JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M705430200 on August 28, 2007

J. Biol. Chem., Vol. 282, Issue 44, 32176-32184, November 2, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/44/32176    most recent
M705430200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Related articles in JBC
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Parlitz, R.
Right arrow Articles by Sinning, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Parlitz, R.
Right arrow Articles by Sinning, I.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Escherichia coli Signal Recognition Particle Receptor FtsY Contains an Essential and Autonomous Membrane-binding Amphipathic Helix*Formula

Richard Parlitz{ddagger}1, Asa Eitan§1, Goran Stjepanovic{ddagger}, Liat Bahari§, Gert Bange{ddagger}, Eitan Bibi§2, and Irmgard Sinning{ddagger}3

From the {ddagger}Biochemie-Zentrum der Universität Heidelberg, Im Neuenheimer Feld 328, Heidelberg 69120, Germany and the §Department of Biological Chemistry, The Weizmann Institute of Science, P. O. Box 26, Rehovot 76100, Israel

Received for publication, July 2, 2007 , and in revised form, August 27, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Escherichia coli membrane protein biogenesis is mediated by a signal recognition particle and its membrane-associated receptor (FtsY). Although crucial for its function, it is still not clear how FtsY interacts with the membrane. Analysis of the structure/function differences between severely truncated active (NG+1) and inactive (NG) mutants of FtsY enabled us to identify an essential membrane-interacting determinant. Comparison of the three-dimensional structures of the mutants, combined with site-directed mutagenesis, modeling, and liposome-binding assays, revealed that FtsY contains a conserved autonomous lipid-binding amphipathic {alpha}-helix at the N-terminal end of the N domain. Deletion experiments showed that this helix is essential for FtsY function in vivo, thus offering, for the first time, clear evidence for the functionally important, physiologically relevant interaction of FtsY with lipids.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Escherichia coli FtsY is a membrane-associated homologue of the eukaryotic SRP4 receptor {alpha}-subunit. Together with the universally conserved SRP particle, FtsY is responsible for the cotranslational targeting of many integral membrane proteins that are consequently inserted into the membrane via the SecYEG translocon (1, 2). For proper function, FtsY interacts with the SRP protein Ffh in a nucleotide-dependent manner (reviewed in Ref. 3). The structure of the complex between the two NG domains of Ffh and FtsY has recently been resolved by x-ray crystallography (4, 5).5 Targeting of ribosomes to the cytoplasmic membrane in E. coli is dependent on the expression of FtsY (6). In addition, under FtsY-depletion conditions, the expression of polytopic membrane proteins such as LacY (7), SecY (6), and MdfA6 is repressed. Other studies demonstrated that the SRP receptor forms a complex with membrane-bound ribosomes at the endoplasmic reticulum (8) and in E. coli, as well as in the absence of SRP or the translocon (9). In addition, recent studies identified interactions between the SRP receptor and the translocon in the endoplasmic reticulum (10) and in E. coli (11, 12). These observations thus underscore the central role of FtsY in ribosome targeting and biogenesis of membrane proteins (13). However, despite extensive genetic, biochemical, and structural studies, important aspects of the function of FtsY are not yet fully understood. FtsY contains three distinct domains: the C-terminal N- and G-domains (together 302 residues long), which constitute a universally conserved SRP-GTPase (14), and an N-terminal A-domain (195 residues long) that was shown to be dispensable under various growth conditions (15).

At steady state, FtsY is distributed between the cytoplasm and the membrane (16), and it has no known membrane anchor partner homologous to the mammalian beta-subunit of the SRP receptor (SR-beta), which coordinates the transfer of ribosomes translating SRP substrates to the translocon (17). Nevertheless, various studies have suggested that FtsY functions as a membrane-bound receptor (18, 19). Interestingly, A-domain-truncated FtsY versions exhibit strong affinity for membrane lipids (20, 21), possibly through the N-domain (22), an interaction that seems to be dominated by electrostatic forces (21). However, the precise lipid-interacting domain in FtsY has not been defined, and the mechanism and functional role of lipid binding to the receptor remain elusive.

Interestingly, an A-domain-truncated version of FtsY (termed NG+1) that is functional in vivo was identified by deletion analysis (15). Removal of the N-terminal amino acid Phe2 (hereafter termed Phe196 according to the sequence of wild-type FtsY) from NG+1 inactivated the receptor (termed NG). In the present study, we describe comparative structure/function analyses of the two mutants, which shed light on the mechanism underlying FtsY interaction with membrane lipids and revealed an essential and autonomous lipid-binding domain of the receptor.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Antibodies to FtsY were described previously (6).

Bacterial Strains—E. coli HB101 was used for propagation and preparation of various plasmid constructs. E. coli FJP10 (23), harboring ftsY under control of the araB promoter, was used for FtsY-depletion experiments. E. coli BL21 was used for the overexpression of SRP and FtsY mutants.

Crystallization and Structure Determination of NG+1—Crystals of NG+1 were obtained by the vapor-diffusion method as described previously (24). Structure was solved by molecular replacement with the NG structure (Protein Data Band code 1FTS [PDB] ) as a search model (14) and using CCP4 (25). The structure was manually built using the program O (26) and refined with CNS (27). Details of the refinement statistics are given in supplemental Table S2.

Construction of ftsY Mutants—Plasmids pET-14b (Novagen) and pTftsY (18) were digested with XhoI and NcoI, respectively, treated with Klenow, and cleaved again with HindIII. The large fragment released from pET-14b and the small fragment from pTftsY were ligated to produce plasmid pET-14b(6His-FtsY). The resultant plasmid was cut with NcoI and HindIII, and the small fragment was ligated with the large fragment released from pGEX-2T (Amersham Biosciences) cut with the same enzymes to create plasmid pGEX(6His-FtsY). Mutant NG was generated by PCR with pGEX(6His-FtsY) as a template, using the 5' primer: 5'-ttataccatggcgcgcctgaaacgcagcctg and a homologous 3' primer. The PCR fragment was cloned into pGEX(6His-FtsY) by NcoI and SacII digestion, to create pGEX(NG). Mutant NG+1 was created by two stages of PCR using pGEX(FtsY-NG) as a template with two internal primers: 5'-agtattccatgttcgcgcgcctgaaacg and 5'-tcaggcgcgcgaacatggaatactgtttcc, and two external primers: 5'-tggctggagtgcgatcttcctg and 5'-tgtggtttccacacccacatcgg. The final PCR product was cloned into pGEX(FtsY-NG) by Bsu36I and BspEI digestion to create PGEX(NG+1). A plain vector was prepared from pGEX(FtsY-NG) by digestion with NcoI and AvaI, Klenow treatment, and self-ligation of the large fragment. The indicated mutations were created by site-directed PCR mutagenesis using pGEX(NG) or PGEX(NG+1) as templates. PGEX(NG+1)(R198C/D479C) was prepared by digesting PGEX(NG+1)(R198C) with BspEI and Bsu36I and ligating the 0.5-kb fragment with the 4.8-kb fragment of PGEX(NG+1)(D479C) digested with the same enzymes. Plasmids used for protein expression and purification were prepared as follows: the coding region of LacIq was amplified by PCR on pGEX-2T with the 5' primer 5'-aataataacatgtaattccgacaccatcgaatggtgc and the 3' primer 5'-aattattacatgtccacacaacatacgagccggaagc. The PCR product and plasmid pT7-5 were digested with AflIII and ligated. The resultant plasmid was digested by EcoRI and BamHI and ligated with the NG or NG+1 encoding genes from pGEX(NG) or PGEX(NG+1), which were PCR-amplified with the 5' primer 5'-aatataagaattcgccgacatcataacggttctggc and the 3' primer 5'-tataataggatccatcgataagcttgggctgcagg and digested by the same enzymes. The final constructs were pT7-5(NG) and pT7-5(NG+1). To tag the mutants by a 6-histidine extension at the C termini of these mutants we amplified the 3' region of the ftsY gene with the 5' primer 5'-ttaatccggatttatcagcctgttccgc and the 3' primer 5'-aattacgcgttaatgatgatgatgatgatggtcctctcgggcaaaaagtgcc, and both the PCR products and pT7-5(NG) and pT7-5(NG+1) were digested with MluI and BspEI and ligated to create pT7-5(NG-6H) and pT7-5(NG+1-6H). pT7-5(NG+1-6H) was used for expression and purification of NG+1 for crystallization. To construct tagged mutants we used a 5' primer, 5'-aatataagaattcgccgacatcataacggttctggc, and a 3' primer, 5'-tgtggtttccacacccacatcgg, for PCR amplification using as templates pGEX(NG+1)(R198C), PGEX(NG+1)(F196A), and PGEX(NG+1)(F196I). Each of the PCR products and pT7-5(NG+1-6H) were digested with EcoRI and BspEI and ligated to produce pT7-5(NG+1-R198C-6H), pT7-5(NG+1-F196A-6H), and pT7-5(NG+1-F196I-6H). All the mutations were verified by sequencing through the PCR-generated segments, or the Klenow-treated ligation junctions.

For mutating the amphipathic helix in NG+1 (NG+1/quadro), R198L, K200L, K205L, and K207L were replaced. This construct was created by one-step PCR using PfuTurbo DNA polymerase (Stratagene) and mutagenic primers that together encode the four mutations: sense, 5'-ctgttactgaccctggaaaatctcggttccgga and antisense, 5'-gctgcgcagcagcagcgcgaacatggaatactg. The PCR product was then treated with DpnI endonuclease for the digestion of methylated, non-mutated parental DNA templates, purified from 0.8% agarose gel, and ligated. Next, the ligation mixture was transformed into E. coli HB101, and purified plasmids were verified by DNA sequencing. A similar procedure was utilized for deleting the helix from full-length FtsY (Phe196-Lys207).

Growth Experiments and FtsY Complementation Studies—Cultures were grown at 37 °C in LB medium, supplemented with ampicillin (100 µg/ml), kanamycin (10 µg/ml), chloramphenicol (10 µg/ml), and spectinomycin (33 µg/ml) when necessary. For growth experiments in liquid media, cells were grown overnight at 37 °C, and then diluted to 0.01 A600. In experiments with E. coli FJP10, cells were diluted to A600 of 0.025. FtsY complementation experiments were executed by plating transformed E. coli FJP10 (23), harboring various constructs, on LB agar plates with or without arabinose, the inducer of the chromosomal ftsY.

Cell Fractionation Gel Electrophoresis and Immunoblotting—Harvested cultures were washed in buffer A (50 mM Tris-HCl, pH 8, 100 mM NaCl, 1 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride) and resuspended in the same buffer. Cell suspensions were sonicated, and cell debris was removed by centrifugation (5 min at 13,000 rpm). Membranes were collected by ultracentrifugation (45 min at 150,000 x g). SDS-PAGE and immunoblotting were performed as described previously (6).

Construction and Purification of Thioredoxin Mutants—Plasmid petM20 containing the sequence for E. coli thioredoxin (Trx-a, kindly provided by Gunter Stier, EMBL, Germany Heidelberg) was digested with MscI and XbaI. The small fragment released containing the Trx sequence was used as a template for a PCR utilizing a forward primer, 5'-ggaaggcccatgggtagcgataaaattattcacct, and a reverse primer, 5'-cgggatccattagtggtggtggtggtggtggccctgaaaataaagattctcggccaggttagcgtcgagga. Via the PCR, a tobacco etch virus (TEV) protease site, a 6-histidine tag, and a BamHI cleavage site were introduced in the 3'-end, and an NcoI site was introduced at the 5'-end. The resulting PCR product was digested with NcoI and BamHI and ligated into vector pETM13 (kindly provided by Gunter Stier) digested with the same enzymes. NG+1-Trx was constructed by using the PCR template described above and the primers 5'-ggaaggcacatgttcgcgcgcctgaaacgcagcctgttaaaaaccaaagaaaatctcggtagcgataaaattattcacctg and 5'-cgggatccattaatggtgatggtgatggtgggccaggttagcgtcgagg, which introduce a 5'-end PciI restriction site and a 3'-end BamHI site and a 6-histidine tag. The PCR product was digested with PciI and BamHI and then ligated into the pET24d Vector (Novagen) cut by NcoI and BamHI. NG-Trx was constructed by using the PCR template described above and the primers 5'-ggaaggccatggcgcgcctgaaacgcagcctgttaaaaaccaaagaaaatctcggtagcgataaaattattcacctg and 5'-cgggatccattaatggtgatggtgatggtgggccaggttagcgtcgagg, which introduce a 5' NcoI cleavage site, a 3' BamHI cleavage site and a 6-histidine tag. The PCR product was digested with NcoI and BamHI and ligated into the pET24d vector (Novagen) cut by NcoI and BamHI. The final constructs were confirmed by DNA sequencing. Proteins were overexpressed in E. coli BL21/DE3, nucleic acids were precipitated after cell lysis with protamine sulfate, and the proteins were purified by nickel affinity chromatography and gel filtration as described for NG FtsY (24).

Expression and Purification of the A-domain (FtsY 1-188)—A Factor Xa cleavage site (Q185I, Q187G, and E188R) was introduced into the plasmid containing FtsY6His (Luirink et al. 16), using the QuikChange kit (Stratagene) and the following primer pair: forward primer, 5'-ccggtggaagaaatcgctatcgagggtcgtaaaccgaccaaagaagg, and reverse primer, 5'-ccttctttggtcggtttacgaccctcgatagcgatttcttccaccgg. Cleavage of mutated FtsY with Factor Xa (400/1 (n/n), New England Biolabs) was carried out at 274 K for 60 h in 20 mM Tris/HCl, pH 8, 1 mM CaCl2, 100 mM NaCl. Cleavage products were isolated by gel filtration on an S200 column (Amersham Biosciences) in 20 mM Tris/HCl, 200 mM NaCl, 10 mM MgCl2. Cleavage products were confirmed by electrospray ionization-mass spectrometry and in-line static-light scattering (Wyatt Technologies).

Binding to LUVs—Preparation of liposomes and flotation ultracentrifugation were carried out essentially as described previously (21). Briefly, purified FtsY, NG, NG+1, Trx, NG-Trx, or NG+1-Trx (20 µg) were incubated for 20 min at 37 °C in the absence or presence of 125 nmol (~100 µg) of LUVs prepared from synthetic POPE (2-oleoyl-1-palmitoyl-sn-glycero-3-phosphoethanolamine) and POPC (1-palmitoyl-2-oleoyl-sn-glycero-3-(phospho-rac-(1-glycerol)-ammonium salts) phospholipids (Sigma) in assay buffer (20 mM phosphate buffer, pH 7.5, 150 mM NaCl, 2 mM MgCl2, 240 mM sucrose). Samples were subjected to flotation analysis as described previously (28) with the following modifications: samples were mixed with 360 µl of assay buffer containing 30% iodixanol and overlaid with 1.16 ml of assay buffer containing 18% iodixanol and 450 µl of assay buffer. The gradient was collected in four fractions (600, 400, 400, and 600 µl) from the top. Fractions were analyzed by SDS-PAGE, Coomassie staining, gels were photographed, and the bands were quantified with ImageJ (National Institutes of Health, rsb.info.nih.gov/ij/). The percentage of values given represents protein found in the top fraction (bound to liposomes).


Figure 1
View larger version (64K):
[in this window]
[in a new window]

  		FIGURE 1.
Complementation of FtsY depletion by Asp479 and Arg198 NG+1 mutants. A, extracts (10 µg of total proteins) of E. coli HB101 expressing the various NG mutants were analyzed by immunoblotting with anti-FtsY antibodies. B, the in vivo function of the NG mutants was tested by complementation of FtsY-depleted cells.

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Site-directed Mutagenesis of the N Terminus of NG+1—As described previously (15), the functional NG+1 mutant of FtsY was created by insertion of a single phenylalanine residue at position 2 of the inactive mutant NG (Phe196). The dramatic functional difference between NG and NG+1 was now investigated by mutating this phenylalanine in an attempt to explore the importance of the chemical properties at the N terminus of NG+1. The expression of selected mutants harboring hydrophobic and large (leucine, isoleucine, and tryptophan), small (alanine), or charged (lysine) residues at position 196 was examined by immunoblotting, and their activity was assayed by complementation of FtsY depletion (Fig. 1). The results (summarized in Table 1) indicated that a large hydrophobic residue is required at position 196. However, because additional truncation studies and characterization of other mutants indicated that the length of the N terminus might also be important (data not shown), we investigated f-Met processing of selected mutants. Briefly, NG, NG+1, and several of the active and nonactive mutants were purified using a C-terminal His6 tag, and the purified proteins were analyzed by N-terminal sequencing. As shown in Table 1, NG+1 and the functional constructs retained their N-terminal methionine. In contrast, the inactive mutants lost this methionine (NG, NG+1(F196A)). Together, the results suggest that the length of the N terminus of NG might be important, as well as a large hydrophobic residue at position 196. To evaluate these conclusions and investigate possible structural requirements at the N terminus of NG, we crystallized NG+1.


View this table:
[in this window]
[in a new window]

  		TABLE 1
Characterization of the various FtsY mutants

 


Figure 2
View larger version (60K):
[in this window]
[in a new window]

  		FIGURE 2.
Comparison of the structures of FtsY truncation mutants NG and NG+1. A, the structure of the NG domain of FtsY (1FTS) (14). B, the structure of NG+1 with the extension at the N terminus marked in red (current study, 2QY9). C, structure of NG+1 showing the nucleotide-binding pocket. GTP is placed according to Montoya et al. (14). The conserved residues Arg198 (N terminus) and Asp479 (G5 closing loop) show a polar interaction. D, the space-filling model of NG+1 with the N-terminal and C-terminal helices marked in red and green, respectively. The color code is as in A and B. The figure was generated using PyMOL (45).

 
Structural Differences between NG and NG+1—In the crystal structure of NG from E. coli FtsY the N terminus is not ordered (14). For a direct assessment of the observed differences between NG and NG+1, we crystallized and solved the structure of NG+1 at 1.9-Å resolution (supplemental Table S2). A comparison with the NG structure (1FTS (14)) revealed that, unlike NG (Fig. 2A), the N terminus of NG+1 is well ordered and forms a regular {alpha}-helix (Fig. 2B). Apart from this N-terminal peptide, the overall structures of NG and NG+1 are identical (the root mean square deviation between the 295 C{alpha} atoms of residues 201-495 is 0.54 Å). Interestingly, the structure of NG+1 also reveals a polar interaction between Arg198 and Asp479 (Fig. 2C). Arg198 is located at the ordered N terminus of NG+1, and Asp479 is part of the closing loop (G5) of the GTPase. The N- and C-terminal helices are in proximity (Fig. 2D), and this interaction might be involved in regulation of the GTPase, as suggested earlier (29-31). Taken together, comparison of the three-dimensional structures and the results presented above enabled us to draw the following conclusions: (i) the Arg198-Asp479 interaction might be important for the functional assembly of the receptor, (ii) this interaction might also facilitate the formation of a regular {alpha}-helix, and (iii) the {alpha}-helical N terminus might be important for NG+1 function. These possibilities were explored further (see below). Importantly, the recently solved structure of the full-length FtsY7 revealed that the N-terminal {alpha}-helix of NG+1 is part of an authentic structural element of the wild-type receptor, where the helix is even longer. Moreover, a comparison with recent structures of FtsY from Mycoplasma mycoides (29) and Thermotoga maritima (Joint Center for Structural Genomics, PDB entry code: 1vma) indicates that this helix is conserved in FtsY homologues.

Site-directed Mutagenesis—The interaction between Arg198 and Asp479 (Fig. 2C) was not observed in the NG structure (14) and could be of structural and functional relevance. Sequence alignment shows that Asp479 is universally conserved, whereas Arg198 is partially conserved among SRP receptors (data not shown). We performed non-conservative replacements at positions Asp479 and Arg198, independently and simultaneously, to analyze the importance of these residues. The mutants were expressed (Fig. 3A), and their in vivo functions were tested by complementing FtsY depletion.

Surprisingly, replacement of the fully conserved residue Asp479 for cysteine (D479C), alanine (D479A), or even arginine (D479R) did not have any appreciable effect on NG+1 function in vivo (Fig. 3B). In contrast, replacing residue Arg198 had a dramatic inhibitory effect. Mutation R198C strongly inhibited the function of NG+1, and mutant R198D could not even be constructed, possibly due to its toxicity even under non-induced, basal expression levels. These results indicated that the observed interaction between Arg198 and Asp479 is not essential for NG+1 function, but might contribute to the stability of the NG+1 structure. The observation that the functional mutant D479R could not be crystallized, due to aggregation of the purified protein at elevated concentrations, might further support this notion, although additional studies are required to establish the structural role of the Arg198-Asp479 interaction.


Figure 3
View larger version (60K):
[in this window]
[in a new window]

  		FIGURE 3.
Complementation of FtsY depletion by various Phe196 NG+1 mutants. A, extracts (10 µg of total proteins) of E. coli HB101 expressing the various NG mutants were analyzed by immunoblotting with anti-FtsY antibodies. B, the in vivo function of NG mutants was tested by complementation of FtsY-depleted cells.

 
The N Terminus of NG+1 Forms a Class A Amphipathic Helix—A more detailed analysis of the N-terminal sequence of NG+1 reveals the presence of a class A amphipathic helix (Fig. 4). Class A amphipathic helices have a distinct charge distribution on their polar face, containing a negative charge that is typically flanked by positive charges. The positive charges interact preferentially with the negatively charged head groups of anionic phospholipids, thereby anchoring the helix to the membrane (32). The polar face of the N-terminal helix in NG+1 contains the characteristic positive charges (Arg198, Lys200, Arg210, Lys205, and Lys207) as well as a negative charge (Glu208). The hydrophobic face is mainly formed by Met195, Phe196, Leu199, and Leu203. The inactive mutants (Table 1) have significantly reduced hydrophobicity at their N termini (Fig. 4). NG lacks both Met195 and Phe196. The F196A mutant lacks Met195, and the alanine at position 196 cannot compensate for the loss of the aromatic side chain. The F196K mutant should contain Met195 according to the rules of f-Met processing (33), but replacing Phe196 by a lysine destroys the amphipathic character of the helix. All in vivo active mutants have Phe196 replaced by larger hydrophobic residues, in addition to Met195 (as shown for F196I).

Multiple sequence alignments of FtsY show that a motif of 13 amino acid residues, which corresponds to the amphipathic helix observed in the NG+1 structure, is conserved in eubacteria, archea, and chloroplasts (Fig. 5A). Yet we noticed that the negative charge (Glu208) is not fully conserved. It was proposed that, although the negative charge is not essential for interaction with lipids, when present, it enhances binding of the amphipathic helix to membranes by repulsion, pushing the helix further down in between the head groups and the carbon chains of the lipid layer (32). Interestingly, a similar functionally important motif (termed membrane-targeting sequence (MTS)) was described previously for the conserved cell division determinant MinD (34, 35). MinD is an ATPase closely related to FtsY, because both are members of the SIMIBI class of NTP-binding proteins (36). Notably, certain MTS sequences are similar to the amphipathic helix of FtsY (Fig. 5B). However, unlike in FtsY, MinD proteins harbor the amphipathic helix at their C termini.


Figure 4
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 4.
Helical wheel representation of the N-terminal helix of NG+1, NG, and NG+1 mutants. The helix is a typical class A amphipathic helix. The hydrophilic face contains a negative charge flanked by positive charges. The opposite side is hydrophobic (32). NG starts with Ala197, NG+1 with methionine in front of Phe196. The two mutants shown are defective in in vivo activity.

 
Interaction with LUVs—The results described above strongly suggest that the N-terminal helix of NG+1 is involved in the documented interaction of the receptor with lipids (21). To test this possibility, we prepared LUVs consisting of 70% phosphatidylethanolamine and 30% phosphatidylglycerol to mimic the composition of E. coli membranes. Various FtsY constructs were purified and incubated with the LUVs, which were then purified by floatation centrifugation. The LUV-associated proteins were analyzed by SDS-PAGE and quantified by densitometry (see "Experimental Procedures") (Fig. 6). FtsY binds to LUVs efficiently (~30%), unlike the A domain alone, which shows only little association with LUVs (~8%) (Fig. 6A), indicating that the receptor's interaction with membranes requires the NG domain. NG+1 bind efficiently, although to a lower extent (~19%), whereas NG binds rather poorly (~5%). This observation seems to contradict our previous study (21), in which however lipid binding was assayed only qualitatively by Western blotting and the composition of the liposomes was different (see "Experimental Procedures"). The observed membrane interaction of full-length FtsY correlates nicely with the previously observed interaction of 30% FtsY bound to IMVs in an in vitro translation experiment (16). These results suggest that, despite the observation that the A-domain alone does not interact with LUVs, it apparently affects the capacity of the receptor to bind lipids (see "Discussion"). These results confirm the hypothesis that the N-terminal helix of NG+1 is required for interaction with lipids. The observed in vivo inactivity of the NG mutants lacking Met195 and Phe196 (Table 1 and Fig. 7) supports the importance of the hydrophobic face of the helix for this interaction.


Figure 5
View larger version (45K):
[in this window]
[in a new window]

  		FIGURE 5.
The N terminus of E. coli NG+1 is conserved in FtsY homologs and MinD proteins. A, alignment of FtsY sequences from various origins. B, alignment of the N-terminal sequence of NG+1 with the MTS sequences of several MinD proteins. Identical residues are shown in blue.

 
To examine whether this segment is an autonomous lipid-binding element, we attached the conserved N-terminal peptides from NG and NG+1 to E. coli Trx, a soluble protein that does not bind to LUVs. The hybrids were then tested for their ability to bind LUVs. Fig. 6B shows that Trx and NG-Trx did not associate with liposomes, whereas NG+1-Trx bound efficiently. Taken together, these studies demonstrate that FtsY contains a transplantable, bona fide membrane-interacting sequence in the A/N-domain interface and that the hydrophobic residues at the N terminus of NG+1 are important for efficient interaction.

The Lipid-binding, Amphipathic {alpha}-Helix Is Essential for Function of FtsY—The results described above clearly show that, unlike in NG, the identified N-terminal amphipathic helix of NG+1 enables the receptor to interact with liposomes in vitro. To address the physiological relevance of these results further (see also Ref. 15) and to examine whether this helix is required for the in vivo activity of NG+1 and FtsY, we performed the following mutagenesis experiments. In FtsY the helix was deleted (Phe196-Lys207), and in NG+1 the positively charged face of the helix was neutralized by replacing the corresponding four basic residues (Arg198, Lys200, Lys205, and Lys207) by leucines. The mutated FtsY (FtsY{Delta}196-207) exhibits a wild-type-like expression level (Fig. 7A), whereas the expression of the mutated NG+1 construct (NG+1/quadro) was very low (Fig. 7B), although at a level comparable to that of the chromosomally expressed FtsY in wild-type cells (Fig. 7B, compare NG+1quadro in the right lane with that of FtsY in the left lane). Importantly, however, Fig. 7 shows that both mutants are unable to complement FtsY depletion, indicating that the helix and its amphipathic character are indeed required for the receptor function in vivo.


Figure 6
View larger version (40K):
[in this window]
[in a new window]

  		FIGURE 6.
The NG+1 amphipathic helix is an autonomous lipid-binding domain. A, interaction of FtsY, NG, NG+1, and the A-domain with LUVs. B, interaction of Trx and Trx hybrids with LUVs. The N-terminal peptide representing the amphipathic helix of NG and NG+1 were fused to Trx (the sequences are shown below the flotation). Purified proteins incubated with LUVs were subjected to flotation ultracentrifugation, and fractions were collected from the top. Samples were separated by SDS-PAGE, stained with Coomassie, and quantified by densitometry. Percentage values given represent protein found in the top fraction (bound to the liposomes). All constructs bound with a reproducibility of ±2% to the liposomes, except NG, which showed a much greater variation. This is due to the tendency of this protein to aggregate. Aggregates are found in the bottom fraction.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
We have previously shown that the FtsY-truncated mutant NG+1 is fully active in vivo (15) and that shortening its N terminus by a single residue abolishes its function. We have now demonstrated that truncation, together with in vivo f-Met processing, destroys an amphipathic helix in NG+1. This helix is an essential, autonomous membrane-interacting sequence, thus defining for the first time, a lipid-binding domain in FtsY that is required for function in vivo.


Figure 7
View larger version (32K):
[in this window]
[in a new window]

  		FIGURE 7.
The amphipathic helix is important for the receptor function in vivo. A, expression of and FtsY-complementation by NG+1 and FtsY{Delta}196-207. B, expression of and FtsY-complementation by FtsY and NG+1/quadro (see text).

 
The issue of how FtsY associates with the cytoplasmic membrane has received great attention since its first functional characterization (16). Already then, it was proposed that the receptor has a limited number of binding sites on the membrane (16), implying that lipids may not provide the major docking site of the receptor (see also Ref. 20). This proposal has been confirmed several times by demonstrating that FtsY assembles on membranes via interactions with a trypsin-sensitive component (22, 37). Finally, the most compelling evidence for FtsY-membrane protein association has recently been offered by studies of the interaction between FtsY and the SecYEG complex in E. coli (11, 12). Whether the translocon is the only proteinaceous binding site for FtsY remains unknown (38, 39). Nevertheless, in addition to convincing evidence for FtsY-membrane protein interaction, other studies demonstrated unequivocally that the receptor also interacts with lipids, although such interaction probably does not dictate docking of the receptor.8 Detailed characterization of this phenomenon was initially put forth by de Leeuw et al. (21), who demonstrated that FtsY interacts directly with E. coli phospholipids, with a preference for anionic ones, and that this interaction stimulates the GTPase activity of FtsY. Moreover, at least one determinant of lipid interaction was identified as the NG domain. In contrast to acidic lipids, other studies proposed that FtsY assembles on membranes via interactions with phosphatidylethanolamine, through the AN domain (37). Regardless of the crucial differences in identifying the specific lipids (see later), the combined studies implied a role for the N-domain in lipid binding. Taken together, the established interactions of the receptor, both with membrane proteins and lipids, raised two major questions as follows: (i) Which structural elements in FtsY are responsible for the association with proteins and lipids? Whereas the mechanism of association with the translocon and/or other membrane proteins remains to be investigated, our work discovered a functionally important lipid-interacting determinant of FtsY at the A/N-domain interface. Notably, the LUV-binding assays indicated that, although the A-domain is not essential, it contributes to this interaction. Possible interpretations are as follows:

First, the positively charged, N terminus of the full-length receptor (16) might be able to enhance lipid binding only in the context of the full-length receptor. Second, the structure of full-length FtsY7 revealed that the helix is in fact longer than seen in NG+1, providing a possible explanation for the enhanced LUV interaction of FtsY, compared with NG+1. (ii) What is the role of the individual interactions? Whereas at this stage one can only speculate on the role of FtsY interaction with membrane proteins, which is probably required for docking, our recent work8 provides direct evidence for a role of lipid binding in regulating downstream events along the SRP pathway, by stimulating the GTPase activity of the membrane-bound FtsY-SRP complex. Such communication between the N-terminal helix of NG+1 and the GTPase G-domain has been suggested on the basis of the M. mycoides FtsY-NG structure (29) (see later). Importantly, the idea that the amphipathic helix regulates downstream, membrane-associated steps in the pathway is supported by our results showing that it is not required for membrane targeting and docking of the receptor.8

As shown in Fig. 5A, the amphipathic helix of FtsY is relatively conserved in organisms or compartments lacking a membrane protein homologous to the eukaryotic beta-subunit of the receptor (bacteria, archaea, and chloroplasts). Comparison of the NG+1 structure to other documented structures of SRP receptors (PDB code 1vma (29)) suggests that not only the N-terminal sequence of NG+1 is conserved but also its structure. Using the program Amphipaseek (40), we predict that the N-terminal peptide of NG+1 forms an in-plain membrane anchor. For FtsY we propose that lipid interaction initially involves electrostatic attraction between basic residues located at the polar face of the amphipathic helix and negatively charged lipid head groups. In the second step, hydrophobic interactions lead to the insertion of the helix into the membrane. This mode of interaction results in orienting the helix parallel to the membrane surface.

An interesting similarity exists between FtsY and other nucleotide-binding, peripheral membrane proteins in their functional interaction with membranes. For example, the peripheral translocon subunit SecA also requires acidic phospholipids for its high affinity binding to the translocon (41, 42). Another example, probably the most striking one, is the previously characterized MTS in proteins of the MinD family. These proteins are structurally related to FtsY, because they are also members of the SIMIBI class of NTP-binding proteins (36). This family contains GTPases and ATPases characterized by the formation of nucleotide-dependent dimers. MinD proteins play a crucial regulatory role in selecting division sites in eubacteria, chloroplasts, and archaea. Apparently, in addition to being related in structure and function, the MTS of MinD proteins show some sequence similarity to the amphipathic helix of FtsY (Fig. 5B). Because the membrane composition in bacteria can vary significantly, the observed variation in the sequences of the membrane-binding helix in FtsY and in MinD (Fig. 5) might correlate with the membrane composition. For the MTS in MinD such correlation was indeed shown (35). The different locations of the membrane-binding domains in these proteins, the N terminus of the NG domain in FtsY and the C terminus of MinD, further support the proposal that the amphipathic helix is autonomous and able to link N- or C-terminally fused proteins to membranes, as shown for MinD (35) and FtsY (the present study). Moreover, as shown previously for FtsY (21) and recently summarized for other peripheral proteins, including MinD (43), activation of these proteins is mediated by membrane domains rich in anionic lipids, in accordance with the positively charged face of their amphipathic helices, thus lending support to the notion that FtsY interaction with acidic lipids (21) rather than neutral ones (37) is essential for the receptor function.

Previously, we reported that the GTPase of FtsY is activated by its interaction with anionic phospholipids (21), but the functional relevance of this stimulation was not understood. Now we localize an autonomous membrane-binding site to a conserved amphipathic helix at the N terminus of NG+1 and in a parallel study8 we provide evidence that the stimulation of the FtsY GTPase by lipids is required for a later step in the SRP pathway. Productive FtsY-lipid interaction requires a certain length and hydrophobicity of the helix. The motif present in NG+1 represents the minimal regulatory element, because NG is not able to function in vivo. Comparison of the structures of SRP receptors shows that the conserved amphipathic helix in NG+1 packs between the C terminus and motif IV of the G domain in the conserved hydrophobic N/G interface (Fig. 2D) (see also Ref. 44). Such a configuration would indeed facilitate a lipid-mediated information transfer from the N-terminal helix to the catalytic domain, as recently proposed (29).


   FOOTNOTES
 
The atomic coordinates and structure factors (code 2QY9) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).

* This work was supported by the German-Israeli Foundation for Scientific Research and Development (to I. S. and E. B.), by the Israel Science Foundation and the Dr. Josef Cohn MINERVA Center for Biomembrane Research (to E. B.), and by the Deutsche Forschungsgemeinschaft (Grant SFB 638 and Graduate Program Grant 1188 to I. S.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Table S2. Back

1 These authors contributed equally to this work. Back

2 To whom correspondence may be addressed: Tel.: 972-8-934-3464; Fax: 972-8-934-4118; E-mail: e.bibi{at}weizmann.ac.il. 3 To whom correspondence may be addressed: Tel.: 49-6221-54-4781; Fax: 49-6221-54-4790; E-mail: Irmi.Sinning{at}bzh.uni-heidelberg.de.

4 The abbreviations used are: SRP, signal recognition particle; Trx, thioredoxin; LUV, large unilamellar vesicle; MTS, membrane-targeting sequence. Back

5 G. Bange and I. Sinning, unpublished data. Back

6 E. S. Bochkareva, I. Yosef, J. Adler, A. Seluanov, and E. Bibi, manuscript in preparation. Back

7 R. Parlitz and I. Sinning, unpublished data. Back

8 Bahari, L., Parlitz, R., Eitan, A., Stjepanovic, G., Bochkareva, E. S., Sinning, I., and Bibi, E. (2007) J. Biol. Chem. 282: 32168-32175. Back


   ACKNOWLEDGMENTS
 
We thank Klemens Wild for support with the x-ray structure analysis and Bernd Segnitz and Bianca Schrul for excellent experimental assistance. We thank the ESRF in Grenoble for excellent support in data collection.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Luirink, J., von Heijne, G., Houben, E., and de Gier, J. W. (2005) Annu. Rev. Microbiol. 59, 329-355[CrossRef][Medline] [Order article via Infotrieve]
  2. Pool, M. R. (2005) Mol. Membr. Biol. 22, 3-15[Medline] [Order article via Infotrieve]
  3. Luirink, J., and Sinning, I. (2004) Biochim. Biophys. Acta 1694, 17-35[Medline] [Order article via Infotrieve]
  4. Egea, P. F., Shan, S. O., Napetschnig, J., Savage, D. F., Walter, P., and Stroud, R. M. (2004) Nature 427, 215-221[CrossRef][Medline] [Order article via Infotrieve]
  5. Focia, P. J., Shepotinovskaya, I. V., Seidler, J. A., and Freymann, D. M. (2004) Science 303, 373-377[Abstract/Free Full Text]
  6. Herskovits, A. A., and Bibi, E. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 4621-4626[Abstract/Free Full Text]
  7. Seluanov, A., and Bibi, E. (1997) J. Biol. Chem. 272, 2053-2055[Abstract/Free Full Text]
  8. Mandon, E. C., Jiang, Y., and Gilmore, R. (2003) J. Cell Biol. 162, 575-585[Abstract/Free Full Text]
  9. Herskovits, A. A., Shimoni, E., Minsky, A., and Bibi, E. (2002) J. Cell Biol. 159, 403-410[Abstract/Free Full Text]
  10. Snapp, E. L., Reinhart, G. A., Bogert, B. A., Lippincott-Schwartz, J., and Hegde, R. S. (2004) J. Cell Biol. 164, 997-1007[Abstract/Free Full Text]
  11. Angelini, S., Deitermann, S., and Koch, H. G. (2005) EMBO Rep. 6, 476-481[CrossRef][Medline] [Order article via Infotrieve]
  12. Angelini, S., Boy, D., Schiltz, E., and Koch, H. G. (2006) J. Cell Biol. 174, 715-724[Abstract/Free Full Text]
  13. Herskovits, A. A., Bochkareva, E. S., and Bibi, E. (2000) Mol. Microbiol. 38, 927-939[CrossRef][Medline] [Order article via Infotrieve]
  14. Montoya, G., Svensson, C., Luirink, J., and Sinning, I. (1997) Nature 385, 365-368[CrossRef][Medline] [Order article via Infotrieve]
  15. Eitan, A., and Bibi, E. (2004) J. Bacteriol. 186, 2492-2494[Abstract/Free Full Text]
  16. Luirink, J., ten Hagen-Jongman, C. M., van der Weijden, C. C., Oudega, B., High, S., Dobberstein, B., and Kusters, R. (1994) EMBO J. 13, 2289-2296[Medline] [Order article via Infotrieve]
  17. Fulga, T. A., Sinning, I., Dobberstein, B., and Pool, M. R. (2001) EMBO J. 20, 2338-2347[CrossRef][Medline] [Order article via Infotrieve]
  18. Zelazny, A., Seluanov, A., Cooper, A., and Bibi, E. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 6025-6029[Abstract/Free Full Text]
  19. Bibi, E., Herskovits, A. A., Bochkareva, E. S., and Zelazny, A. (2001) Trends Biochem. Sci. 26, 15-16[CrossRef][Medline] [Order article via Infotrieve]
  20. de Leeuw, E., Poland, D., Mol, O., Sinning, I., ten Hagen-Jongman, C. M., Oudega, B., and Luirink, J. (1997) FEBS Lett. 416, 225-229[CrossRef][Medline] [Order article via Infotrieve]
  21. de Leeuw, E., te Kaat, K., Moser, C., Menestrina, G., Demel, R., de Kruijff, B., Oudega, B., Luirink, J., and Sinning, I. (2000) EMBO J. 19, 531-541[CrossRef][Medline] [Order article via Infotrieve]
  22. Millman, J. S., and Andrews, D. W. (1999) J. Biol. Chem. 274, 33227-33234[Abstract/Free Full Text]
  23. Herskovits, A. A., Seluanov, A., Rajsbaum, R., ten Hagen-Jongman, C. M., Henrichs, T., Bochkareva, E. S., Phillips, G. J., Probst, F. J., Nakae, T., Ehrmann, M., Luirink, J., and Bibi, E. (2001) EMBO Rep. 2, 1040-1046[CrossRef][Medline] [Order article via Infotrieve]
  24. Montoya, G., Svensson, C., Luirink, J., and Sinning, I. (1997) Proteins 28, 285-288[CrossRef][Medline] [Order article via Infotrieve]
  25. Collaborative Computational Project, Number 4 (1994) Acta Crystallogr. D Biol. Crystallogr. 50, 760-763[CrossRef][Medline] [Order article via Infotrieve]
  26. Jones, T. A., Zou, J. Y., Cowan, S. W., and Kjeldgaard, M. (1991) Acta Crystallogr. A 47, 110-119[CrossRef]
  27. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve, R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S., Read, R. J., Rice, L. M., Simonson, T., and Warren, G. L. (1998) Acta Crystallogr. Sect. D Biol. Crystallogr. 54, 905-921[CrossRef][Medline] [Order article via Infotrieve]
  28. Valent, Q. A., Scotti, P. A., High, S., de Gier, J. W., von Heijne, G., Lentzen, G., Wintermeyer, W., Oudega, B., and Luirink, J. (1998) EMBO J. 17, 2504-2512[CrossRef][Medline] [Order article via Infotrieve]
  29. Gariani, T., Samuelsson, T., and Sauer-Eriksson, A. E. (2006) J. Struct. Biol. 153, 85-96[CrossRef][Medline] [Order article via Infotrieve]
  30. Gawronski-Salerno, J., Coon, J. S., Focia, P. J., and Freymann, D. M. (2007) Proteins 66, 984-995[CrossRef][Medline] [Order article via Infotrieve]
  31. Reyes, C. L., Rutenber, E., Walter, P., and Stroud, R. M. (2007) PLoS ONE 2, e607[CrossRef]
  32. Segrest, J. P., De Loof, H., Dohlman, J. G., Brouillette, C. G., and Anantharamaiah, G. M. (1990) Proteins 8, 103-117[CrossRef][Medline] [Order article via Infotrieve]
  33. Hirel, P. H., Schmitter, M. J., Dessen, P., Fayat, G., and Blanquet, S. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 8247-8251[Abstract/Free Full Text]
  34. Szeto, T. H., Rowland, S. L., Rothfield, L. I., and King, G. F. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 15693-15698[Abstract/Free Full Text]
  35. Szeto, T. H., Rowland, S. L., Habrukowich, C. L., and King, G. F. (2003) J. Biol. Chem. 278, 40050-40056[Abstract/Free Full Text]
  36. Leipe, D. D., Wolf, Y. I., Koonin, E. V., and Aravind, L. (2002) J. Mol. Biol. 317, 41-72[CrossRef][Medline] [Order article via Infotrieve]
  37. Millman, J. S., Qi, H. Y., Vulcu, F., Bernstein, H. D., and Andrews, D. W. (2001) J. Biol. Chem. 276, 25982-25989[Abstract/Free Full Text]
  38. Cristobal, S., Scotti, P., Luirink, J., von Heijne, G., and de Gier, J. W. (1999) J. Biol. Chem. 274, 20068-20070[Abstract/Free Full Text]
  39. Facey, S. J., Neugebauer, S. A., Krauss, S., and Kuhn, A. (2007) J. Mol. Biol. 365, 515-525
  40. Combet, C., Blanchet, C., Geourjon, C., and Deléage, G. (2000) Trends Biochem. Sci 25, 147-150[CrossRef][Medline] [Order article via Infotrieve]
  41. Hendrick, J. P., and Wickner, W. (1991) J. Biol. Chem. 266, 24596-24600[Abstract/Free Full Text]
  42. Alami, M., Dalal, K., Lelj-Garolla, B., Sligar, S. G., and Duong, F. (2007) EMBO J. 26, 1995-2004[CrossRef][Medline] [Order article via Infotrieve]
  43. Mileykovskaya, E., and Dowhan, W. (2005) Curr. Opin. Microbiol. 8, 135-142[CrossRef][Medline] [Order article via Infotrieve]
  44. Montoya, G., Kaat, K., Moll, R., Schafer, G., and Sinning, I. (2000) Structure 8, 995-1004
  45. Delano, W. L. (2002) The PyMOL Molecular Graphics System, Delano Scientific, Palo Alto, CA

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?

Related articles in JBC:

ATP-dependent Assembly of the Human Origin Recognition Complex
Khalid Siddiqui and Bruce Stillman
JBC 2007 282: 32370-32383. [Abstract] [Full Text]  



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
S. Ravaud, G. Stjepanovic, K. Wild, and I. Sinning
The Crystal Structure of the Periplasmic Domain of the Escherichia coli Membrane Protein Insertase YidC Contains a Substrate Binding Cleft
J. Biol. Chem., April 4, 2008; 283(14): 9350 - 9358.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/44/32176    most recent
M705430200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Related articles in JBC
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow