Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M704331200 on September 25, 2007

J. Biol. Chem., Vol. 282, Issue 47, 34058-34065, November 23, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/47/34058    most recent
M704331200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, Y.
Right arrow Articles by Forgac, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, Y.
Right arrow Articles by Forgac, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Arrangement of Subunits in the Proteolipid Ring of the V-ATPase*

Yanru Wang, Daniel J. Cipriano, and Michael Forgac1

From the Department of Physiology, Tufts University School of Medicine, Boston, Massachusetts 02111

Received for publication, May 25, 2007 , and in revised form, August 30, 2007.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The vacuolar ATPases (V-ATPases) are multisubunit complexes containing two domains. The V1 domain (subunits A–H) is peripheral and carries out ATP hydrolysis. The V0 domain (subunits a, c, c', c'', d, and e) is membrane-integral and carries out proton transport. In yeast, there are three proteolipid subunits as follows: subunit c (Vma3p), subunit c' (Vma11p), and subunit c'' (Vma16p). The proteolipid subunits form a six-membered ring containing single copies of subunits c' and c'' and four copies of subunit c. To determine the possible arrangements of proteolipid subunits in V0 that give rise to a functional V-ATPase complex, a series of gene fusions was constructed to constrain the arrangement of pairs of subunits in the ring. Fusions containing c'' employed a truncated version of this protein lacking the first putative transmembrane helix (which we have shown previously to be functional), to ensure that the N and C termini of all subunits were located on the luminal side of the membrane. Fusion constructs were expressed in strains disrupted in c', c'', or both but containing a wild copy of c to ensure the presence of the required number of copies of subunit c. The c-c''({Delta}TM1), c''({Delta}TM1)-c', and c'-c constructs all complemented the vma phenotype and gave rise to complexes possessing greater than 25% of wild-type levels of activity. By contrast, neither the c-c', the c'-c''({Delta}TM1), nor the c''({Delta}TM1)-c constructs complemented the vma phenotype. These results suggest that functionally assembled V-ATPase complexes contain the proteolipid subunits arranged in a unique order in the ring.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The vacuolar (H+)-ATPases (V-ATPases)2 are a family of ATP-dependent proton pumps that acidify intracellular compartments like endosomes, lysosomes, and synaptic vesicles (16). Intracellular V-ATPases are important in processes such as membrane traffic, protein degradation, coupled transport, and the entry of many viruses and toxins, including influenza virus and anthrax toxin (1, 7). They also pump protons across the plasma membrane in certain cells, including renal intercalated cells, epididymal cells, osteoclasts, and tumor cells (4, 810). Plasma membrane V-ATPases in these cells are important in acid-base balance in the kidney, sperm maturation, bone resorption, and tumor metastasis, respectively.

The V-ATPases are multisubunit complexes containing two domains (16). The peripheral V1 domain is composed of eight subunits (A–H) and functions to hydrolyze ATP. The integral V0 domain is composed of six subunits and is responsible for proton transport. V0 domains from both yeast and mammalian sources contain a set of common subunits (a, c, c'', d, and e) (1, 11). In addition, the yeast V0 domain contains an additional proteolipid subunit (c'), whereas the V0 domain from at least some mammalian sources contains a glycoprotein subunit termed Ac45 (12).

The proteolipid subunits of the V-ATPase (subunits c, c', and c'') are homologous to each other and to the c subunit of the F-ATPase (13, 14). The c subunit of the F-ATPase is an 8-kDa protein that contains two transmembrane helices (TMs). The second TM contains a buried acidic amino acid that is critical for proton transport (15). The F-ATPase c subunits are arranged in a ring. In contrast with the F-ATPase, which contains only a single type of proteolipid subunit, the V-ATPases contain either two or three different proteolipid subunits. In yeast, all three proteolipid subunits have been shown to be essential for activity (14).

Subunits c and c' have molecular masses around 17 kDa and contain four transmembrane helices. Subunit c'' has a molecular mass of 23 kDa and contains a fifth transmembrane helix at the N terminus (14). Each proteolipid subunit contains a buried glutamic acid residue critical for proton transport. This critical residue resides in TM4 of subunits c and c' but in TM3 of subunit c'' (14). Subunit c'' contains an additional buried glutamic acid residue in TM5, but this residue is not essential for activity. The essential glutamic acid residues in each subunit are thought to undergo reversible protonation and deprotonation during proton transport through the V0 domain.

Although evidence from quantitative amino acid analysis suggests that the proteolipid subunits of the V-ATPase form a six-membered ring (16), the arrangement of the proteolipids in the ring is not known. The purpose of this study was to determine which of the possible arrangements of the three proteolipid subunits give rise to a functional V-ATPase complex. This was addressed by construction of a series of gene fusions in which pairs of the proteolipid subunits were constrained to adopt a particular orientation. The results suggest that the V-ATPase proteolipid subunits in the functionally assembled complex adopt a unique orientation.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Zymolyase 100T was obtained from Seikagaku America, Inc. Protease inhibitors (leupeptin, pepstatin, and aprotinin), the monoclonal antibody 3F10 (directed against the influenza hemagglutinin (HA) antigen) conjugated with horseradish peroxidase, mouse monoclonal antibody 8B1-F3 against the yeast V-ATPase A subunit, and the mouse monoclonal antibody 10D7 against the 100-kDa subunit a were from Invitrogen. Bacterial and yeast culture media were purchased from Difco. Restriction endonucleases, T4 DNA ligase, and other molecular biology reagents were from Invitrogen, Promega, and New England Biolabs. Concanamycin A, ATP, phenylmethylsulfonyl fluoride, and most other chemicals were purchased from Sigma.

Plasmid Construction and Epitope Tagging—We genetically fused the different proteolipid subunits to each other in six different combinations (Fig. 1a). The plasmid pYW3-16 encoding the fusion of c and c''({Delta}TM1) was constructed by ligation of plasmid pTN3 containing VMA3 with a PCR product derived from pTN16 encoding a VMA16 lacking amino acids 1–48 but containing a single HA tag at the C terminus. The linker region connecting c and c''({Delta}TM1) was 14 amino acids in length and included the C-terminal 6 amino acids of c and amino acids 49–54 of c'' (Fig. 1b). pYW16-3, pYW16-11, pYW11-16, and pYW11-3 were all constructed using the same strategy as pYW3-16 and contained linker regions of 14 amino acids (for the first three) or 10 amino acids (for pYW11-3) (Fig. 1b). pYW16-3, pYW11-16, and pYW11-3 contained single HA tags at the C terminus, whereas pYW16-11 contained three tandem HA tags at the C terminus. Initial attempts to construct a fusion protein containing c followed by c' using the same strategy failed because of cleavage of the fusion protein in the linker region connecting the two subunits. To solve this problem, the linker region was replaced with the 14-amino acid linker from pYW3-16 (Fig. 1b), which then gave a stable fusion construct. pYW3-11 again contained a single HA tag at the C terminus. For construction of 11-3pRS316, an XhoI and SpeI fragment of pYW11-3 was recloned into pRS316. For construction of 3-16pRS316, an EcoRI and SalI fragment of pYW3-16 was recloned into pRS316. The oligonucleotides used for amplification of fusion genes are as follows: pYW3-11 forward, GTCGGATCCTTCTTGTTAAGGACATCCGCTCCCTTTTTCGGGTTCGC, and pYW3-11 reverse, GAAACTAGTTTAGGCGTAGTCGGGCACGTCGTAGGG; pYW3-16 forward, GTCGGATCCTTCTTGTTAAGGACATCC, and the same reverse primer as pYW3-11; pYW11-3 forward, CGGATTCATGACTGAATTGTGTCCTG, and pYW11-3 reverse, CGGGAATCCTTAGGCGTAGTCGGGCACGTCGTAGGG; pYW16-3 forward, GGGACGCGTACTGAATTGTGTCCTGTC, and the same reverse primer as pYW11-3; pYW16-11 forward, ACGCGTGTCGACATGTCAACGCAACTC, and pYW16-11 reverse, CGGGAATTCTTAGGCGTAGTCGGGCACGTCGTAGGGGTAACAGACAACATCTTGAGT.

Strains and Culture Conditions—The yeast strains and plasmids used in this study are listed in Tables 1 and 2. HA-tagged forms of each proteolipid subunit (and the c''({Delta}TM1) construct) were expressed in the strain in which the corresponding gene was disrupted. All fusion proteins were also HA-tagged. The c-c' and c'-c fusions were expressed in a strain disrupted in subunit c' but containing the endogenous copies of subunits c and c''. Similarly, the c-c'' and c''-c fusions were expressed in a strain disrupted in c'' but containing the endogenous copies of subunits c and c'. The c'-c'' and c''-c' fusions were expressed in a strain disrupted in c' and c'' but containing the endogenous copy of subunit c. By expressing all fusions in strains containing the wild-type c gene, we could ensure that the requisite number of copies of subunit c to form a functional ring would be present. All yeast strains were cultured in synthetic dropout minimal media supplemented with the appropriate amino acids or YEPD media buffered to pH 5.5 using 50 mM succinate/phosphate. To test for a vma phenotype, saturated cultures were diluted to an absorbance at 600 nm of 0.20. Serial dilutions of the cultures were prepared in YEPD media buffered to pH 7.5, and growth was monitored on YEPD plates buffered to the same pH.


View this table:
[in this window]
[in a new window]

 
TABLE 1
Yeast strains used in this study

 


View this table:
[in this window]
[in a new window]

 
TABLE 2
Plasmids used in this study

 
Transformation and Selection—Yeast cells were transformed using the lithium acetate method (17). The transformants were selected on ura minus plates (for 11-3pRS316 and 3-16pRS316) or histidine minus plates for other strains, and growth phenotypes of the mutants were assessed on YEPD plates buffered with 50 mM KH2PO4 or 50 mM succinic acid to either pH 7.5 or pH 5.5.

Protein Preparation, SDS-PAGE, and Immunoblot Analysis—Whole cell lysates were prepared using a modification of the previously described protocol (18); 5-ml yeast cultures were grown overnight at 30 °C to an absorbance at 600 nm of 1.0. Cells were collected by centrifugation and washed with 1 ml of cold extraction buffer (150 mM ammonium sulfate, 10% glycerol, 1 mM EDTA, 200 mM Tris (pH 8.0), 2 mM dithiothreitol, and protease inhibitors). Cells were resuspended in 200 µl of extraction buffer and vortexed with glass beads five times for 1-min pulses. Unbroken cells were removed by sedimentation for 3 min at 4000 rpm, and samples of the supernatant were collected. Vacuolar membrane vesicles were isolated as described previously (19). Whole cell lysates and vacuolar membranes were separated by SDS-PAGE on 4–15% gradient acrylamide gels, as described previously (20). Expression of the fusion proteins was analyzed by Western blotting using the horseradish peroxidase-conjugated monoclonal antibody 3F10 against HA, whereas subunit a and subunit A were detected using the monoclonal antibodies 10D7 and 8B1-F3, respectively, followed by a horseradish peroxidase-conjugated secondary antibody, as described previously (21, 22). Blots were developed using a chemiluminescent detection method obtained from Kirkegaard & Perry Laboratories.

ATPase Activity and ATP-dependent Proton Transport—ATPase activity was measured using a coupled spectrophotometric assay (23). The reactions were carried out at 30 °C, and vacuolar membrane vesicles were incubated with Me2SO or 1 µM concanamycin A (in Me2SO) for 5 min prior to measurement of ATPase activity. ATP-dependent proton transport was measured by fluorescence quenching with the fluorescence probe 9-amino-6-chloro-2-methoxyacridine in transport buffer (50 mM NaCl, 30 mM KCl, 20 mM HEPES, 0.2 mM EGTA, 10% glycerol (pH 7.0)) as described (23) in the presence or absence of 1 µM concanamycin A.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Construction of Proteolipid Fusion Proteins—Previous results from studies of the bovine clathrin-coated vesicle and yeast V-ATPases suggest that the proteolipid ring of the yeast V-ATPase consists of four copies of subunit c and one copy of subunits c' and c'' (16, 24). The arrangement of subunits in the proteolipid ring, however, is not known. To determine which arrangements of the subunits in the proteolipid ring are able to give rise to a functional V-ATPase complex, a series of six gene fusions was constructed between pairs of proteolipid subunit genes (Fig. 1a). These fusion constructs were then expressed in the appropriate deletion strains (Tables 1 and 2). By expressing proteolipid subunits as fusion constructs, the resultant oligomer is restricted in the possible arrangements that the proteolipid subunits can adopt. Assuming that each proteolipid subunit inserts in the ring with the same internal arrangement of transmembrane helices (see "Discussion"), there are five possible arrangements of the three proteolipid subunits in a six-membered ring (Fig. 2). In two of these, subunits c' and c'' are adjacent to each other, either clockwise or counterclockwise relative to each other (models A and B). In two other arrangements, subunits c' and c'' are separated by a single copy of subunit c (c' and c'' are again either clockwise or counterclockwise relative to each other, models C and D). In the final arrangement, subunit c' and c'' are on opposite sides of the six-membered ring separated by two copies of subunit c (model E). Each of these arrangements makes specific predictions about which proteolipid fusions should give rise to a functional V-ATPase (Table 3).


View this table:
[in this window]
[in a new window]

 
TABLE 3
Ability of fusion constructs to form proteolipid rings shown in Fig. 2

+ indicates the proteolipid ring shown in the corresponding model in Fig. 2 can be formed from the fusion construct indicated, whereas - indicates the ring cannot be formed.

 


Figure 1
View larger version (67K):
[in this window]
[in a new window]

 
FIGURE 1.
Proteolipid subunit fusion proteins. a, topological models of the six proteolipid fusion proteins created in this study. Transmembrane helices are numbered from the N terminus and are shown as follows: subunit c (gray gradient); subunit c' (white); and subunit c'' (solid gray). b, linker sequences used to fuse two proteolipids. The loop regions are shown in boldface, and the black lines below the sequences denote the amino acids derived from each proteolipid subunit.

 
Topological studies of the yeast proteolipids suggest that subunit c'' has five transmembrane helices with the N terminus on the cytoplasmic side of the membrane, whereas subunits c and c' both have four transmembrane helices with both the N and C terminus on the luminal side of the membrane (25). It was therefore necessary to delete TM1 of subunit c'' to ensure that construction of fusion proteins containing subunit c'' at the C terminus did not change the way in which the transmembrane segments of subunit c'' were inserted (Fig. 1a). We and others have shown previously that strains expressing subunit c'' from which TM1 had been deleted still gave rise to a functional V-ATPase complex (25, 26). Thus, c'' ({Delta}TM1) was used in place of c'' in construction of fusion proteins in this study.

Care was taken to define the transmembrane segments as well as the minimal length of the loop connecting the two proteins. We defined the transmembrane helix/connecting loop boundaries of the yeast proteolipids by comparing them to the NtpK subunit of the V-type (Na+)-ATPase from Enterococcus hirae (27). If the connecting loop between the fused proteins is too short, it may not allow the two halves of the protein to adopt a native conformation or insert properly into the membrane. However, if the connecting loop is too long, it could allow for another c subunit to insert between the two halves of the fusion construct. Using a model of the c12 ring from the Escherichia coli F-ATPase and the c10 ring from E. hirae V-ATPase (15, 27), we estimate that a loop length of 10–14 amino acids is sufficient to connect adjacent subunits without allowing an additional copy of subunit c to insert between them. Therefore, all proteolipid fusions were constructed with a linker length of 10–14 amino acids.


Figure 2
View larger version (50K):
[in this window]
[in a new window]

 
FIGURE 2.
Possible arrangements of the three proteolipid subunits (c, c', and c'') in a six-membered proteolipid ring of the yeast V-ATPase. Subunit c is shown in white, subunit c' is shown in dark gray, and subunit c'' is shown in light gray. The proteolipid ring is viewed from the luminal side of the membrane, with the arrangement of helices within each subunit modeled after that observed in the c ring of the Na+ V-ATPase from E. hirae (27). A five TM model of subunit c'' is assumed in this diagram.

 
In Vivo Function and Stability of V-ATPase Containing Proteolipid Subunit Fusions—To address the functional role of different fusions, we first tested the ability of these constructs to complement the phenotype of yeast strains from which the various proteolipid genes have been deleted. It has been shown previously that yeast lacking any of the V-ATPase proteolipid genes display a conditional lethal phenotype (vma) characterized by an inability to grow at pH 7.5 but retaining the ability to grow at pH 5.5 (28). Data from our laboratory and others have shown previously that plasmid-borne VMA3, VMA11, VMA16, or VMA16{Delta}TM1 were able to complement their own disruption (25, 26). The c-c''({Delta}TM1), c''({Delta}TM1)-c', and c'-c fusion proteins were all able to confer wild-type growth on YEPD media buffered at pH 7.5, whereas the c-c', c'-c''({Delta}TM1), and c''({Delta}TM1)-c constructs could not (Fig. 3). We also observed that the c-c''({Delta}TM1) fusion construct did not support growth at pH 7.5 of the vma3{Delta},vma16{Delta} double deletion strain, whereas the c'-c fusion construct did not support growth at pH 7.5 of the vma3{Delta},vma11{Delta} double deletion strain (data not shown). This latter result is consistent with the need for multiple copies of subunit c, which cannot be provided by the fusion constructs alone in the double deletion strains.

Next the expression and stability of the fusion proteins as well as their ability to assemble into a V-ATPase complex was tested. Western blot analysis was performed on whole cell lysates using the monoclonal antibody 10D7 for subunit a, 8B1-F3 for subunit A, and 3F10 for the HA tag. Because there is currently no available antibody raised against any of the proteolipid subunits, an HA epitope tag was added at the C-terminal end of all constructs. Three HA tags were added to the C terminus of c''({Delta}TM1)-c' because of the weak signal observed with only one tag. All the proteolipid fusions had apparent molecular masses of 32–36 kDa, whereas the monomers (c, c', or c''({Delta}TM1)) had a molecular mass of 17 kDa (Fig. 4). The lower level of antibody staining of the c''({Delta}TM1)-c construct in whole cell lysate may reflect altered reactivity of the HA epitope in this construct or the low expression or degradation of the fusion protein in this mutant strain. These results demonstrate that five of the six fusion proteins are expressed and are stable.


Figure 3
View larger version (61K):
[in this window]
[in a new window]

 
FIGURE 3.
The ability of proteolipid fusion proteins to complement the vma phenotype in proteolipid deletion strains. Serial dilutions of yeast strains carrying plasmid-borne proteolipids and proteolipid fusions were spotted onto YEPD agar plates at either pH 5.5 or pH 7.5 and grown overnight at 30 °C. Five µl of yeast culture grown to an absorbance at 600 nm of 0.20 was spotted onto the plate at the far left-hand position for each pH, and the spots to the right of this position correspond to 5 µl of serial 10-fold dilutions of the original culture.

 


Figure 4
View larger version (49K):
[in this window]
[in a new window]

 
FIGURE 4.
The presence of V1 and V0 subunits in whole cell lysates. Whole cell lysates were isolated from strains expressing proteolipid subunits and proteolipid fusion constructs, subjected to SDS-PAGE, transferred to nitrocellulose, and probed with anti-a (10D7), anti-A (8B1-F3), or anti-HA (3F10) antibodies as described under "Experimental Procedures."

 
Previous studies have shown that the loss of subunit c or subunit d results in reduced levels of subunit a (29), likely because of reduced subunit a stability when not assembled into V0. In contrast, because V1 assembles independently of V0 (29, 30), V1 subunits are unaffected by the deletion of V0 subunits. To determine whether the proteolipid fusion constructs were able to stabilize subunit a, Western blotting was performed on whole cell lysates. As expected, lysates from all strains, including that carrying the empty vector, showed normal levels of subunit A (Fig. 4). Lysates isolated from strains expressing c-c''({Delta}TM1), c''({Delta}TM1)-c', or c'-c showed almost the same level of subunit a relative to strains carrying the c, c', or c''({Delta}TM1) controls. Strains carrying the c-c', c'-c''({Delta}TM1), or c''({Delta}TM1)-c showed reduced levels of subunit a, suggesting that these proteolipid fusions do not assemble properly.

To confirm this assembly defect and to test for proper targeting of the V-ATPase subunits to the vacuolar membrane, partially purified vacuoles were subjected to SDS-PAGE, and Western blot analysis was performed. As can be seen in Fig. 5, Western blots of isolated vacuoles carrying c-c''({Delta}TM1), c''({Delta}TM1)-c', or c'-c showed slightly reduced levels of subunits a and A relative to vacuoles isolated from the strains expressing the monomer of the three proteolipid subunits, whereas the c-c', c'-c''({Delta}TM1), and c''({Delta}TM1)-c constructs showed dramatically reduced levels of subunits a and A, showing that the latter three constructs were unable to assemble into either a stable V0 or V1V0 complex. These results suggest that the fusions c-c', c'-c''({Delta}TM1), and c''({Delta}TM1)-c cannot form the proper arrangement of proteolipid subunits in the V0 domain, whereas the c-c''({Delta}TM1), c''({Delta}TM1)-c', and c'-c are able to do so.


Figure 5
View larger version (43K):
[in this window]
[in a new window]

 
FIGURE 5.
Assembly and targeting of V-ATPases subunits to the vacuole. To assess the ability of the fusion constructs to assemble into V-ATPase complexes, vacuolar membrane fractions were isolated from strains expressing plasmid-borne proteolipids, and 15 µg were subjected to SDS-PAGE, followed by Western blotting using the monoclonal antibodies against subunit a, subunit A, and the HA epitope tag, as described in the legend to Fig. 4.

 
ATPase and Proton Transport Activity of V-ATPase Complexes Containing Proteolipid Fusion Proteins—To determine the effect of the fusion constructs on activity of the V-ATPase, both concanamycin-sensitive ATPase activity and ATP-dependent proton transport (as assessed by quenching of ACMA fluorescence) were measured in isolated vacuoles as described under "Experimental Procedures." The data shown in Fig. 6 represents the ATPase and proton transport activities sensitive to 1 µM concanamycin. The activities are expressed relative to those measured for vacuolar membranes isolated from a yeast strain expressing wild-type subunit c''. For ATPase activity, this corresponds to 0.51 µmol of ATP/min/mg of protein. Representative traces for ATP-dependent ACMA quenching as a measure of proton transport are shown in Fig. 7. Previous results have suggested that retention of 20% of wild-type V-ATPase activity is sufficient to confer on cells a wild-type growth phenotype (31, 32). As expected, vacuolar membranes from strains expressing the c-c''({Delta}TM1), c''({Delta}TM1)-c', or c'-c fusion proteins had more than 25% of the wild-type ATPase and proton pumping activities, whereas vacuole membranes from cells expressing the c-c', c'-c''({Delta}TM1), or c''({Delta}TM1)-c fusions showed almost no activity. The activities observed for the functional constructs are due to V-ATPase because both ATPase and proton transport activities are inhibitable by the specific V-ATPase inhibitor concanamycin. These data indicate that, although the c-c''({Delta}TM1), c''({Delta}TM1)-c', or c'-c fusion constructs do not give fully active complexes, the resultant complexes do possess significant V-ATPase activity.


Figure 6
View larger version (26K):
[in this window]
[in a new window]

 
FIGURE 6.
Concanamycin A-sensitive ATPase activity and ATP-dependent proton transport of vacuolar membranes containing wild-type and proteolipid fusion constructs. Vacuolar membranes were isolated from cells expressing plasmid-borne proteolipids or proteolipid fusion constructs, and the ATPase activity and ATP-dependent proton transport sensitive to 1 µM concanamycin A were measured as described under "Experimental Procedures." Solid bars represent the concanamycin-sensitive ATPase activities and are expressed relative to vacuolar membranes isolated from cells expressing wild-type subunit c'', which had a specific activity of 0.51 µmol of ATP/min/mg of protein. Concanamycin-sensitive ATP-dependent proton transport (open bars) was measured as the initial rate of ATP-dependent fluorescence quenching using the fluorescent dye ACMA. Values represent the average of the three measurements on two independent vacuole preparations ±S.D.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The results presented in this study suggest that the three proteolipid subunits of the yeast V-ATPase adopt a particular arrangement in the proteolipid ring. Thus, of the five possible arrangements of proteolipid subunits described in Fig. 2, only that described by model B is consistent with the data obtained (Table 3). In this model, subunit c' is adjacent to and counterclockwise from subunit c'' as viewed from the luminal side of the membrane, with the four copies of subunit c making up the remainder of the proteolipid ring. Moreover, although the results do not rule out other possible arrangements of transmembrane segments within each proteolipid subunit, they do place some constraints on the relative arrangements in adjacent subunits (see below).

The proteolipid ring of the V-ATPases plays a crucial role in proton transport. The V-ATPases, like the F-ATPases, operate by a rotary mechanism (33, 34). ATP hydrolysis in the V1 domain drives rotation of a rotary complex that includes the proteolipid ring of V0 (34). Rotation of the proteolipid ring relative to subunit a within the V0 domain drives unidirectional proton transport from the cytoplasmic to the luminal side of the membrane, as originally proposed for the F-ATPases (35, 36). Subunit a is held fixed relative to the catalytic head of V1 by peripheral stalks or stators (37, 38) and is thought to provide access channels (hemi-channels) for protons to reach and leave the critical carboxyl groups on the proteolipid ring (1). Evidence for such hemi-channels has been obtained for the F-ATPase a subunit (39). Subunit a also contains a critical arginine residue in TM7, which interacts with the carboxyl groups on the proteolipid ring (4042), thereby displacing protons from these sites into the luminal hemi-channel following rotation. By functioning as the proton acceptors and donors during rotary catalysis, the proteolipids serve an essential function in proton transport.


Figure 7
View larger version (34K):
[in this window]
[in a new window]

 
FIGURE 7.
ATP-dependent quenching of ACMA fluorescence by vacuolar membranes isolated from cells expressing wild-type and fusion constructs. Vacuolar membranes (4 µg of protein) isolated from cells expressing plasmid-borne proteolipids or proteolipid fusion constructs were assayed for ATP-dependent quenching of ACMA fluorescence as a measure of proton transport by addition of 1 mM MgATP and measurement of fluorescence intensity at 490 nm (excitation at 410 nm) as described under "Experimental Procedures." The trace indicated by c'' corresponds to the activity observed for a vma16{Delta} strain expressing an HA-tagged form of subunit c'', whereas the remaining traces correspond to the activities measured for the fusion constructs expressed in the deletions strains indicated in Fig. 3. The activities were quantitated from the slopes of the traces, and the values shown in Fig. 6 were corrected for any activity observed in the presence of 1 µM concanamycin, which was generally almost indistinguishable from the vector alone control. The slopes are proportional to the proton transport activity as indicated by the nearly linear relationship of the slope to the amount of vacuolar protein added (data not shown). At the indicated point, 5 mM (NH4)2SO4 was added to dissipate the pH gradient generated. It should be noted that the mutant strains give traces showing a significant lag before quenching following addition of MgATP, although the basis for this lag is not understood.

 
Because of its importance in proton transport, it is of interest to determine the structure of the proteolipid ring of the V-ATPases. A 3.9-Å resolution structure has been reported for the proteolipid ring of the F-ATPase from yeast mitochondria (43). The structure reveals a 10-membered ring with the outer part of the ring composed of TM2 of subunit c and the inner portion composed of TM1 (43). Individual c subunits have the TM1/TM2 loop facing the cytoplasmic side of the membrane, where it can interact with other subunits of the rotor. The critical acidic residues are located near the middle of TM2, although the structure is not of sufficiently high resolution to visualize the orientation of these groups. Modeling studies of the F-ATPase c ring based on the NMR structure of subunit c as well as cross-linking studies suggest that the buried carboxyl group is oriented inward toward a pocket formed between adjacent c subunits (15).

A 2.1-Å resolution structure has also been reported for the proteolipid ring of the (Na+)-V-ATPase from the archaebacteria E. hirae (27). Like the eukaryotic V-ATPase subunits c and c', the archaebacterial protein is composed of four TMs with the critical carboxyl group located in TM4. Because the E. hirae ring contains 10 copies of this protein, the ring is composed of 40 transmembrane helices, twice as many as the mitochondrial c ring. Nevertheless, the buried carboxyl groups (which are bound to Na+) are located near the middle of TM4 and are oriented toward a common pocket formed by TM2, TM3, and TM4.

Unlike the proteolipid rings from both the F-ATPase and the (Na+)-V-ATPase, which contain only a single species of c subunit, the eukaryotic V-ATPases contain either two (for mammals) or three (for fungi) distinct proteolipid subunits. Moreover, mutagenesis studies in yeast indicate that all three proteolipid subunits are essential to form a functional V-ATPase complex and do not replace one another upon gene disruption (14). Subunit c'', which is common to all eukaryotic V-ATPases, is unique both in having an additional transmembrane helix at the N terminus and in containing an additional (nonessential) buried carboxyl group in TM5. By placing the essential carboxyl group in TM3 rather than TM5, an irregularity is introduced in the spacing of the carboxyl groups around the ring (Fig. 2). This irregularity may affect the ability of the free V0 domain to passively conduct protons. In fact, one important difference between V0 and F0 is that free V0 does not carry out passive proton conduction (44). This property is important because an essential mechanism of regulating V-ATPase activity in vivo involves reversible dissociation of the complex into its component V1 and V0 domains (45). The data in this study support the relative orientation of subunits c, c'', and c' shown in model B. In this model, TM4 of subunit c is in proximity to TM2 of subunit c'', and TM5 of subunit c'' is in proximity to TM1 of subunit c'. As a result, helices containing essential glutamic acid residues are spaced evenly around the proteolipid ring except for the border of subunits c and c'', where they are in adjacent helices, and subunits c'' and c', where there is a gap lacking any critical acidic residue.

The proteolipid ring of the V0 domain from eukaryotes also appears to differ from that in E. hirae in size. Early measurements of subunit stoichiometry using quantitative amino acid analysis suggested 5–6 copies of c plus c' (not distinguishable by SDS-PAGE) and a single copy of subunit c'' (16). Later studies employing epitope-tagged subunits demonstrated that yeast V-ATPase complexes contain single copies of subunits c' and c'' but multiple copies of subunit c (24). This study shows that the c''-c' fusion is expressed, stable, and functional, further confirming that there are only single copies of the c' and c'' subunits present in the V0 proteolipid ring. Thus the eukaryotic proteolipid ring appears to be both more complex and significantly smaller than that from archaebacteria.

Attempts were made by our laboratory and the Stevens laboratory (University of Oregon) to construct homodimers of subunit c to establish whether the functional complex contains an even or odd number of c subunits. Tandem repeat DNA sequences of subunit c were constructed in plasmids and amplified in E. coli deficient in homologous recombination by mutation of the recA gene. Introduction into wild type or yeast lacking the VMA3 gene resulted in immediate recombination of the tandem repeat DNA sequence to efficiently and accurately produce a single copy of the VMA3 gene. Several yeast strains were constructed that contained disruptions of various genes in the RAD gene family in an attempt to stabilize the tandem repeat DNA sequences of subunit c.3 Unfortunately, none of the mutations adequately stabilized the plasmid-borne c-c fusion gene constructs and at best only slowed the conversion by recombination to the subunit c monomer gene, and these results were confirmed both at the DNA level and protein level. Thus it has not been possible to stably maintain the subunit c homodimer gene in yeast to test the various models for subunit c stoichiometry.

Given the unique properties of the eukaryotic proteolipid subunits and V0 domain, it was of interest to observe that these subunits appear to adopt a unique arrangement in the proteolipid ring of functional V-ATPase complexes. Because of the close similarity of subunit c and c', it is somewhat surprising that subunit c cannot replace subunit c' adjacent to and counterclockwise from subunit c''.

One possible reason for this may be related to the role that subunit c' plays in assembly of the V-ATPase complex. Subunit c' has been shown to serve as the binding site for Vma21p, which is one of three dedicated chaperone proteins (the others being Vma12p and Vma22p) that are localized to the endoplasmic reticulum and that are required for assembly of the V0 domain (46). Vma21p appears to promote assembly of the proteolipid subunits into a ring and the association of the ring with subunit d, which sits in the middle of the cytoplasmic side of the ring (47). Perhaps, by virtue of this interaction with the assembly factor Vma21p, subunit c' facilitates insertion and association of subunit c'' with the remainder of the ring. Subunit c'' may pose unique problems in this regard because of the presence of the additional transmembrane helix at the N terminus. It is also possible that subunit c' may need to be in contact with both subunit c and subunit c'' in order for Vma21p to mediate assembly of the proteolipid ring. If this is the case, the actual helical contacts between these subunits also appear to be important, because the proteolipid subunits cannot assemble into a functional complex when constrained to adopt the arrangement shown in Fig. 2, model A. Because mammalian cells contain no subunit c', subunit c presumably assumes this role, suggesting a difference in the binding properties of the mammalian counterpart to Vma21p.

From the data in Fig. 5, it should be noted that the chimeras that fail to complement the vma phenotype (c'-c''({Delta}TM1), c''({Delta}TM1)-c, and c-c') do not allow assembly of intact V-ATPase complexes in the vacuolar membrane. It is therefore not possible to determine from our data whether complexes that did contain these alternative arrangements would be functional in ATP-dependent proton transport or not. In summary, we have shown that the three proteolipid subunits of the yeast V-ATPase must adopt a unique arrangement to assemble functional complexes in vivo.


    FOOTNOTES
 
* This work was supported by National Institutes of Health Grant GM34478 (to M. F.), a postdoctoral fellowship from the NE Affiliate of the American Heart Association (to Y. W.), and a postdoctoral fellowship from the Canadian Institutes of Health Research (to D. J. C.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Dept. of Physiology, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA 02111. Tel.: 617-636-6939; Fax: 617-636-0445; E-mail: michael.forgac{at}tufts.edu.

2 The abbreviations used are: V-ATPase, vacuolar proton-translocating adenosine triphosphatase; F-ATPase, F1F0-ATP synthase; HA, influenza hemagglutinin; TM, transmembrane segment; ACMA, 9-amino-6-chloro-2-methoxyacridine; YEPD, yeast extract peptone dextrose; Me2SO, dimethyl sulfoxide. Back

3 L. A. Graham and T. H. Stevens, personal communication. Back


    ACKNOWLEDGMENTS
 
We thank Drs. Tom Stevens and Laurie Graham (University of Oregon) for the kind gift of the vma3{Delta},vma11{Delta} and vma3{Delta},vma16{Delta} double deletion strains and for sharing their information concerning homologous recombination of c-c dimer constructs. We also thank Drs. Ayana Hinton and Takao Inoue as well as Jie Qi, Kevin Jeffries, and Sarah Bond for many helpful discussions and Kathleen Forgac for careful reading of our manuscript. E. coli strains were provided through National Institutes of Health Grant DK34928.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Forgac, M. (2007) Nat. Rev. Mol. Cell Biol. 8, 1–13[CrossRef]
  2. Kane, P. M. (2006) Microbiol. Mol. Biol. Rev. 70, 177–191[Abstract/Free Full Text]
  3. Nelson, N. (2003) J. Bioenerg. Biomembr. 35, 281–289[CrossRef][Medline] [Order article via Infotrieve]
  4. Wagner, C. A., Finberg, K. E., Breton, S., Marshansky, V., Brown, D., and Geibel, J. P. (2004) Physiol. Rev. 84, 1263–1314[Abstract/Free Full Text]
  5. Sun-Wada, G. H., Wada, Y., and Futai, M. (2004) Biochim. Biophys. Acta 1658, 106–114[Medline] [Order article via Infotrieve]
  6. Inoue, T., Wang, Y., Jefferies, K., Qi, J., Hinton, A., and Forgac, M. (2005) J. Bioenerg. Biomembr. 37, 393–398[CrossRef][Medline] [Order article via Infotrieve]
  7. Abrami, L., Lindsay, M., Parton, R. G., Leppla, S. H., and van der Goot, F. G. (2004) J. Cell Biol. 166, 645–651[Abstract/Free Full Text]
  8. Pietrement, C., Sun-Wada, G. H., Silva, N. D., McKee, M., Marshansky, V., Brown, D., Futai, M., and Breton, S. (2006) Biol. Reprod. 74, 185–194[Abstract/Free Full Text]
  9. Li, Y. P., Chen, W., Liang, Y., Li, E., and Stashenko, P. (1999) Nat. Genet. 23, 447–451[CrossRef][Medline] [Order article via Infotrieve]
  10. Sennoune, S. R., Bakunts, K., Martinez, G. M., Chua-Tuan, J. L., Kebir, Y., Attaya, M. N., and Martinez-Zaguilan, R. (2004) Am. J. Physiol. 286, C1443–C1452[CrossRef]
  11. Sambade, M., and Kane, P. M. (2004) J. Biol. Chem. 279, 17361–17365[Abstract/Free Full Text]
  12. Supek, F., Supekova, L., Mandiyan, S., Pan, Y. C., Nelson, H., and Nelson, N. (1994) J. Biol. Chem. 269, 24102–24106[Abstract/Free Full Text]
  13. Mandel, M., Moriyama, Y., Hulmes, J. D., Pan, Y. C., Nelson, H., and Nelson, N. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 5521–5524[Abstract/Free Full Text]
  14. Hirata, R., Graham, L. A., Takatsuki, A., Stevens, T. H., and Anraku, Y. (1997) J. Biol. Chem. 272, 4795–4803[Abstract/Free Full Text]
  15. Dmitriev, O. Y., Jones, P. C., and Fillingame, R. H. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 7785–7790[Abstract/Free Full Text]
  16. Arai, H., Terres, G., Pink, S., and Forgac, M. (1988) J. Biol. Chem. 263, 8796–8802[Abstract/Free Full Text]
  17. Gietz, D., St. Jean, A., Woods, R. A., and Schiestl, R. H. (1992) Nucleic Acids Res. 20, 1425[Free Full Text]
  18. Pfeifer, K., Arcangioli, B., and Guarente, L. (1987) Cell 49, 9–18[CrossRef][Medline] [Order article via Infotrieve]
  19. Uchida, E., Ohsumi, Y., and Anraku, Y. (1985) J. Biol. Chem. 260, 1090–1095[Abstract/Free Full Text]
  20. Laemmli, U. K. (1970) Nature 227, 680–685[CrossRef][Medline] [Order article via Infotrieve]
  21. Arata, Y., Baleja, J. D., and Forgac, M. (2002) Biochemistry 41, 11301–11307[CrossRef][Medline] [Order article via Infotrieve]
  22. Arata, Y., Baleja, J. D., and Forgac, M. (2002) J. Biol. Chem. 277, 3357–3363[Abstract/Free Full Text]
  23. Vasilyeva, E., Liu, Q., MacLeod, K. J., Baleja, J. D., and Forgac, M. (2000) J. Biol. Chem. 275, 255–260[Abstract/Free Full Text]
  24. Powell, B., Graham, L. A., and Stevens, T. H. (2000) J. Biol. Chem. 275, 23654–23660[Abstract/Free Full Text]
  25. Flannery, A. R., Graham, L. A., and Stevens, T. H. (2004) J. Biol. Chem. 279, 39856–39862[Abstract/Free Full Text]
  26. Nishi, T., Kawasaki-Nishi, S., and Forgac, M. (2003) J. Biol. Chem. 278, 5821–5827[Abstract/Free Full Text]
  27. Murata, T., Yamato, I., Kakinuma, Y., Leslie, A. G., and Walker, J. E. (2005) Science 308, 654–659[Abstract/Free Full Text]
  28. Nelson, H., and Nelson, N. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 3503–3507[Abstract/Free Full Text]
  29. Bauerle, C., Ho, M. N., Lindorfer, M. A., and Stevens, T. H. (1993) J. Biol. Chem. 268, 12749–12757[Abstract/Free Full Text]
  30. Doherty, R. D., and Kane, P. M. (1993) J. Biol. Chem. 268, 16845–16851[Abstract/Free Full Text]
  31. Liu, J., and Kane, P. M. (1996) Biochemistry 35, 10938–10948[CrossRef][Medline] [Order article via Infotrieve]
  32. MacLeod, K. J., Vasilyeva, E., Baleja, J. D., and Forgac, M. (1998) J. Biol. Chem. 273, 150–156[Abstract/Free Full Text]
  33. Imamura, H., Nakano, M., Noji, H., Muneyuki, E., Ohkuma, S., Yoshida, M., and Yokoyama, K. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 2312–2315[Abstract/Free Full Text]
  34. Hirata, T., Iwamoto-Kihara, A., Sun-Wada, G. H., Okajima, T., Wada, Y., and Futai, M. (2003) J. Biol. Chem. 278, 23714–23719[Abstract/Free Full Text]
  35. Vik, S. B., and Antonio, B. J. (1994) J. Biol. Chem. 269, 30364–30369[Abstract/Free Full Text]
  36. Junge, W., Sabbert, D., and Engelbrecht, S. (1996) Ber. Bunsen-Ges. Phys. Chem. 100, 2014–2019
  37. Boekema, E. J., van Breemen, J. F., Brisson, A., Ubbink-Kok, T., Konings, W. N., and Lolkema, J. S. (1999) Nature 401, 37–38[CrossRef][Medline] [Order article via Infotrieve]
  38. Wilkens, S., Inoue, T., and Forgac, M. (2004) J. Biol. Chem. 279, 41942–41949[Abstract/Free Full Text]
  39. Fillingame, R. H., Angevine, C. M., and Dmitriev, O. Y. (2002) Biochim. Biophys. Acta 1555, 29–36[Medline] [Order article via Infotrieve]
  40. Kawasaki-Nishi, S., Nishi, T., and Forgac, M. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 12397–12402[Abstract/Free Full Text]
  41. Kawasaki-Nishi, S., Nishi, T., and Forgac, M. (2003) J. Biol. Chem. 278, 41908–41913[Abstract/Free Full Text]
  42. Wang, Y., Inoue, T., and Forgac, M. (2004) J. Biol. Chem. 279, 44628–44638[Abstract/Free Full Text]
  43. Stock, D., Leslie, A. G., and Walker, J. E. (1999) Science 286, 1700–1705[Abstract/Free Full Text]
  44. Zhang, J., Myers, M., and Forgac, M. (1992) J. Biol. Chem. 267, 9773–9778[Abstract/Free Full Text]
  45. Kane, P. M. (1995) J. Biol. Chem. 270, 17025–17032[Abstract/Free Full Text]
  46. Malkus, P., Graham, L. A., Stevens, T. H., and Schekman, R. (2004) Mol. Biol. Cell 15, 5075–5091[Abstract/Free Full Text]
  47. Iwata, M., Imamura, H., Stambouli, E., Ikeda, C., Tamakoshi, M., Nagata, K., Makyio, H., Hankamer, B., Barber, J., Yoshida, M., Yokoyama, K., and Iwata, S. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 59–64[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
B. Ediger, S. D. Melman, D. L. Pappas Jr., M. Finch, J. Applen, and K. J. Parra
The Tether Connecting Cytosolic (N Terminus) and Membrane (C Terminus) Domains of Yeast V-ATPase Subunit a (Vph1) Is Required for Assembly of V0 Subunit d
J. Biol. Chem., July 17, 2009; 284(29): 19522 - 19532.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
S. Saroussi and N. Nelson
The little we know on the structure and machinery of V-ATPase
J. Exp. Biol., June 1, 2009; 212(11): 1604 - 1610.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Ryan, L. A. Graham, and T. H. Stevens
Voa1p Functions in V-ATPase Assembly in the Yeast Endoplasmic Reticulum
Mol. Biol. Cell, December 1, 2008; 19(12): 5131 - 5142.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/47/34058    most recent
M704331200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, Y.
Right arrow Articles by Forgac, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, Y.
Right arrow Articles by Forgac, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement