was checked by sequencing. This expression vector was used to transform E. coli BL21(DE3). For PGM2L1, a 5' primer containing the initiator codon (CCATATGGCTGAAAACACAGAGGGGG) in an NdeI site (in bold) and a 3' primer containing the putative stop codon (TGGATCCCTAAACAGAACGCCAGATCA) flanked by a BamHI site (in bold) were used. A 1870-bp product was obtained, which was subcloned in pBlueScript and checked by sequencing. A NdeI-BamHI fragment was removed from the pBlueScript plasmid and ligated in pET-15b expression vector. This vector was used to transform E. coli BL21(DE3) pLysS. Protein expression and preparation of bacterial extracts were performed as described previously (8). Both His-tagged proteins were purified on HisTrap columns (Ni2+ form) as previously described (9). Both proteins were eluted with
150 mM imidazole (as indicated by SDS-PAGE analysis). Both proteins were desalted on PD-10 columns equilibrated with 25 mM Hepes pH 7.4 and 50 mM KCl. Protein concentration was estimated by measuring A280 assuming extinction coefficients of 83,810 and 97,260 M–1 cm–1 for PGM2 and PGM2L1, respectively; 22 mg of pure PGM2 and 3 mg of pure PGM2L1 were obtained per liter of culture. The purified proteins were supplemented with 10% (w/v) glycerol and stored at –70 °C.
Measurement of Enzymatic Activities—The enzymatic activities were assayed spectrophotometrically at 30 °C. All assay media (reaction mixture of 600 µl) contained 25 mM Hepes pH 7.4, 25 mM KCl, 1 mM MgCl2, 1 mM DTT, and 100 µM EGTA (assay buffer). Phosphoribomutase was assayed in assay buffer containing 1 mM MnCl2, 50 µM CTP-Mg, 0.15 mM NADPH, 0.5 µM glucose 1,6-bisphosphate, different concentrations of ribose 1-phosphate, ribose-5-phosphate isomerase from spinach (1.7 units/ml), Haemophilus influenzae ribulose-5-phosphate reductase (0.3 units/ml) (10) and PGM2 (0.03 µg/ml) or PGM2L1 (2 µg/ml). One unit of enzyme is the amount that converts 1 µmol of substrate per min under these conditions. Phosphodeoxyribomutase was assayed in assay buffer containing 0.15 mM NADH, 5 µM glucose 1,6-bisphosphate, different concentrations of deoxyribose 1-phosphate, deoxyribose-5-phosphate aldolase (6 µg/ml, from Thermus thermophilus, overexpressed in E. coli and purified to homogeneity),6 rabbit muscle triose phosphate isomerase (3.5 units/ml) and glycerol-3-phosphate dehydrogenase (1 units/ml), as well as PGM2 (0.03 µg/ml) or PGM2L1 (5 µg/ml). Phosphoglucomutase was assayed in assay buffer containing 0.25 mM NADP, 5 µM glucose 1,6-bisphosphate, different concentrations of glucose 1-phosphate, yeast glucose-6-phosphate dehydrogenase (3 units/ml) and PGM2 (0.15 µg/ml) or PGM2L1 (2.4 µg/ml).
The glucose-1,6-bisphosphate synthase and aldose-bisphosphate synthase activities were determined in assay buffer containing 500 µM inorganic phosphate, 20 µM glyceraldehyde 3-phosphate, 500 µM NAD, 100 µg/ml bovine serum albumin, different concentrations of aldose monophosphate, rabbit muscle glyceraldehyde-3-phosphate dehydrogenase (1 unit/ml) and PGM2 (1.5 µg/ml) or PGM2L1 (0.8 to 2.8 µg/ml).
RNA Extraction and Quantitative Real Time PCR Assays—Total RNA was extracted from fresh tissues from 3 male fed mice with TriPure reagent according to the manufacturer's protocol. RNA integrity was verified by loading RNA onto a 1% agarose gel and evaluating the 28 S and 18 S ribosomal RNA bands, and its purity was assessed by checking A260/A280. Approximately 1 µg of RNA from each sample was converted to cDNA by RT-PCR using random hexamers and Superscript II reverse transcriptase. Gene-specific primers (Table 1) were designed to generate PCR products of about 150 bp from PGM2, PGM2L1 and two reference genes: GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and HPRT (hypoxanthine guanine phosphoribosyltransferase). Intron-spanning primers were selected to verify, by agarose gel electrophoresis, that amplification of contaminating genomic DNA did not take place. Real-time PCR was performed using an iCycler IQTM system (Bio-Rad). The rate of accumulation of amplified DNA was measured by continuous monitoring of SYBR green I fluorescence.
|
| RESULTS |
|---|
|
|
|---|
30-kDa polypeptide band that coeluted with phosphopentomutase activity (though less ideally than the 68-kDa band). This protein, which was identified (p < 2.2 x 10–10) as triose phosphate isomerase (GenBankTM accession number NP_000356
[GenBank]
), is unrelated to phosphopentomutase.
|
50% identity) and fungi (
40% identity). No orthologue was detected in plant genomes. Vertebrate genomes also encode a closely related protein, designated PGM2-like 1 (PGM2L1), which shares about 60% sequence identity with PGM2. As shown in the sequence alignment of Fig. 2, a remarkable feature of the PGM2L1 proteins was that they do not contain a proline but an arginine in the highly conserved TASHNP motif that surrounds the phosphorylatable serine in the phosphoglucomutase family (13, 14). The evolutionary tree illustrated in Fig. 3 shows that PGM2L1 and PGM2 separated early on during vertebrate evolution, as indicated by the presence of orthologues of both PGM2 and PGM2L1 in Danio rerio.
|
Analysis with PSORT (15) and Target P (16) indicated that the sequences of both human PGM2 and PGM2L1 do not contain a signal peptide, a mitochondrial propeptide, or a nuclear localization signal, suggesting that both proteins are cytosolic.
Tissue Distribution of PGM2 and PGM2L1—The tissue distribution of PGM2 and PGM2L1 mRNAs was determined in mice by quantitative real-time PCR using both glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and hypoxanthine phosphoribosyltransferase (HPRT) transcripts as references. Fig. 4A shows that for PGM2, the highest expression levels were observed in lung, spleen, and thymus. Other tissues contained at least 20% of the levels found in lung or spleen if HPRT was used as a reference. The lower levels observed in skeletal muscle and heart when GAPDH was used as a reference are presumably because of the high expression of this glycolytic enzyme in muscle. As for PGM2L1 (Fig. 4B), the highest levels of expression were observed in brain and testis, intermediate levels were found in thymus, spleen, lung and skeletal muscle, and the lowest levels (about 2–3% of the maximal ratio) were recorded in kidney, liver, and heart.
Overexpression and Characterization of Human PGM2 and PGM2L1—Both proteins were overexpressed in E. coli as fusion proteins with a polyHis tag at their N terminus and purified on His-Trap to near homogeneity. The ability of the two enzymes to convert ribose 1-phosphate, deoxyribose 1-phosphate, and glucose 1-phosphate to the corresponding aldose 5- or 6-phosphates was determined with specific spectrophotometric assays. As shown in Table 2, PGM2 displayed significant phosphomutase activity on all three substrates. In terms of catalytic efficiency the best substrates were deoxyribose 1-phosphate and ribose 1-phosphate, which were 27 and 12 times better than glucose 1-phosphate, respectively. The highest Vmax was observed with ribose 1-phosphate and the lowest Km, with deoxyribose 1-phosphate. PGM2L1 showed much lower phosphomutase activity on all three substrates, the Vmax being in all cases less than 5% of that observed with PGM2. All phosphomutase activities mentioned above were stimulated by glucose 1,6-bisphosphate. In the case of the phosphoglucomutase activity of PGM2, half-maximal stimulation was observed at 0.16 and 0.18 µM glucose 1,6-bisphosphate in the presence of 100 and 500 µM glucose 1-phosphate, respectively. In the case of PGM2L1, half-maximal stimulation was observed at much higher glucose 1,6-bisphosphate concentrations (1.15 µM in the presence of both 20 and 200 µM glucose 1-phosphate).
|
50%. This finding suggested that the phosphate ester of a C3 compound could be a substrate for PGM2L1.
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
70-kDa band in addition to the 32.5-kDa band. Our presumption is that the
70-kDa band rather than the 32.5-kDa band corresponds to rat phosphopentomutase. Accordingly the rat genome also encodes a PGM2 orthologue sharing 90% sequence identity with human PGM2.
Our findings indicate that PGM2 comprises the TASHNP motif common to members of the
-D-phosphohexomutase family, which comprises eukaryotic phosphoglucomutases, bacterial phosphoglucomutases and phosphomannomutases, eukaryotic phosphoacetylglucosaminemutase and bacterial phosphoglucosamine mutase (14). The reaction mechanism of phosphoglucomutase has been thoroughly studied (14, 22, 23). To be active, phosphoglucomutase needs to be phosphorylated on the serine present in the TASHNP motif, and this phosphorylation is achieved by transferring one of the phospho-groups of glucose 1,6-bisphosphate. To catalyze the net conversion of glucose 1-phosphate to glucose 6-phosphate, the phosphorylated enzyme reacts with glucose 1-phosphate, thus re-forming glucose 1,6-bisphosphate. The latter flips inside the catalytic site and rephosphorylates the enzyme by transferring its 1-phospho group, thus forming glucose 6-phosphate. Because of the conservation of the TASHNP motif in PGM2 and of the fact that this enzyme also requires glucose 1,6-bisphosphate as a cofactor, it is likely that the conserved serine also serves as a transient phosphate acceptor.
The role of phosphopentomutase is to utilize ribose 1-phosphate and deoxyribose 1-phosphate, which are formed by purine nucleoside phosphorylase and uridine phosphorylase. The molecular identification of phosphopentomutase might help to solve unexplained cases of congenital immunodeficiency. Both adenosine deaminase and nucleoside phosphorylase deficiencies are indeed known to be causes of immunodeficiency (24, 25). The absence of phosphopentomutase should result in the accumulation of ribose 1-phosphate and deoxyribose 1-phosphate and therefore in a functional block of purine nucleoside phosphorylase.
Identification of PGM2L1 as Glucose-1,6-bisphosphate Synthase—The presence of a human protein sharing about 60% sequence identity with human PGM2 was very intriguing. Our first hypothesis was that this enzyme was a second form of phosphopentomutase/phosphoglucomutase with slightly different kinetic properties. However, this enzyme proved to have a very low phosphomutase activity on the three tested substrates (glucose 1-phosphate, ribose 1-phosphate, and deoxyribose 1-phosphate). The finding that PGM2L1 is expressed at a high level in brain, its molecular mass of 72 kDa and its (low) phosphomutase activity are all properties that PGM2L1 shares with glucose-1,6-bisphosphate synthase (17, 18, 26), an enzyme whose molecular identity had not yet been established.
That PGM2L1 corresponds to glucose 1,6-bisphosphate synthase is indicated by the fact that recombinant PGM2L1 used 1,3-bisphosphoglycerate as a phosphate donor and a series of sugar-monophosphate as acceptors. As for brain glucose-1,6-bisphosphate synthase (17, 19), 1-phosphosugars (glucose 1-phosphate, mannose 1-phosphate, ribose 1-phosphate, and deoxyribose 1-phosphate) were good substrates, whereas 5 or 6-phosphosugars (to the exception of glucose 6-phosphate) were not. This broad substrate specificity makes that PGM2L1 is able to synthesize cofactors for various phosphomutases.
The fact that PGM2L1 also comprises a potentially phosphorylatable serine in a similar motif as found in PGM1-related enzymes agrees with previous findings indicating that glucose-1,6-bisphosphate synthase is phosphorylated on a serine residue by transfer of the 1-phosphogroup of 1,3-bisphosphoglycerate (18). As previously shown, this reaction is the first step of aldose-bisphosphate synthesis. The second step is the transfer of the phosphate group from the phosphorylated serine onto a suitable sugar-phosphate acceptor (18, 26).
As previously reported by others for the enzyme purified from human erythrocytes (21), recombinant PGM2 also displays glucose-1,6-bisphosphate synthase activity. However, as shown in the present study, the synthase activity of PGM2 is lower than that of PGM2L1 and it is more powerfully inhibited by glucose 1,6-bisphosphate. This means that PGM2L1 is more prone to form elevated concentrations of glucose 1,6-bisphosphate than PGM2. This agrees with the finding that the glucose 1,6-bisphosphate concentration is particularly elevated in brain, where values of the order of 75 nmol/g have been reported (27, 28). These concentrations are far above the levels needed to saturate phosphomutases (Ka
0.1 µM) and it is therefore thought that glucose 1,6-bisphosphate plays another role, possibly a regulatory one.
Glucose 1,6-bisphosphate is, at least in vitro, an inhibitor of low Km hexokinases (29, 30), of 6-phosphogluconate dehydrogenase (31) and of fructose-1,6-bisphosphatase (32), and a stimulator of phosphofructokinase (33), though a much poorer one than fructose 2,6-bisphosphate (34), and of liver pyruvate kinase (35). The idea that glucose 1,6-bisphosphate plays a regulatory role is supported by the finding that brain is also rich in glucose-1,6-bisphosphatase, the enzyme that degrades glucose 1,6-bisphosphate. The activity of this enzyme is nearly dependent on inosine-monophosphate, a nucleotide that accumulates in anoxia (36) and this effect may at least partly account for the fact that the glucose 1,6-bisphosphate concentration decreases in brain during ischemia. The decrease in the concentration of glucose 1,6-bisphosphate is likely to deinhibit low Km hexokinases and favor glycolysis. A complementary role is presumably played by ribose 1,5-bisphosphate, which is also formed by PGM2L1 and is a potent stimulator of phosphofructokinase (37). The concentration of ribose 1,5-bisphosphate was shown to increase in macrophages during hypoxia (38). The molecular identification of the enzyme that synthesizes glucose 1,6-bisphosphate and ribose 1,5-bisphosphate will facilitate investigations aimed at testing the regulatory role of these molecules in intact cells.
| FOOTNOTES |
|---|
1 Fellow of the Fonds pour l'Encouragement à la Recherche dans l'Industrie et dans l'Agriculture. ![]()
2 Collaborateur logistique F.R.S.-FNRS. ![]()
3 Chercheur qualifié of the Fonds National de la Recherche Scientifique. ![]()
4 To whom correspondence should be addressed: UCL 7539, Ave. Hippocrate 75, B-1200 Brussels, Belgium. Tel.: 3227647564; Fax: 327647598; E-mail: emile.vanschaftingen{at}uclouvain.be.
5 The abbreviations used are: PGM, phosphoglucomutase; DEAE, diethylaminoethyl; SP, sulfopropyl; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HPRT, hypoxanthine phosphoribosyltransferase; MES, 4-morpholineethanesulfonic acid; DTT, dithiothreitol. ![]()
6 T. Sokolova and M. Veiga-da-Cunha, unpublished results. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Veiga-da-Cunha, W. Vleugels, P. Maliekal, G. Matthijs, and E. Van Schaftingen Mammalian Phosphomannomutase PMM1 Is the Brain IMP-sensitive Glucose-1,6-bisphosphatase J. Biol. Chem., December 5, 2008; 283(49): 33988 - 33993. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Hughes and R. Friedman Genome Size Reduction in the Chicken Has Involved Massive Loss of Ancestral Protein-Coding Genes Mol. Biol. Evol., December 1, 2008; 25(12): 2681 - 2688. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |