Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M703245200 on September 13, 2007

J. Biol. Chem., Vol. 282, Issue 45, 33034-33042, November 9, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/45/33034    most recent
M703245200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masaki, H.
Right arrow Articles by Teraoka, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masaki, H.
Right arrow Articles by Teraoka, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Developmental Pluripotency-associated 4 (DPPA4) Localized in Active Chromatin Inhibits Mouse Embryonic Stem Cell Differentiation into a Primitive Ectoderm Lineage*

Hisaharu Masaki{ddagger}, Tomohiro Nishida{ddagger}, Shigetaka Kitajima§, Kinji Asahina{ddagger}1, and Hirobumi Teraoka{ddagger}

From the Departments of {ddagger}Pathological Biochemistry and §Biochemical Genetics, Medical Research Institute, Tokyo Medical and Dental University, Chiyoda-ku, Tokyo 101-0062, Japan

Received for publication, April 17, 2007 , and in revised form, September 13, 2007.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Because embryonic stem (ES) cells can proliferate indefinitely in an undifferentiated state and differentiate into various cell types, ES cells are expected to be useful for cell replacement therapy and basic research on early embryogenesis. Although molecular mechanisms of ES cell self-renewal have been studied, many uncharacterized genes expressed in ES cells remain to be clarified. Developmental pluripotency associated 4 (Dppa4) is one such gene highly expressed in both ES cells and early embryos. Here, we investigated the role of Dppa4 in mouse ES cell self-renewal and differentiation. We generated Dppa4-overexpressing ES cells under the control of tetracycline. Dppa4 overexpression suppressed cell proliferation and formation of embryoid bodies and caused massive cell death in differentiating ES cells. Quantitative reverse transcription-PCR analysis showed that Dppa4 overexpression does not support ES cell self-renewal but partially inhibits ES cell differentiation. Suppression of Dppa4 expression by short hairpin RNA induced ES cell differentiation into a primitive ectoderm lineage. DPPA4 protein was localized in the ES cell nucleus associated with chromatin. Micrococcal nuclease digestion analysis and immunocytochemistry revealed that DPPA4 is associated with transcriptionally active chromatin. These findings indicate that DPPA4 is a nuclear factor associated with active chromatin and that it regulates differentiation of ES cells into a primitive ectoderm lineage.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Mouse embryonic stem (ES)2 cells are pluripotent cells established from the inner cell mass of blastocysts (1). ES cells can proliferate indefinitely in specific culture conditions in an undifferentiated state (1) and are capable of mimicking an early developmental process by forming embryoid bodies (EBs). Because human ES cells have been established (2), they are expected to become a valuable source for therapeutic interventions and model systems for investigating human embryogenesis. Thus, understanding of ES cell self-renewal and maintenance of pluripotency is essential for the application of ES cells.

Mouse ES cells are maintained in an undifferentiated state in the presence of leukemia inhibitory factor (LIF), which binds to a dimer of the LIF receptor and gp130 (3, 4). In turn, gp130 activates STAT3, which directly regulates c-Myc transcription in ES cells. Dominant activation of STAT3 or c-Myc is known to be sufficient for maintaining ES cells in an undifferentiated state (5, 6). Furthermore, gp130 activates phosphatidylinositol 3-kinase and Erk signaling (7). Whereas Erk signaling promotes ES cell differentiation, phosphatidylinositol 3-kinase promotes proliferation and ES cell self-renewal through its inhibitory effect on Erk signaling (8). Indeed, activation of Akt signaling is sufficient to maintain the pluripotency of both mouse and primate ES cells (9). Moreover, BMP and Wnt/beta-catenin signals are involved in ES cell self-renewal and pluripotency (10, 11). It thus seems likely that these signaling pathways are synergistically involved in ES cell self-renewal.

Several transcription factors including Oct-3/4, Sox-2, and Nanog have been identified as playing an essential role in the self-renewal of ES cells (12). Targeted disruption of each of these genes in mice results in early embryonic lethality (13-17). Recent studies have indicated that these factors regulate each other, i.e. Oct-3/4, Nanog, and Sox-2 each bind to the promoter regions of each other's transcription factors (18-23). Expression of Oct-3/4 and Nanog is also regulated by Sall4 (24, 25). Therefore, these four factors are considered to be core regulatory factors in ES cell self-renewal.

Although molecular mechanisms that confer ES cell self-renewal remain to be clarified, many unknown factors have been identified as being expressed in ES cells by microarray analysis (26). Developmental pluripotency-associated (Dppa) 4 is one such uncharacterized gene expressed in ES cells. Dppa4 has been originally identified as a gene expressed in mouse early embryos with other factors named Dppa1, Dppa2, and Dppa5 (27). The expression of Dppa4 is restricted to early developmental stages and germ cells including primordial germ cells, gonads, and testis (27, 28). Comprehensive ChIP-on-chip analysis has indicated that Oct-3/4, Sox-2, and Nanog each bind to the Dppa4 promoter region in human ES cells (29). The amino acid sequence of DPPA4 protein indicates that DPPA4 shows weak similarity to DPPA2 and DPPA3 (Stella/PGC7) (30, 31). These three proteins have a putative DNA-binding domain named SAP (Scaffold attachment factor A/B, Acinus, and PIAS) domain. The SAP domain is found in SAF-A/B, poly(ADP-ribose) polymerase, Ku70, PIAS, and Acinus and is thought to be involved in chromosomal organization including RNA processing, DNA repair, and apoptotic degradation of chromatin (32). However, it is little known regarding whether Dppa4 is involved in the self-renewal and differentiation of ES cells. To clarify the mechanisms of ES cell self-renewal, we focused on Dppa4 because of its expression pattern and the SAP domain.

In the present study, we found that Dppa4 overexpression in ES cells resulted in inhibition of differentiation and proliferation of differentiated ES cells. Suppression of Dppa4 expression in ES cells induced ES cell differentiation into a primitive ectoderm lineage even in the presence of LIF. DPPA4 protein was localized in nuclear chromatin and was extracted with high salt concentration from chromatin pellet. Interestingly, the solubility property of DPPA4 from ES cell chromatin is identical to that of RNA polymerase II phosphorylated on serine 2 (RNAPIIO-S2), representing localization in active chromatin. Our results indicate that Dppa4 is associated with active chromatin and maintains ES cells in an undifferentiated state by inhibiting differentiation into an ectoderm lineage.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
ES Cell Culture and Differentiation—The mouse ES cell line, MGZRTcH2 (33), was maintained in ES medium consisting of knockout Dulbecco's modified Eagle's medium (Invitrogen) containing 20% fetal bovine serum (Invitrogen), 2 mM L-glutamine (Invitrogen), 0.3 mM monothioglycerol (Sigma), 100 units/ml penicillin, 100 µg/ml streptomycin, 100 µM nonessential amino acids (Invitrogen), and 1,000 units/ml LIF (Chemicon, Temecula, CA) on gelatin-coated dishes (34). ES cell differentiation was induced in the ES medium in the absence of LIF. EBs were formed from ES cells by hanging drop culture for 2 days and then cultured on gelatin-coated dishes as previously described (34).

Production of Polyclonal Antibody to DPPA4—Rabbit polyclonal antibodies against a mouse DPPA4 peptide, DAYKRL-LARAFPEQ (amino acids 106-119), were produced by Sigma-Aldrich Japan (Tokyo, Japan), available from Cosmo Bio (Tokyo, Japan). This epitope is present in the central region of DPPA4 containing part of the SAP domain (see Fig. 1B).

Generation of Tetracycline (Tc)-regulatable Dppa4-overexpressing ES Cells—The open reading frame of Dppa4 cDNA was amplified by RT-PCR using cDNAs synthesized from ES cells as a template. The primers used for Dppa4 cDNA cloning were 5'-CTCGAGATGGAGACTGCTGGAGACAA and 5'-GCGGCCGCTTATCCTTCGAGGCTCTTAG. The amplified 905-bp fragment was subcloned into a pGEM-T vector (Promega, Madison, WI). The Dppa4 cDNA in the vector was excised with XhoI and NotI and ligated into an exchange vector, pPthC (33). pPthC-HA was constructed by insertion of annealed HA oligonucleotide consisting of 5'-TCGATATGTATCCATACGATGTTCCAGATTACGCGC and 5'-TCGAGCGCGTAATCTGGAACATCGTATGGATACAT into the XhoI site of the pPthC vector. Each of the pPthC-Dppa4 and pPthC-HADppa4 vectors was co-transfected with pCAGGS-Cre (Cre expression vector) into the MGZRTcH2 ES cells (see Fig. 2A) using Lipofectamine 2000 (Invitrogen) as previously described (33). The puromycin-resistant colonies were selected in the presence of 1 µg/ml Tc (Sigma), and then clones showing sensitivity to hygromycin B (Invitrogen) in the absence of Tc were selected as correctly targeted clones. The selected clones were maintained in ES medium containing 1 µg/ml Tc and 3 µg/ml puromycin.

Transfection of Dppa4 in NIH3T3 Cells—The Dppa4-amplified fragment was inserted into the EcoRV site of a pIREShyg2 vector (Clontech, Palo Alto, CA). The resulting pIREShyg2-Dppa4 or mock vector was transfected into NIH3T3 cells using Lipofectamine 2000. The cells were cultured in Dulbecco's modified Eagle's medium (Sigma) containing 10% fetal bovine serum, 100 units/ml penicillin, 100 µg/ml streptomycin, and 100 µg/ml hygromycin B.

Quantitative RT-PCR (qRT-PCR)—Total RNA was extracted from cultured cells with GenElute mammalian total RNA Mini-Prep kit (Sigma) and treated with DNase I (Promega). cDNAs were synthesized from 1 µg of the total RNA using a high capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Quantitative PCR was performed using a Power SYBR Green PCR Master Mix (Applied Biosystems) on the ABI PRISM 7900HT sequence detection system (Applied Biosystems). Standard curves of cycle threshold values were obtained from amplification of stepwise dilutions of cDNA. For each experimental sample, the expression levels of each gene were determined from the standard curves. The level of each gene transcript was normalized to beta-actin expression levels. The samples were run in triplicate. The real time PCR primers and amplified size of each gene are as follows: for Dppa4, 5'-AGGAAGTCAGCACCACCGTAGT, 5'-AAGCAGGAAGAGGGCAATGGCT; for Oct-3/4, 5'-GTTGGAGAAGGTGGAACCAA, 5'-CCAAGGTGATCCTCTTCTGC; for Nanog, 5'-ATGCCTGCAGTTTTTCATCC, 5'-GAGGCAGGTCTTCAGAGGAA; for Rex-1, 5'-TGTCCTCAGGCTGGGTAGTC, 5'-TGATTTTCTGCCGTATGCAA; for Fgf5, 5'-ACAAGAGAGGGAAAGCCAAGAG, 5'-GAACAGTGACGGTGAAGGAAAG; for Nestin, 5'-GCAGGGTCTACAGAGTCAG, 5'-GCAAGCGAGAGTTCTCAG; for Brachyury (T), 5'-CAGCCCACCTACTGGCTCTA, 5'-GAGCCTCGAAAGAACTGAGC; for Goosecoid, 5'-CGGCACCGCACCATCT, 5'-TGGGTACTTCGTCTCCTGGAA; for Gata4, 5'-TCTCACTATGGGCACAGCAG, 5'-GCGATGTCTGAGTGACAGGA; for Foxa2, 5'-GGCCCAGTCACGAACAAAGC, 5'-CCCAAAGTCTCCACTCAGCCTC; and for beta-actin, 5'-GCCAACCGTGAAAAGATGACC, 5'-GCGTGAGGGAGAGCATAGC.

Western Blot Analysis—The cells were washed with PBS, lysed in radioimmune precipitation assay buffer consisting of 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, and protease inhibitor mixture (Sigma), and incubated on ice for 20 min. The whole cell extract was centrifuged at 14,500 x g for 20 min, and the supernatant was subjected to electrophoresis on 13% polyacrylamide gel containing 0.1% SDS. After electrophoresis, the protein was transferred onto a nitrocellulose membrane (GE Healthcare BioSciences, Little Chalfont, UK) at 200 mA for 1.5 h. The membrane was blocked with 5% skim milk in Tris-buffered saline containing 0.05% Tween 20 (TTBS) and then probed with either rabbit anti-DPPA4 antibodies (1:3,000), mouse anti-beta-actin antibodies (1:10,000; AC-74, Sigma), rabbit anti-histone H2A variant X (H2AX) antibodies (1:5,000; BL552, Bethyl Laboratories, Montgomery, TX), rabbit anti-HA antibodies (1:2,000; Y-11, Santa Cruz Biotechnology, Santa Cruz, CA), mouse anti-tubulin-beta antibodies (1:1,000; Ab-3, NeoMarkers, Fremont, CA), mouse anti-poly(ADP-ribose) polymerase antibodies (1:2,000; C-2-10, BioVision, Mountain View, CA), mouse anti-heterochromatin protein 1{alpha} (HP1{alpha}) antibodies (1/2,000; 15.19S2, Upstate%20Biotechnology">Upstate Biotechnology, Lake Placid, NY), or mouse anti-RNAPIIO-S2 antibodies (1:5,000; H5, Covance, Berkeley, CA). The membrane was washed with TTBS and then incubated with appropriate secondary antibodies conjugated with horseradish peroxidase. After washing with TTBS, the antigen-antibody complex was visualized by chemiluminescence with Immobilon Western (Millipore Corporation, Billerica, MA).

Flow Cytometric Analysis—The cells were washed with PBS, treated with 0.1% Triton X-100 in PBS for 5 min, added to PI solution (PBS containing 50 µg/ml propidium iodide and 20 µg/ml RNase A; Sigma), and incubated for 20 min at room temperature. The cells were analyzed on a FACSCalibur HG (Becton Dickinson, Franklin Lakes, NJ). Data acquisition was performed with CellQuest (Becton Dickinson) software.

Expression of Short Hairpin RNAs—To construct short hairpin RNA (shRNA) expression vectors, oligonucleotides targeting the coding region of Dppa4 and its mutated sequence were annealed and inserted into the BglII/HindIII sites of pSUPER (OligoEngine, Seattle, WA). The shRNA was designed to target mouse Dppa4 mRNA at nucleotides 126-144 from the ATG codon. The oligonucleotides used were as follows: shRNA for Dppa4, 5'-GATCCCCGTCGGAGACAGATAATGGTTTCAAGAGAACCATTATCTGTCTCCGACTTTTTA and 5'-AGCTTAAAAAGTCGGAGACAGATAATGGTTCTCTTGAAACCATTATCTGTCTCCGACGGG; mutated shRNA for Dppa4, 5'-GATCCCCGTCGGAGACAGAATTAGGTTTCAAGAGAACCTAATTCTGTCTCCGACTTTTTA and 5'-AGCTTAAAAAGTCGGAGACAGAATTAGGTTCTCTTGAAACCTAATTCTGTCTCCGACGGG. The underlining indicates mutated nucleotides in the stem region of shRNA for Dppa4. A puromycin resistance gene expression unit in pCre-Pac (Kurabo, Osaka, Japan) was excised with SalI and was inserted into the SalI site of the constructed shRNA expression vectors and mock vector. Each vector was transfected into ES cells with Lipofectamine 2000 with subsequent selection in the ES medium containing 3 µg/ml puromycin.

Cell Fractionation—Cytoplasmic and nuclear fractions were isolated essentially as described by Smith et al. (35). ES cells were washed with PBS, scraped into hypotonic lysis buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 1 mM EGTA, 1 mM sodium orthovanadate, 10 mM NaF, and protease inhibitor mixture), and incubated on ice for 20 min. The lysate was homogenized with 50 strokes of a tightly fitting Dounce homogenizer and centrifuged for 5 min at 380 x g. The resulting pellet was washed five times with hypotonic lysis buffer containing 0.1% Nonidet P-40 and resuspended in hypotonic lysis buffer containing 0.5% sodium deoxycholate, 0.1% SDS, and 0.2% Nonidet P-40. The supernatant was centrifuged twice at 380 x g to obtain the cytoplasmic fraction. The cytoplasmic fractions were further centrifuged at 14,500 x g to remove insoluble material. The protein was measured using Bio-Rad protein assay according to the manufacturer's instructions and subjected to SDS-PAGE and Western blot analysis.

Chromatin Fractionation—To isolate soluble and insoluble fractions, ES cells were washed with PBS and lysed in Nonidet P-40 buffer consisting of 20 mM Tris-HCl, pH 7.5, 150-500 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, and protease inhibitor mixture. After incubation on ice for 20 min, the soluble fraction was separated from the pellet by centrifugation at 22,500 x g for 20 min with additional centrifugation. The pellet (insoluble fraction) was washed with the Nonidet P-40 buffer and resuspended in 2x SDS sample buffer (100 mM Tris, pH 6.8, 4% SDS, 20% glycerol, 4% 2-mercaptoethanol, and 0.2% bromphenol blue), with subsequent sonication.

Micrococcal Nuclease Digestion—Micrococcal nuclease (MNase) digestion was performed according to Rose and Garrard (36) and Remboutsika et al. (37). ES cells were washed with PBS, resuspended in N buffer (15 mM Tris-HCl, pH 7.5, 60 mM KCl, 15 mM NaCl, 10 mM MgCl2, 2 mM CaCl2, 1 mM dithiothreitol, 250 mM sucrose, and protease inhibitor mixture) containing 0.3% Nonidet P-40 and incubated on ice for 5 min. The nuclei were precipitated by centrifugation at 2,000 x g for 5 min, washed with N buffer, and finally resuspended in 200 µl of N buffer containing 0.5% Nonidet P-40. After incubation on ice for 20 min, the ES cell nuclei were digested with 0.2, 1, or 5 units of MNase (Takara Bio, Shiga, Japan) per 5 x 106 nuclei at 37 °C for 10 min. After the addition of EDTA to stop digestion, the digested nuclei were immediately placed on ice for 10 min before centrifugation at 12,000 x g for 10 min at 4 °C. The supernatant was designated as the S1 fraction. The pellet was resuspended in 200 µl of 2 mM EDTA containing protease inhibitor mixture, incubated on ice for 10 min, and centrifuged again. The resultant supernatant and pellet were designated as the S2 and P fractions, respectively. These fractions were subjected to SDS-PAGE and Western blot analysis. After treatment with Proteinase K (Sigma) at 37 °C overnight, DNA in the samples was extracted with phenol, recovered by ethanol precipitation, and subjected to electrophoresis in a 1.5% agarose gel.

Immunocytochemistry—ES cells were cultured on gelatin-coated glass slides. The cells were fixed with 10% neutral buffered formalin for 10 min, permeabilized with PBS containing 0.5% Triton X-100 for 20 min, and blocked with PBS containing 2% goat serum for 1 h. Then the cells were incubated with either rabbit anti-HA antibodies (1:200), rabbit anti-DPPA4 antibodies (1:1,200), mouse anti-RNAPIIO-S2 antibodies (1:500), mouse anti-HP1{alpha} antibodies (1:200), mouse anti-histone H3 trimethylated on lysine 4 (H3K4 tri-me) antibodies (1:200; ab1012, Abcam, Cambridge, UK), or mouse anti-histone H3 trimethylated on lysine 9 (H3K9 tri-me) antibodies (1;400; ab6001, Abcam) in 2% goat serum overnight and then with appropriate fluorescein isothiocyanate or Alexa Fluor 555-conjugated secondary goat antibodies. The nuclei were stained with Cellstain 4',6'-diamino-2-phenylindole solution (Dojindo, Kumamoto, Japan). Immunofluorescence images were photographed at x630 magnification under a laser scanning confocal microscopy LSM510 (Carl Zeiss, Oberkochen, Germany).


Figure 1
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 1.
Expression of Dppa4 is down-regulated in ES cell differentiation. A, qRT-PCR analysis for Dppa4 and pluripotency marker genes (Oct-3/4, Nanog, and Rex-1) in ES cells and cultured EBs. The results are expressed as relative expression compared with the ES cells. Each value is the mean ± S.D. B, the structure of DPPA4 protein. The SAP domain is located from amino acids 81 to 115. The underlining indicates the 14-amino acid sequence from 106 to 119 for antibody production. C, Western blot analysis of DPPA4 in ES cells and NIH3T3 cells transfected with Dppa4 or mock vectors. An asterisk indicates a nonspecific band. beta-Actin was used as an internal control. D, DPPA4 expression during ES cell differentiation determined by Western blot analysis.

 


Figure 2
View larger version (44K):
[in this window]
[in a new window]

 
FIGURE 2.
Dppa4 overexpression suppresses ES cell differentiation and proliferation. A, generation of an ES cell line carrying a Tc-regulatable Dppa4 overexpression unit in the ROSA26 locus. The exchange vector carrying Dppa4 cDNA (middle) is co-transfected with the Cre expression vector into the MGZRTcH2 ES cell line (top) in which the tTA sequence, Venus expression unit, and hygromycin expression unit flanked by the loxP and loxPV elements are stably integrated in the ROSA26 locus. The region flanked by the loxP and loxPV elements in the ES cell line is replaced by the Dppa4 expression unit in the exchange vector with Cre recombinase. The resulting ES cell (bottom) expresses Dppa4 and Venus in the absence of Tc, whereas these gene expressions are suppressed in the presence of Tc. B-D, confirmation of inducible Dppa4 and Venus expression in the ES cell line. Dppa4 mRNA and protein were induced in the ES cell line 48 h after withdrawal of Tc as determined by qRT-PCR (B) and Western blot analysis (C). VENUS was detected in the ES cell line in the absence of Tc (D). E and F, qRT-PCR analysis for pluripotency (E) and differentiation (F) marker genes in Dppa4-overexpressing ES cells and EBs cultured in the presence or absence of Tc. The results are expressed as relative expression compared with the Dppa4-ES cells in the presence of LIF and Tc. Each value is the mean ± S.D. G, Dppa4-overexpressing EBs cultured for 5 days in the presence (panel a) and absence (panel b) of Tc. Scale bars, 100 µm.

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of Dppa4 Is Down-regulated in ES Cell Differentiation—First, to characterize how specifically Dppa4 is expressed in ES cells and during early differentiation, we explored the expression profile of Dppa4 in ES cell differentiation by qRT-PCR. ES cells robustly expressed transcripts of Dppa4, Oct-3/4, Nanog, and Rex-1 (Fig. 1A). When EBs formed from ES cells were cultured, these gene expression levels decreased (Fig. 1A). To examine DPPA4 expression at a protein level, we produced anti-DPPA4 polyclonal antibodies against a synthetic 14-amino acid peptide that partially overlaps the SAP domain (Fig. 1B). The open reading frame of the mouse Dppa4 cDNA encodes 296 amino acids with calculated molecular weight of 32,699 (Fig. 1B). Western blot analysis with the anti-DPPA4 antibodies detected 42-kDa and 50-kDa bands in the ES cells (Fig. 1C). The 42-kDa band was detected in NIH3T3 cells transfected with mouse Dppa4 cDNA, but not in mock-transfected NIH3T3 cells, indicating that the 42- and 50-kDa bands represent DPPA4 and nonspecific bands, respectively (Fig. 1C). Western blot analysis revealed that DPPA4 is down-regulated upon ES cell differentiation, similar to its mRNA expression (Fig. 1D).

Dppa4 Overexpression Inhibits EB Differentiation and Proliferation—To study the role of expression of Dppa4 in ES cell differentiation, we generated mouse ES cell lines carrying a Tc-regulatable Dppa4 cDNA unit in the ROSA26 locus (Fig. 2A) (33). Using both the exchange vector carrying Dppa4 cDNA and a Cre expression vector, the Dppa4 cDNA was stably introduced under the control of the Tc-regulatable promoter (hCMV*-1) between the loxP and loxPV sites in the ROSA26 locus (Fig. 2A). After correct integration of the Dppa4 cDNA into this locus, the expression of the Dppa4 can be suppressed by the addition of Tc. Upon withdrawal of Tc, the introduced Dppa4 and Venus, a green fluorescent protein variant, were expressed (Fig. 2A). Two days after the withdrawal of Tc, the ES cells increased expression of Dppa4 (Fig. 2B). Increased expression of DPPA4 and VENUS were also confirmed by Western blot analysis (Fig. 2C) and fluorescence microscopy (Fig. 2D), respectively, in the ES cells cultured in the absence of Tc.


Figure 3
View larger version (54K):
[in this window]
[in a new window]

 
FIGURE 3.
Dppa4 overexpression inhibits ES cell differentiation toward a mesodermal lineage and causes cell death. Dppa4-ES cells were cultured in the presence or absence of LIF or Tc for 7 days. A, gross appearance of Dppa4-ES cells cultured for 7 days under the following conditions: (panel a) LIF+, Tc+;(panel b) LIF+,Tc-;(panel c) LIF-,Tc+;(panel d) LIF-,Tc-. B and C, qRT-PCR analysis for pluripotency (B) and differentiation marker genes (C) in the differentiation of Dppa4-ES cells. The results are expressed as relative expression compared with the Dppa4-ES cells in the presence of LIF and Tc. Each value is the mean ± S.D. D, growth curve of Dppa4-ES cells. E, flow cytometric analysis of the DNA content of Dppa4-ES cells cultured under the indicated conditions. Scale bars, 100 µm.

 
To study the effects of Dppa4 overexpression on ES cell fate, we formed EBs from the Dppa4-ES cell line by hanging drop culture for 2 days, subsequently culturing the EBs on gelatin-coated dishes in the presence and absence of Tc. In the presence of Tc (no induction of Dppa4 expression), decreased expression of Oct-3/4, Nanog, Rex-1, and Dppa4 (Fig. 2E), and increased expression of Fgf5, a primitive ectoderm marker, T, a mesoderm marker, and Gata4, a primitive endoderm marker (Fig. 2F) were detected during the EB culture as assessed by qRT-PCR. In the absence of Tc (induction of Dppa4 expression), the cultured EBs expressed Dppa4 at a high level (Fig. 2E). Dppa4 overexpression slightly blocked the down-regulation of Nanog and Rex-1 in the EBs compared with those cultured in the presence of Tc for 5 days (Fig. 2E). Expression of Fgf5 and T, but not Gata4, was significantly decreased in the Dppa4-overexpressing EBs (Fig. 2F). In addition, Dppa4 overexpression suppressed cell proliferation in EBs (Fig. 2G, panel b) compared with the normal EBs (Fig. 2G, panel a) on Day 5.

Dppa4 Overexpression Inhibits ES Cell Differentiation toward a Mesodermal Lineage and Causes Cell Death—We next examined the effect of Dppa4 overexpression on ES cell differentiation in monolayer culture. In the presence of LIF, no morphological change was observed in the Dppa4-overexpressing ES cell line (Tc-) compared with the normal ES cell line (Tc+) (Fig. 3A, panels a and b). Dppa4 overexpression slightly changed the expression of pluripotency markers (Fig. 3B) and decreased the proliferative activity of the ES cell lines in the presence of LIF (Fig. 3D). When the ES cells were cultured in the absence of LIF for 7 days, the ES cells spontaneously differentiated and changed to a flattened morphology (Fig. 3A, panel c) with a decrease in the expression of the pluripotency marker genes (Fig. 3B) and an increase in the expression of the differentiation marker genes (Fig. 3C). Dppa4 overexpression in the absence of LIF resulted in change in the morphology of the ES cells into primitive ectoderm-like cells (Fig. 3A, panel d) that were different from both spontaneously differentiated ES cells (Fig. 3A, panel c) and undifferentiated ES cells (Fig. 3A, panel a). Dppa4 overexpression in the absence of LIF slightly increased the expression of the pluripotency marker genes including Nanog and Rex-1 (Fig. 3B), while strongly suppressing the expression of the mesoderm marker T (Fig. 3C). Dppa4 overexpression (Tc-) dramatically reduced proliferation of differentiated ES cells as compared with differentiated ES cells without Dppa4 overexpression (Tc+) in the absence of LIF (Fig. 3D). Flow cytometric analysis showed that decreased proliferation of differentiated ES cells was attributable to increased sub-G1 population, reflecting cell death (Fig. 3E). These results suggest that Dppa4 overexpression is insufficient for maintenance of ES cells in an undifferentiated state but capable of inhibiting ES cell differentiation into mesodermal lineage.


Figure 4
View larger version (62K):
[in this window]
[in a new window]

 
FIGURE 4.
Reduced expression of Dppa4 results in ES cell differentiation. ES cells were transfected with a pSUPER vector carrying Dppa4 shRNA (shDppa4), mutated Dppa4 shRNA (shDppa4 mut), or without an insert sequence (Mock), and cultured for 4 days in the presence of LIF. A, Western blot analysis of DPPA4 and beta-ACTIN. shDppa4, but not shDppa4 mut or mock, reduces endogenous DPPA4 expression in the ES cells. B and C, qRT-PCR analysis for pluripotency (B) and differentiation marker genes (C) in the ES cells transfected with shDppa4. The results are expressed as relative expression compared with the ES cells transfected with mock vector. Each value is the mean ± S.D. D, morphology of ES cells transfected with mock (panel a), shDppa4 mut (panel b), or shDppa4 (panel c). The ES cells became differentiated in morphology with shDppa4. Scale bars, 100 µm.

 
Reduced Expression of Dppa4 Induces ES Cell Differentiation—To determine whether Dppa4 is required for maintaining ES cells in an undifferentiated state, we down-regulated Dppa4 expression in ES cells with shRNA. We constructed a pSUPER vector carrying the oligonucleotide sequence targeting Dppa4, and the resulting pSUPER-Dppa4 vector (shDppa4) was transfected into ES cells. The ES cells were cultured for 4 days in the presence of LIF. shDppa4 reduced Dppa4 expression at both protein (Fig. 4A) and mRNA levels (Fig. 4B), whereas the control pSUPER vector without an insert sequence (mock) or with a mutated Dppa4-targeting sequence (shDppa4 mut) had no effect on Dppa4 expression (Fig. 4, A and B) or ES cell morphology (Fig. 4D, panel a and b). After the inhibition of the Dppa4 expression, the morphology of the ES cells showed differentiation even in the presence of LIF (Fig. 4D, panel c). qRT-PCR analysis showed that the reduced expression of Dppa4 in ES cells results in increased expression of Fgf5 (Fig. 4C). In addition, expression of Nestin, a neuroectoderm marker, and T and Goosecoid, mesoderm markers, was slightly induced in Dppa4-repressed ES cells, with no induction of Gata4 and Foxa2, primitive endoderm markers (Fig. 4C). These results indicate the requirement of Dppa4 in the maintenance of ES cells in an undifferentiated state. Importantly, the expressions of Oct-3/4 and Nanog were rarely affected in the Dppa4-shRNA transfected ES cells, although Rex-1 was weakly down-regulated (Fig. 4B). These results indicate that Dppa4 inhibits ES cell differentiation into a primitive ectodermal lineage without direct transcriptional regulation on pluripotency-related genes and raise the question how Dppa4 regulates the maintenance of ES cells in an undifferentiated state.

DPPA4 Is Associated with Chromatin in ES cells—Next, we tried to determine the localization of DPPA4 in ES cell self-renewal. We fractionated cytosolic and nuclear fractions from ES cells by differential centrifugation. Western blot analysis showed that the nuclear fraction contains DPPA4 as well as histone H2AX, a histone H2A variant (Fig. 5A). This nuclear localization of DPPA4 is reasonable because a SAP domain in DPPA4 has been considered as a putative DNA-binding domain (27, 28, 32). When soluble and insoluble fractions were separated from the ES cells by the addition of 1% Nonidet P-40, DPPA4 was detected in the insoluble fraction (Fig. 5A), indicating that DPPA4 interacts with chromatin. Next, we overexpressed HA-tagged DPPA4 in Tc-regulatable ES cells as described in Fig. 2A. Western blot analysis using the anti-HA antibody gave a single 43-kDa band only in the nuclear fraction of the DPPA4-overexpressing ES cells (Fig. 5B, fourth lane). Immunocytochemistry using anti-DPPA4 antibodies revealed intense staining in the ES cell nuclei (Fig. 5C). Anti-HA antibodies confirmed the nuclear localization of DPPA4 in the ES cells overexpressing HA-tagged DPPA4 and Venus (Fig. 5D). Overexpression of DPPA4 fused with Ds-Red at the C terminus in the ES cells showed identical results (data not shown).

Next, we examined the strength of the association of DPPA4 with chromatin by salt extraction of ES cell chromatin. Western blot analysis revealed that DPPA4 was weakly solubilized by 250 mM NaCl. Most of the DPPA4 was solubilized from the ES cell nuclei in the presence of 500 mM NaCl, at which concentration half of the HP1{alpha} was solubilized, whereas H2AX remained in the insoluble fraction (Fig. 5E), indicating that DPPA4 is a protein associated with chromatin, but not a nuclear matrix component, in ES cells.

DPPA4 Is Associated with Transcriptionally Active Chromatin in ES Cells—Because the solubility characteristics of DPAA4 were different from those of HP1{alpha} and H2AX, we wanted to know whether DPPA4 is localized to transcriptionally active chromatin. ES cell nuclei were treated with MNase and centrifuged to prepare a supernatant fraction (designated S1). The pellet was resuspended and centrifuged to obtain a further supernatant fraction (S2) and the remaining insoluble chromatin fraction (P). DNA electrophoresis revealed nucleosomal ladders in the presence of high concentrations of MNase (Fig. 6A). The S1 fraction was progressively enriched in mono-nucleosomes with increase in MNase, whereas the S2 and P fractions contained poly- and oligonucleosomes (Fig. 6A).


Figure 5
View larger version (44K):
[in this window]
[in a new window]

 
FIGURE 5.
DPPA4 is associated with chromatin in ES cells. A, Western blot analysis of DPPA4 in cytoplasmic and nuclear fractions (left panel) and in chromatin soluble and insoluble fractions (right panel) of ES cells. H2AX was used as a marker for both the nuclear and chromatin fractions, and beta-ACTIN was a marker for the cytoplasmic fraction. B, Western blot analysis of HA-tagged DPPA4 in nuclear and cytoplasmic fractions of ES cells. The Tc-regulatable HA-tagged DPPA4 unit was introduced into the ES cells as described in Fig. 2A. Anti-HA antibodies detected HA-tagged DPPA4 only in the nuclear fraction of the ES cells in the absence of Tc. Tubulin-beta and poly(ADP-ribose) polymerase were used as positive controls for the cytoplasmic and nuclear fractions, respectively. C, confocal images of ES cells immunostained with anti-DPPA4 antibodies (green). The counterstaining with 4',6'-diamino-2-phenylindole (DAPI, blue) shows localization of DPPA4 in the nuclei (merge). D, confocal images of ES cells overexpressing HA-tagged DPPA4, which were immunostained with anti-HA antibodies (red) or VENUS fluorescence (green). HA staining is localized in the nuclei counterstained with 4',6'-diamino-2-phenylindole (blue), whereas VENUS is detected in the whole cells (Merge). Scale bars,10 µm. E, Western blot analysis of DPPA4, HP1{alpha}, and H2AX in soluble (S) and insoluble (I) fractions of ES cells extracted with Nonidet P-40 buffer containing the indicated concentrations of NaCl.

 
The S1 and P fractions are known to be enriched in transcriptionally active DNA, whereas the S2 fraction is depleted of transcribed sequences as shown by the presence of HP1{alpha} (36). The P fraction is characterized by the presence of both active chromatin proteins such as RNA polymerase II and nuclear matrix-associated proteins such as SWI/SNF (38). Because serine 2 of RNA polymerase II is phosphorylated in transcriptionally active chromatin (39), we evaluated DPPA4 and RNAPIIO-S2 by Western blot analysis. Interestingly, DPPA4 showed the same pattern as that of RNAPIIO-S2 exclusively in fraction P (Fig. 6B), whereas HP1{alpha} was preferentially present in the S2 fraction (Fig. 6B). In addition, we employed double immunostaining of DPPA4 with RNAPIIO-S2 or H3K4 tri-me, which is preferentially associated with active genes (40), in ES cells. As shown in Fig. 6 (C and D), immunostaining of DPPA4 was almost identical to that of RNAPIIO-S2 and H3K4 tri-me in the ES cell nuclei. On the other hand, DPPA4 immunostaining was not co-localized with heterochromatin markers, HP1{alpha} and H3K9 tri-me (41), that formed foci in the nuclei (Fig. 6, E and F). These results indicate that DPPA4 is associated with transcriptionally active chromatin in ES cells.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Dppa4 has been known to be expressed specifically in the inner cell mass in blastocysts, epiblasts, and ES cells, but its characteristics and functions in ES cells remain to be clarified (27, 28). The present study revealed two novel findings of Dppa4: inhibition of ES cell differentiation into a primitive ectoderm lineage and association with active chromatin in ES cells.

Expression of Dppa4 mRNA was decreased in ES cell differentiation similar to that of pluripotency markers including Oct-3/4, Nanog, and Rex-1, implying that Dppa4 is involved in ES cell differentiation. We confirmed decreased DPPA4 expression in ES cell differentiation at a protein level using anti-DPPA4 antibodies. Although Western blot analysis using the antibodies raised against DPPA4 gave two bands of 42 and 50 kDa in mouse ES cells, transfection of Dppa4 cDNA into NIH3T3 cells, which do not express Dppa4, showed that the former is DPPA4 and the latter is a nonspecific band. Moreover, the nonspecific band was not detected in the nuclear fraction (data not shown). Because the 296-amino acid sequence of the Dppa4 coding region indicates a molecular weight of 32,699, the 42-kDa band of DPPA4 by Western blot analysis suggests some stable modification(s) on the DPPA4 protein, which are currently under investigation.

Using the Tc-regulatable expression system, we examined whether Dppa4 overexpression maintains ES cells in an undifferentiated state without LIF. In ES cell differentiation induced by both EB formation and monolayer culture in the absence of LIF, Dppa4 overexpression did not maintain the ES cells in an undifferentiated state. When endogenous Dppa4 expression was suppressed with shRNA, expression of pluripotency markers including Oct-3/4, Nanog, and Rex-1 remained unchanged, but expression of a primitive ectoderm marker, Fgf5, a neuro-ectoderm marker, Nestin, and mesoderm markers T and Goosecoid, was increased. These results indicated that Dppa4 is involved in ES cell self-renewal by inhibiting ES cell differentiation into a primitive ectoderm lineage. Comprehensive ChIP-on-chip analysis has indicated that Oct-3/4, Sox-2, and Nanog each bind to the Dppa4 promoter region in human ES cells (29). Although transcriptional regulation of mouse Dppa4 by these factors has not been examined, these results suggest that Dppa4 lies downstream of those pluripotency-associated transcription factors in ES cells. Wang et al. (42) have recently identified Nanog-associated proteins in which DPPA4 was not included. Oct-3/4 is known to be almost solubilized at 100 mM NaCl and 0.1% Triton X-100 from ES cell nuclei (43), whereas complete solubilization of DPPA4 required 500 mM NaCl. Although further studies including immunoprecipitation of DPPA4 are necessary, these data imply that DPPA4 directly binds to neither Oct-3/4 nor Nanog.


Figure 6
View larger version (31K):
[in this window]
[in a new window]

 
FIGURE 6.
DPPA4 is associated with transcriptionally active chromatin. A and B, fractionation of ES cell nuclei using MNase digestion. ES cell nuclei were subjected to mild digestion by MNase at the indicated doses and separated into supernatant (S1) and pellet (P). The pellet was subsequently extracted with hypotonic buffer and centrifuged to obtain a further supernatant (S2) and a pellet. These fractions were subjected to DNA electrophoresis (A) and Western blot analysis of DPPA4, HP1{alpha}, and RNAPIIO-S2 (B). M indicates a 100-bp ladder marker. DPPA4 and RNAPIIO-S2 are enriched in the P fraction, whereas HP1{alpha} is in the S2 fraction. C-F, double immunostaining of DPPA4 (green) with RNAPIIO-S2 (C, red), H3K4 tri-me (D, red), HP1{alpha} (E, red), or H3K9 tri-me (F, red) in ES cells. The merged images are shown on the right. Scale bars, 10 µm.

 
In differentiating ES cells overexpressing Dppa4 without LIF on monolayer, expression of T, but neither Fgf5 nor pluripotency markers, was inhibited, and the cells developed into primitive ectoderm-like cells. This expression pattern together with the associated morphology are reminiscent of primitive ectoderm differentiated from ES cells (44). We assume that the absence of the LIF signaling in ES cells overwhelms the inhibitory effect of Dppa4 on ES cell differentiation into a primitive ectoderm lineage, but Dppa4 overexpression inhibits further differentiation of the primitive ectoderm into the mesoderm.

Dppa4-overexpressing ES cells in the presence of LIF exhibited slightly reduced proliferative activity. This effect was noticeable when Dppa4 was continuously overexpressed in differentiating ES cells. Because the Dppa4-overexpressing ES cells exhibited an increased sub-G1 population, the decreased proliferation of the Dppa4-overexpressing ES cells is attributable to cell death. Thus, these results suggest that down-regulation of Dppa4 expression is a prerequisite for proper ES cell differentiation. We also observed that forced expression of Dppa4 in NIH3T3 cells had little influence on cell proliferation (data not shown). Further studies are necessary to address whether Dppa4 selectively induces cell death in early differentiation of ES cells.

It has been shown that aggregation of ES cells causes primitive endoderm differentiation by down-regulation of Nanog even in the presence of LIF (45). Differentiated primitive endoderm subsequently affects primitive ectoderm differentiation (46). Thus, compared with the random differentiation of ES cells in monolayer, EB culture is suitable to analyze early embryogenesis in vitro. When overexpressed in cultured EBs, Dppa4 suppressed expression of Fgf5 and T and slightly increased expression of Nanog and Rex-1. These gene expression patterns in EB culture are not identical to those of differentiating ES cells in monolayer. This difference may be due to the difference between EB culture and monolayer culture. During preparation of this manuscript, Ivanova et al. (47) published a paper on screening genes expressed in mouse ES cells by comprehensive analysis using RNA interference and the effects of Dppa4 down-regulation on ES cell fate. Consistent with our data, Dppa4 knockdown ES cells slowly proceeded to differentiate (47).

Using anti-DPPA4 antibodies, we demonstrated that DPPA4 is localized in ES cell nuclei. It has been reported that linker histone H1 and HP1{alpha} loosely bind to chromatin in ES cells as compared with somatic cells (48, 49). For example, HP1{alpha} is extracted from somatic cell chromatin by 1 M NaCl but extracted from ES cell chromatin by 500 mM NaCl (37, 49). Indeed, we confirmed that half of HP1{alpha} is solubilized by 500 mM NaCl in ES cells. The nuclear matrix is defined as an insoluble fraction obtained from chromatin after treatments with a higher salt concentration (over 1 M NaCl) and nuclease. DPPA4 was almost all extracted from ES cell chromatin by 500 mM NaCl, indicating that DPPA4 is associated with chromatin, but not a component of the nuclear matrix.

MNase digestion of ES cell chromatin allowed us to examine association of DPPA4 with chromatin. HP1{alpha} and DPPA4 were present in the S2 and P fractions, respectively, indicating that DPPA4 is not associated with inactive chromatin in ES cells. RNAPIIO-S2 is a marker for active chromatin and is known to be fractionated in the P fraction with MNase digestion (38). Because RNAPIIO-S2 strongly interacts with DNA, RNAPIIO-S2 may be resistant to nuclease digestion (38). We found that the P fraction contains both RNAPIIO-S2 and DPPA4. Immunocytochemistry confirmed the co-localization of DPPA4 with RNAPIIO-S2 or H3K4 tri-me in ES cell nuclei. Based on these results, we conclude that DPPA4 is associated with transcriptionally active chromatin in ES cells.

Although the present study shows association of DPPA4 in active chromatin in ES cells, it is still unclear how DPPA4 regulates ES cell differentiation at a molecular level. DPPA4 has the SAP domain, which is also found in DPPA2 and DPPA3 (stella/PGC7), and these three genes are expressed in ES cells. Dppa4 has 47% similarity to Dppa2, and both genes are expressed in pluripotent tissues including four-cell embryos, blastocysts, primordial germ cells, gonads, and spermatogonia, but not in somatic tissues. Overexpression of Dppa2 had no effect on ES cells (data not shown), indicating that the function of Dppa4 may be different from that of Dppa2. A recent study has indicated that Dppa3 (stella/PGC7), a primordial germ cell-specific gene, protects against DNA demethylation in early embryogenesis (50). Because the SAP domain has been thought to be related to chromosomal organization, Dppa4 might be involved in epigenetic regulation or in maintenance of chromatin structure unique to ES cells and early embryos.


    FOOTNOTES
 
* This work was supported by Grants-in-Aid for Scientific Research 18390343 and 18048015 from the Ministry of Education, Culture, Sports, Science and Technology, Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed. Present address: Department of Pathology, Keck School of Medicine, University of Southern California. E-mail: asahina{at}usc.edu.

2 The abbreviations used are: ES, embryonic stem; Dppa, developmental pluripotency-associated; EB, embryoid body; H2AX, histone 2A variant X; H3K4 tri-me, histone H3 trimethylated on lysine 4; H3K9 tri-me, histone H3 trimethylated on lysine 9; HP1{alpha}, heterochromatin protein 1{alpha}; LIF, leukemia inhibitory factor; RT, reverse transcription; qRT-PCR, quantitative RT-PCR; RNAPIIO-S2, RNA polymerase II phosphorylated on serine 2; shRNA, short hairpin RNA; T, Brachyury; Tc, tetracycline; STAT, signal transducers and activators of transcription; HA, hemagglutinin; PBS, phosphate-buffered saline; MNase, micrococcal nuclease. Back


    ACKNOWLEDGMENTS
 
We thank Drs. Shinji Matsui (International Medical Center of Japan) and Tetsuro Watabe (University of Tokyo) for kindly providing the MGZRTcH2 ES cell system. We also thank Dr. Ken-ichi Yoshioka in our laboratory for critical reading of this manuscript.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Evans, M. J., and Kaufman, M. H. (1981) Nature 292, 154-156[CrossRef][Medline] [Order article via Infotrieve]
  2. Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A., Swiergiel, J. J., Marshall, V. S., and Jones, J. M. (1998) Science 282, 1145-1147[Abstract/Free Full Text]
  3. Smith, A. G., Heath, J. K., Donaldson, D. D., Wong, G. G., Moreau, J., Stahl, M., and Rogers, D. (1988) Nature 336, 688-690[CrossRef][Medline] [Order article via Infotrieve]
  4. Williams, R. L., Hilton, D. J., Pease, S., Willson, T. A., Stewart, C. L., Gearing, D. P., Wagner, E. F., Metcalf, D., Nicola, N. A., and Gough, N. M. (1988) Nature 336, 684-687[CrossRef][Medline] [Order article via Infotrieve]
  5. Matsuda, T., Nakamura, T., Nakao, K., Arai, T., Katsuki, M., Heike, T., and Yokota, T. (1999) EMBO J. 18, 4261-4269[CrossRef][Medline] [Order article via Infotrieve]
  6. Cartwright, P., McLean, C., Sheppard, A., Rivett, D., Jones, K., and Dalton, S. (2005) Development 132, 885-896[Abstract/Free Full Text]
  7. Burdon, T., Smith, A., and Savatier, P. (2002) Trends Cell Biol. 12, 432-438[CrossRef][Medline] [Order article via Infotrieve]
  8. Paling, N. R. D., Wheadon, H., Bone, H. K., and Welham, M. J. (2004) J. Biol. Chem. 279, 48063-48070[Abstract/Free Full Text]
  9. Watanabe, S., Umehara, H., Murayama, K., Okabe, M., Kimura, T., and Nakano, T. (2006) Oncogene 25, 2697-2707[CrossRef][Medline] [Order article via Infotrieve]
  10. Ying, Q. L., Nichols, J., Chambers, I., and Smith, A. (2003) Cell 115, 281-292[CrossRef][Medline] [Order article via Infotrieve]
  11. Sato, N., Meijer, L., Skaltsounis, L., Greengard, P., and Brivanlou, A. H. (2004) Nat. Med. 10, 55-63[CrossRef][Medline] [Order article via Infotrieve]
  12. Boiani, M., and Schöler, H. R. (2005) Nat. Rev. Mol. Cell Biol. 6, 872-884[CrossRef][Medline] [Order article via Infotrieve]
  13. Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I., Schöler, H., and Smith, A. (1998) Cell 95, 379-391[CrossRef][Medline] [Order article via Infotrieve]
  14. Niwa, H., Miyazaki, J., and Smith, A. G. (2000) Nat. Genet. 24, 372-376[CrossRef][Medline] [Order article via Infotrieve]
  15. Avilion, A. A., Nicolis, S. K., Pevny, L. H., Perez, L., Vivian, N., and Lovell-Badge, R. (2003) Genes Dev. 17, 126-140[Abstract/Free Full Text]
  16. Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S., and Smith, A. (2003) Cell 113, 643-655[CrossRef][Medline] [Order article via Infotrieve]
  17. Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M., and Yamanaka, S. (2003) Cell 113, 631-642[CrossRef][Medline] [Order article via Infotrieve]
  18. Loh, Y. H., Wu, Q., Chew, J. L., Vega, V. B., Zhang, W., Chen, X., Bourque, G., George, J., Leong, B., Liu, J., Wong, K. Y., Sung, K. W., Lee, C. W. H., Zhao, X. D., Chiu, K. P., Lipovich, L., Kuznetsov, V. A., Robson, P., Stanton, L. W., Wei, C. L., Ruan, Y., Lim, B., and Ng, H. H. (2006) Nat. Genet. 38, 431-440[CrossRef][Medline] [Order article via Infotrieve]
  19. Chew, J. L., Loh, Y. H., Zhang, W., Chen, X., Tam, W. L., Yeap, L. S., Li, P., Ang, Y. S., Lim, B., Robson, P., and Ng, H. H. (2005) Mol. Cell. Biol. 25, 6031-6046[Abstract/Free Full Text]
  20. Okumura-Nakanishi, S., Saito, M., Niwa, H., and Ishikawa, F. (2005) J. Biol. Chem. 280, 5307-5317[Abstract/Free Full Text]
  21. Tomioka, M., Nishimoto, M., Miyagi, S., Katayanagi, T., Fukui, N., Niwa, H., Muramatsu, M., and Okuda, A. (2002) Nucleic Acids Res. 30, 3202-3213[Abstract/Free Full Text]
  22. Kuroda, T., Tada, M., Kubota, H., Kimura, H., Hatano, S., Suemori, H., Nakatsuji, N., and Tada, T. (2005) Mol. Cell. Biol. 25, 2475-2485[Abstract/Free Full Text]
  23. Rodda, D. J., Chew, J. L., Lim, L. H., Loh, Y. H., Wang, B., Ng, H. H., and Robson, P. (2005) J. Biol. Chem. 280, 24731-24737[Abstract/Free Full Text]
  24. Zhang, J., Tam, W. L., Tong, G. Q., Wu, Q., Chan, H. Y., Soh, B. S., Lou, Y., Yang, J., Ma, Y., Chai, L., Ng, H. H., Lufkin, T., Robson, P., and Lim, B. (2006) Nat. Cell Biol. 8, 1114-1123[CrossRef][Medline] [Order article via Infotrieve]
  25. Wu, Q., Chen, X., Zhang, J., Loh, Y. H., Low, T. Y., Zhang, W., Zhang, W., Sze, S. K., Lim, B., and Ng, H. H. (2006) J. Biol. Chem. 281, 24090-24094[Abstract/Free Full Text]
  26. Ramalho-Santos, M., Yoon, S., Matsuzaki, Y., Mulligan, R. C., and Melton, D. A. (2002) Science 298, 597-600[Abstract/Free Full Text]
  27. Bortvin, A., Eggan, K., Skaletsky, H., Akutsu, H., Berry, D. L., Yanagimachi, R., Page, D. C., and Jaenisch, R. (2003) Development 130, 1673-1680[Abstract/Free Full Text]
  28. Maldonado-Saldivia, J., van den Bergen, J., Krouskos, M., Gilchrist, M., Lee, C., Li, R., Sinclair, A. H., Surani, M. A., and Western, P. S. (2007) Stem Cells 25, 19-28[Abstract/Free Full Text]
  29. Boyer, L. A., Lee, T. I., Cole, M. F., Johnstone, S. E., Levine, S. S., Zucker, J. P., Guenther, M. G., Kumar, R. M., Murray, H. L., Jenner, R. G., Gifford, D. K., Melton, D. A., Jaenisch, R., and Young, R. A. (2005) Cell 122, 947-956[CrossRef][Medline] [Order article via Infotrieve]
  30. Sato, M., Kimura, T., Kurokawa, K., Fujita, Y., Abe, K., Masuhara, M., Yasunaga, T., Ryo, A., Yamamoto, M., and Nakano, T. (2002) Mech. Dev. 113, 91-94[CrossRef][Medline] [Order article via Infotrieve]
  31. Saitou, M., Barton, S. C., and Surani, M. A. (2002) Nature 418, 293-300[CrossRef][Medline] [Order article via Infotrieve]
  32. Aravind, L., and Koonin, E. V. (2000) Trends Biochem. Sci. 25, 112-114[CrossRef][Medline] [Order article via Infotrieve]
  33. Masui, S., Shimosato, D., Toyooka, Y., Yagi, R., Takahashi, K., and Niwa, H. (2005) Nucleic Acids Res. 33, e43[Abstract/Free Full Text]
  34. Chinzei, R., Tanaka, Y., Shimizu-Saito, K., Hara, Y., Kakinuma, S., Watanabe, M., Teramoto, K., Arii, S., Takase, K., Sato, C., Terada, N., and Teraoka, H. (2002) Hepatology 36, 22-29[CrossRef][Medline] [Order article via Infotrieve]
  35. Smith, E. R., Smedberg, J. L., Rula, M. E., and Xu, X. X. (2004) J. Cell Biol. 164, 689-699[Abstract/Free Full Text]
  36. Rose, S. M., and Garrard, W. T. (1984) J. Biol. Chem. 259, 8534-8544[Abstract/Free Full Text]
  37. Remboutsika, E., Lutz, Y., Gansmuller, A., Vonesch, J. L., Losson, R., and Chambon, P. (1999) J. Cell Sci. 112, 1671-1683[Abstract]
  38. Reyes, J. C., Muchardt, C., and Yaniv, M. (1997) J. Cell Biol. 137, 263-274[Abstract/Free Full Text]
  39. Komarnitsky, P., Cho, E. J., and Buratowski, S. (2000) Genes Dev. 14, 2452-2460[Abstract/Free Full Text]
  40. Schneider, R., Bannister, A. J., Myers, F. A., Thorne, A. W., Crane-Robinson, C., and Kouzarides, T. (2004) Nat. Cell Biol. 6, 73-77[CrossRef][Medline] [Order article via Infotrieve]
  41. Lachner, M., O'Carroll, D., Rea, S., Mechtler, K., and Jenuwein, T. (2001) Nature 410, 116-120[CrossRef][Medline] [Order article via Infotrieve]
  42. Wang, J., Rao, S., Chu, J., Shen, X., Levasseur, D. N., Theunissen, T. W., and Orkin, S. H. (2006) Nature 444, 364-368[CrossRef][Medline] [Order article via Infotrieve]
  43. Fujii-Yamamoto, H., Kim, J. M., Arai, K., and Masai, H. (2005) J. Biol. Chem. 280, 12976-12987[Abstract/Free Full Text]
  44. Lake, J., Rathjen, J., Remiszewski, J., and Rathjen, P. D. (2000) J. Cell Sci. 113, 555-566[Abstract]
  45. Hamazaki, T., Oka, M., Yamanaka, S., and Terada, N. (2004) J. Cell Sci. 117, 5681-5686[Abstract/Free Full Text]
  46. Li, L., Arman, E., Ekblom, P., Edgar, D., Murray, P., and Lonai, P. (2004) Development 131, 5277-5286[Abstract/Free Full Text]
  47. Ivanova, N., Dobrin, R., Lu, R., Kotenko, I., Levorse, J., DeCoste, C., Schafer, X., Lun, Y., and Lemischka, I. R. (2006) Nature 442, 533-538[CrossRef][Medline] [Order article via Infotrieve]
  48. Meshorer, E., and Misteli, T. (2006) Nat. Rev. Mol. Cell Biol. 7, 540-546[CrossRef][Medline] [Order article via Infotrieve]
  49. Meshorer, E., Yellajoshula, D., George, E., Scambler, P. J., Brown, D. T., and Misteli, T. (2006) Dev. Cell 10, 105-116[CrossRef][Medline] [Order article via Infotrieve]
  50. Nakamura, T., Arai, Y., Umehara, H., Masuhara, M., Kimura, T., Taniguchi, H., Sekimoto, T., Ikawa, M., Yoneda, Y., Okabe, M., Tanaka, S., Shiota, K., and Nakano, T. (2007) Nat. Cell Biol. 9, 64-71[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
B. Madan, V. Madan, O. Weber, P. Tropel, C. Blum, E. Kieffer, S. Viville, and H. J. Fehling
The Pluripotency-Associated Gene Dppa4 Is Dispensable for Embryonic Stem Cell Identity and Germ Cell Development but Essential for Embryogenesis
Mol. Cell. Biol., June 1, 2009; 29(11): 3186 - 3203.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Ho, J. L. Ronan, J. Wu, B. T. Staahl, L. Chen, A. Kuo, J. Lessard, A. I. Nesvizhskii, J. Ranish, and G. R. Crabtree
An embryonic stem cell chromatin remodeling complex, esBAF, is essential for embryonic stem cell self-renewal and pluripotency
PNAS, March 31, 2009; 106(13): 5181 - 5186.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/45/33034    most recent
M703245200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masaki, H.
Right arrow Articles by Teraoka, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masaki, H.
Right arrow Articles by Teraoka, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement