![]()
|
|
||||||||
J. Biol. Chem., Vol. 282, Issue 47, 34204-34212, November 23, 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


2
3
From the
Whitehead Institute for Biomedical Research, Cambridge, Massachusetts 02142, the
Department of Chemistry and Biology, Emory University, Atlanta, Georgia 30322, the ¶Department of Molecular Genetics and Cell Biology, Howard Hughes Medical Institute, University of Chicago, Chicago, Illinois 60637, the ||Department of Chemistry and Biochemistry, University of California, Santa Cruz, California 95064, and the **Institut für Organische Chemie und Biochemie, Technische Universität München, D-85747 Garching, Germany
Received for publication, June 15, 2007 , and in revised form, September 11, 2007.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The mammalian PrP and yeast Sup35 share several similar structural characteristics, including a well-folded C-terminal core and a natively unfolded N terminus. The N termini of both proteins contain oligopeptide repeats that influence their conformational conversion to the prion state (6-10). The N terminus of wild-type human PrPC contains four perfect copies of a highly conserved octarepeat sequence (11), PHGGGWGQ, and one imperfect copy, PQGGGTWGQ. Expansion of the octarepeat region, ranging from one to nine extra copies, has been found in several types of familial CJD and is associated with an earlier onset of pathology (12, 13). When transgenic mice that express repeat-free PrP are infected by scrapie extracts or by PrP aggregates, they show a slower progression of disease (9, 14) and exhibit different histopathological characteristics than mice with the wild-type protein (15). In vitro, expansion of the octarepeat region increases the spontaneous conversion rate of PrPC to a protease-resistant conformation (16). Likewise, when the octarepeat region is fused to a GST (glutathione S-transferase) protein, it accelerates protein self-association and allows selective binding of PrPSc from brain extracts (17). Sup35 has five imperfect copies of PQGGYQQYN. Reducing the number of repeats lowers the frequency of spontaneous prion induction (7, 18). Furthermore, the prion state associated with this variant is unstable and frequently spontaneously converts back to the non-prion state, [psi-] (7). Sup35 with an expanded number of repeats, however, induces a new and stable prion state much more frequently than wild-type Sup35 (7).
Oligopeptide repeats of various lengths and compositions appear in several other amyloid-forming proteins in addition to prion proteins. The huntingtin protein associated with Huntington's disease contains a perfect polyglutamine repeat, and expansion of this repeat region results in early onset of the disease and an increase in the rate of in vitro amyloid formation (19, 20).
-Synuclein, a protein that plays a role in Parkinson disease and assembles into amyloid fibers in vitro, contains seven copies of a less defined repeat, XKTKEGVXXXX (21). The major and minor components of the Escherichia coli curli protein each consist of five 16-18 mer repeats, which are required for the formation of curli amyloid fibers and are involved in cell aggregation, biofilm formation, and surface adhesion (22, 23). Although oligopeptide repeats are clearly a crucial feature of these amyloid-forming proteins, the exact structural and functional role of these repeats remains unclear.
Compared with these other oligopeptide repeats, the biophysical properties of the PrP octarepeats are well characterized. The octarepeat of PrP can selectively bind Cu(II) ions (24), and the histidine residues in the octarepeats act as the primary anchor point for Cu(II) binding (24). Structurally, Cu(II) binding can induce a conformational conversion of PrPC into protease-resistant species (10), and the efficiency of this conversion depends on the number of octarepeats (17). Cu(II) ions combined with nicotinamide adenine dinucleotide phosphate (NADPH) can even induce spontaneous conformational change and aggregation of HuPrP-(23-98), a variant that only contains the octarepeat region of human PrP (25). Functionally, Cu(II) binding to the octarepeats induces PrPC endocytosis in neuronal cells, indicating a role for PrPC in Cu(II) sensing, uptake and/or transport (26). Superoxide dismutase (SOD)-like activities have also been reported for the Cu(II)-bound PrPC, suggesting a neuronal function of PrPC as an anti-oxidant (27-29), although that is still a subject of debate (30). Treatment of scrapie-infected mice with Cu(II) chelator D-(-)-penicillamine (D-PEN) delays the onset of prion disease in mice (31).
While the biophysical properties of the PrP repeats have been studied extensively, the role of the repeats in prion conformational conversion is not well understood, particularly because of the lack of knowledge on many details of PrP prion formation. One the other hand, the factors that guide prion conformational conversion have been best defined for Sup35. These factors include molecular chaperones that influence conformational conversion (32-35), as well as specific sequence elements that control the maintenance and nucleation of the prion conformation and govern the formation of distinct prions strains and the existence of prion species barriers (36-40). To provide a new model for studying prion conformational conversion and to better understand the role of the oligopeptide repeats in amyloid formation, we explored the role of the PrP octarepeats in the context of the yeast prion protein Sup35. We created chimeric proteins in which different numbers of hamster PrP repeats were substituted for the endogenous Sup35 repeats. Facilitated by the powerful genetic and biophysical techniques developed for yeast prions, we were able to characterize how the PrP octarepeats influence the conformational conversion and amyloid formation of these chimeric prion proteins both in vivo and in vitro.
We find that increasing the number of PrP repeats in the chimeric proteins increases the spontaneous appearance of the [PSI+] phenotype in vivo and accelerates amyloid formation in vitro. Conformational conversion and amyloid formation by the chimeras are modulated by both pH and the presence of metal ions. Further, the manner in which these factors modulate conversion is highly sensitive to the number of PrP repeats. Our work offers new insight into the role of the PrP octarepeats in amyloid formation and prion formation, with implications for prion structure. It also allows us to control protein assembly by simply altering environmental conditions. This control will be useful for further functional and structural work and could provide a practical means of controlling assembly for biomaterial and biotechnology applications.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
The first two PrP repeats were added to pRS306Sup35R1 by annealing two complementary oligonucleotides and inserting them between the BspE1 and EagI sites. To ensure high purity of these lengthy oligos, they were ordered PAGE-purified and phosphorylated from Research Genetics (oligo sequences 5'-CCGGATATCCACAAGGTGGAGGTACTTGGGGTCAACCCCATGGAGGTGGTTGGGGTCAACCACAAGGC-3' and 5'-GGCCGCCTTGTGGTTGACCCCAACCACCTCCGGGTTGACCCCAAGTACCTCCACCTTGTGGATAT-3'), and contained a BstXI site. The resulting plasmid was named pRS306Sup35R1+2. Subsequent repeats were added by inserting annealed oligos encoding three PrP repeats in the BstXI site (oligo sequences 5'-GAGGTTGGGGTCAACCCCATGGAGGAGGTTGGGGTCAACCCCATGGAGGTGGTTGGGGTCAACCCCATGGAG-3' and 5'-ATGGGGTTGACCCCAACCACCTCCATGGGGTTGACCCCAACCTCCTCCATGGGGTTGACCCCAACCTCCTCC-3'). The addition of one copy of these annealed oligos created pRS306Sup35R1+5. The oligos contained two BstXI sites, so digestion with BstXI and self-ligation created pRS306Sup35R1+4, while digestion with BstXI and insertion of another copy of the annealed oligos created pRS306Sup35R1+7. In a similar manner, pRS306Sup35R1+6 and pRS306Sup35R1+8 were created. All of these plasmids were sequenced through the repeat region to confirm accuracy.
The plasmids for the R1+8H1Q chimera were created by the same method, inserting oligos encoding PrP repeats in which the histidines were changed to glutamines into pRS306Sup35R1+2 (oligo sequences 5'-GAGGTTGGGGTCAACCC CAAGGAGGAGGTTGGGGTCAACCCCAAGGAGGTGGTTGGGGTCAACCCCAAGGAG-3' and 5'-TTGGGGTTGACCCCAACCACCTCCTT GGGGTTGACCCCAACCTCCTCCTTGGGGTTGACCCCAACCTCCTCC-3'). The plasmids pRS306Sup35R1+8H1Q was created in this manner and sequenced through the repeat region. Note that these plasmids still contained the one histidine that was present in the repeats in pRS306Sup35R1+2.
Bacterial expression constructs for R1+4, R1+8, and R1+8H1Q were created by excising the repeat region from the corresponding integration constructs with BstEII and MscI and ligating it into these sites in the expression construct pJC25NMstop (42). These constructs were named pJC25R1+4stop, pJC25R1+8stop and pJC25R1+8H1Q. These plasmids were sequenced through the repeat region to confirm accuracy.
Gene Integration and Replacement—The integration constructs were linearized with MluI and transformed into a [psi-] 74-D694 (genotype: ade1-14(UGA), trp1-289(UAG), his3
-200, ura3-52, leu2-3,112) strain. Transformants were selected on uracil-deficient medium (S.D.-Ura), and recombinant excision events were selected on medium containing 5-fluoroorotic acid. Strains in which the wild-type Sup35 gene had been replaced by the mutant copy were identified by PCR of a portion of the genomic Sup35 gene. The repeat region of the Sup35 gene was sequenced to confirm accuracy.
Spontaneous Appearance of [PSI+] in R1+X Yeast Strains—All R1+X strains were grown on YPD plates, and then inoculated in liquid YPD. After overnight growth, the cells were plated on ADE- at 0.7 x 106, 1.4 x 106, and 6 x 106 cells/plate. After 7 days of incubation, colonies were counted.
Protein Purification—Crude preparations of proteins were purified as previously described (43). Mass spectrometry analysis yielded the following masses: R1+4 was 27171.1 Da (calculated value is 27170.1 Da), R1+8 was 30277.6 Da (calculated value is 30277.3Da), and R1+8H1Q was 30222.9 Da (calculated value is 30223.3 Da). Protein concentrations were determined using the absorbance at 280 nm with molar extinction coefficients calculated as 25,600 (NM), 39400 (R1+4), 62160 (R1+8), and 62160 (R1+8H1Q).
Fiber Formation—Proteins were dissolved in 6 M guanidine hydrochloride as a stock solution, and the concentration was determined by the absorbance at 280 nm. Solutions for unseeded polymerization reactions were prepared by dilution of the stock solution into aqueous buffers and allowed to assemble at room temperature either with our without agitation. Seeds for seeded reactions were prepared by sonicating preformed fibers in a VWR Aquasonic 50T water bath sonicator, and all seeded reactions contained 2% (w/w) of the seeds.
The buffers for the tests at different pH values are: pH 7.2, 20 mM MOPS with 100 mM sodium chloride; pH 6.2, 5 mM potassium phosphate with 50 mM sodium sulfate; pH 4.9, 3.9, and 2.9, 5 mM potassium acetate with 50 mM sodium sulfate.
Cu(II) Binding Reactions—Lyophilized protein was first dissolved in acidified 25 mM NEM, 300 mM NaCl and spin filtered through a 300 kDa cutoff membrane. An appropriate volume of 100 mM CuCl2 in deionized water was added and samples were mixed. Then samples were diluted to 5-20 µM final protein concentration using 30 mM NEM pH 8.1. All EPR samples contained 20% (v/v) glycerol as a cryoprotectant.
Electron Spin Resonance Spectroscopy—X-band spectra (9.43 GHz) were acquired using a Bruker ELEXSYS E500 spectrometer and a TE102 cavity. Measurements were performed at
115-125K in a nitrogen vapor using cavity equipped with variable temperature control. The total bound Cu(II) was quantified by spin integration and comparison to accurate standard solutions containing Cu(II) in 10 mM imidazole at pH 7.4.
Thioflavin-T Binding—Fiber formation was monitored by Thioflavin-T (44) in both seeded and unseeded reactions (45). Attenuated Thioflavin T (ThT) intensity was observed at acidic pHs and in the presence of Cu(II), when SDS assay showed the same amount of free monomers left after polymerization reactions. ThT fluorescence intensity was baseline subtracted and then normalized to the maximum intensity when the polymerization reaction reached equilibrium.
Monitoring Fiber Formation by SDS Solubility—At the indicated time points, 20 µl of the assembly mix was withdrawn and added to SDS-PAGE sample buffer. Samples were run on 12.5% SDS-PAGE gels and stained with Coomassie Blue G-250. The percentage of soluble protein was calculated by (gel band intensity at indicated time point) divided by (gel band intensity of zero hour sample after boiling).
| RESULTS |
|---|
|
|
|---|
|
Increasing the Number of PrP Repeats Destabilizes Both the [psi-] and [PSI+] States—When wild-type cells are grown in YPD, they are stable in both the [PSI+] and the [psi-] states, and the rate of spontaneous conversion between these states is very low (7). To determine the stability of the [psi-] state in our mutant strains, we observed the spontaneous appearance of [PSI+] by streaking [psi-] cells on YPD followed by an S.D.-Ade plate. Wild-type Sup35 [psi-] strains produced colonies on S.D.-Ade medium rarely, approximately one per 106 cells/plate. R1+2, R1+4, R1+5, also rarely produced colonies. In contrast, colonies appeared
10-fold more frequently on S.D.-Ade medium with R1+6 and
100-fold more frequently with R1+7 and R1+8 strains. The colonies were confirmed as being true [PSI+] colonies by taking advantage of the fact that cells can be cured of the prion state by growing them on media containing guanidine hydrochloride. This produced red colonies that could not grow on S.D.-Ade medium. Thus, repeat expansion increased rate of spontaneous conversion from the [psi-] to the [PSI+] state.
Next we examined the spontaneous conversion of R1+X [PSI+] strains to [psi-]. To create [PSI+] strains of R1+2, R1+4, R1+5, and R1+6, large numbers of the [psi-] strains were plated on S.D.-Ade and colonies that grew were selected. All of the [PSI+] strains were confirmed by growth and curing in the presence of 5 mM Gdn·HCl. Fig. 1B shows the growth of R1+X strains in both [psi-] and [PSI+] states on YPD. When R1+2, R1+4, R1+5, and R1+6 [PSI+] strains were grown on YPD-rich medium, the colonies appeared white, and red colonies were rarely observed, similar to wild-type Sup35 [PSI+] strains. Thus, the [PSI+] states of R1+2, R1+4, R1+5, and R1+6 were maintained stably. However, R1+7 and R1+8 strains frequently converted to [psi-] on YPD plates, with the colonies sectoring to red around the perimeter. Thus, extra copies of the PrP octarepeats destabilize both the prion and non-prion states.
Increasing the Number of PrP Repeats Dramatically Accelerates Amyloid Formation in Vitro—Sup35 can be divided into three distinct regions, the N terminus with the oligopeptide repeats (amino acids 1-123), a highly charged middle region, and the C terminus (amino acids 254-685), which functions as a translation termination factor. The N terminus (N) and the middle region (M) of Sup35, often called NM, forms the prion-determining (PrD) domain. In vitro assembly of NM amyloid fibers recapitulates the induction and propagation of yeast prions in vivo (7, 39, 48, 49), and transformation of NM fibers into [psi-] yeast cells (50) induces the formation of yeast prion phenotypes (36, 39, 48). To examine the amyloidogenic properties of the R1+X proteins, we chose to purify the NM domains of wild-type Sup35, R1+4, and R1+8. Amyloid fibers formed by the R1+4 and R1+8 chimeras were examined by atomic force microscopy (AFM). They were morphologically indistinguishable from those formed by wild-type NM (supplemental Fig. S1).
The kinetics of amyloid formation were monitored both by a Thioflavin-T (ThT) binding assay and by an assay for resistance to solubilization by SDS (46). Wild-type NM or chimeric NMs were diluted from a 6 M Gdn·HCl stock solution into aqueous buffer and incubated at room temperature with agitation, a standard condition that accelerates assembly. Under these conditions, all of the proteins exhibited behavior typical of spontaneous, nucleated amyloid formation, with an initial lag phase followed by an assembly phase (Fig. 2A). However, wild-type NM and the chimeras exhibited very different lag times. Both chimeras with PrP repeats showed a shorter lag phase than wild-type NM. Moreover, R1+8 exhibited a shorter lag phase than R1+4. These experiments were performed many times with independent protein preparations. Although the absolute lag times varied somewhat from experiment to experiment, the differences between the behavior of three proteins were extremely consistent. This result indicates that the PrP octarepeat is more amyloidogenic than the Sup35 repeat, and that the number of PrP octarepeats can greatly alter the intrinsic capacity of the proteins to form amyloid.
|
Histidine Residues in the PrP Repeats Confer pH Sensitivity on Amyloid Formation—We then explored the factors that may affect the conformation of the repeat region and thereby the process of amyloid formation. Previous studies showed that conformational conversion of truncated PrPs free of the repeat region was sensitive to pH (51-53) and the remaining histidine residues in the truncated PrP were suggested to be crucial for this pH sensitivity (54). To our knowledge, the role of histidines in the octapepetide repeats has not been well tested. To examine the effect of pH on the spontaneous assembly of the chimeras, we used quiescent reaction conditions, which extend the lag phase. Amyloid formation by wild-type NM, R1+4 and R1+8 in buffers with different pH values was monitored by both ThT (Fig. 3A) and SDS (supplemental Fig. S2) assays. The lag phase of wild-type NM was insensitive to pH, with similar amyloid formation time courses at pH 7.2, 6.2, 4.9, 3.9, and 2.9. In contrast, lowering the pH lengthened the lag phase for both R1+4 and R1+8, with the effect especially profound for R1+8. The lag phase for R1+8 was less than 2 h at pH 7.2 and 6.2, but it was more than 10 h at pH 4.9 and more than 30 h at pH 2.9. We also investigated the effects of pH on seeded assembly (Fig. 3B and supplemental Fig. S3). The assembly rate of wild-type NM remained almost unchanged. However, the assembly rate of R1+4 and R1+8 decreased at lower pH. Moreover, R1+8 was more sensitive to pH changes than R1+4, particularly at pH 4.5.
To directly test whether the histidine residues are responsible for the pH dependence of assembly, we mutated the histidines in the repeat region of R1+8 to glutamines (changing PHGGGWGQ to PQGGGWGQ). Glutamine was chosen since it is present in the first imperfect repeat (PQGGGTWGQ) in the same location as the histidine in the subsequent PHGGGWGQ repeats (Fig. 1A). Because of details of the cloning procedure, the histidine was not removed from the second PrP repeat. Therefore, this new chimera contained only a single PrP repeat with histidine, and was named R1+8H1Q. The histidine replacement had no obvious effect on the function of the protein in vivo:R1+8H1Q strains supported both [PSI+] and [psi-] states, and the purified NM domain of R1+8H1Q formed amyloid fibers in vitro (supplemental Fig. S1). However, unlike the R1+4 and R1+8 proteins with histidines in the repeats, both the spontaneous nucleation rate and the assembly rate for amyloid formation by R1+8H1Q was almost unchanged across the entire tested pH range, from pH 7.2 to 2.9 (Fig. 3, A and B). Thus, the histidine residues are the primary source of the pH sensitivity of amyloid formation by the R1+4 and R1+8 proteins.
Interplay between Cu(II) and PrP Repeats Shows Complex Effects on Amyloid Formation in Vitro—It has been extensively shown that the PrP repeats can selectively bind Cu(II) ions (24, 55-58). Therefore, we explored the effect of Cu(II) on the conformational conversion and amyloid formation of the chimeras. First, we investigated the Cu(II)-binding sites in non-assembled NM and R1+X proteins by Electron Paramagnetic Resonance (EPR). EPR has been previously applied to determine the molecular features of the Cu(II)-binding sites in recombinant full-length Syrian hamster PrPC (59). Those results showed that Cu(II) coordination depends highly on the relative concentration of Cu(II) to PrPC (60). With excess amount of Cu(II), copper fully occupies individual repeat units, one Cu(II) per repeat unit, coordinating with the His imidazole and two deprotonated glycine amides (59, 61). The EPR spectra of Cu(II)-bound R1+4 and R1+8 are nearly indistinguishable from that of Cu(II)-bound recombinant PrPC at full occupancy (60), although in R1+8 there may be additional broadening in the parallel region (
2700 G-3100 G; Fig. 4). This broadening is possibly due to Cu(II)-Cu(II) dipolar interactions. On average, R1+4 bound 4-5 equivalents of Cu(II), and R1+8 bound up to 10 equivalents. Wild-type NM and R1+8H1Q bind Cu(II) at
2 and 4 equivalents, respectively. They might bind Cu(II) via histidine residues outside the octarepeat region, and/or the free amino group at the N terminus. R1+8H1Q retains a single histidine-containing repeat, which is also likely responsible for the additional Cu(II) binding compared with wild-type NM.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Curiously, expanding the number of repeats destabilized the [PSI+] and [psi-] states, increasing switching in both directions. Both results can be explained by our finding that R1+8 is more amyloidogenic than R1+4. In destabilizing the [psi-] state, it seems most likely that R1+8 simply converts spontaneously into the amyloid prion state, [PSI+], more frequently than does R1+4. But how might a greater propensity to form an amyloid destabilize the [PSI+] state? There are at least two likely possibilities based on our current findings. First, R1+8 amyloids may be too stable to be severed by Hsp104 for efficient transmission to daughter cells. A reduced partitioning rate would lead to the loss of [PSI+] (62). Second, the increased efficiency of amyloid conversion might sequester too much of the Sup35 essential translation-termination activity. This would provide a selective advantage to cells that switch to the [psi-] state. A third, alternative explanation is that the repeats interact with Hsp104 leading to increased disassembly of the prion (18).
In any case, the strong effects of repeat expansions are intriguing. We previously proposed that [PSI+] provides a mechanism for cells to switch heritably between distinct phenotypic states (63, 64). It may be that the number of repeats in Sup35, and the degree of their amyloidogenicity, has been subject to evolutionary pressures to optimize switching rates according to the frequency of environmental change.
The model substrates we have created allow multiple methods for interrogating the ways in which repeats can influence amyloid formation. As shown for wild-type NM, a collapsed oligomeric intermediate facilitates the intermolecular contacts required for nucleation (32, 36, 40, 65). In our chimeras, the structures populated by the collapsed intermediate can be modulated by the number of repeats, by pH and by metal ions, and each of these factors dramatically influences the lag time of unseeded polymerization. Thus, these substrates, together with new methods of single molecule fluorescence (66), should provide powerful new tools to study the biophysics of conformational conversion, both in nucleation and polymerization.
Indeed, results from the initial analysis reported here already have interesting implications. First, although wild-type NM and R1+4 have very different spontaneous nucleation rates they have virtually identical seeded polymerization rates. The increased amyloidogenicity of R1+4 compared with NM, then, is solely due to a change in spontaneous nucleation. Second, R1+4 and NM have much slower rates of seeded polymerization than R1+8. Third, and most strikingly, these very different rates of seeded polymerization are independent of the seed. That is, seeds formed by R1+8, by R1+4, or by wild-type NM cross-seed polymerization of all three proteins in the very same way. These results fit well with one structural model for NM fibers, but not another. In the model proposed by Shewmaker et al. (67), the residues of the N domain stack upon each other, with the repeat region forming an extensive intermolecular interface. Under this model, it would be hard to understand why replacing 38 amino acids (out of 123) in the N domain with 64 heterologous amino acids from the PrP protein, has virtually no effect on cross seeding activity. In the second model by Krishnan et al. (36), the repeat region is largely sequestered from intermolecular contacts. The repeats are envisioned as coiling upon each other during amyloid formation, which would be consistent with facilitated nucleation we observe with expanding the repeats. However, intermolecular contacts are primarily made by flanking regions in this model (36). Efficient cross-seeding between wild-type NM and the two chimeras would therefore be expected, since they contain the same sequences in the flanking regions for inter-molecular contacts (36, 40, 65).
Further study of these chimeric proteins might also help us understand the effects of the PrP repeats, pH and metal ions, on prion initiation by wild-type PrP. Although the repeats are outside the main amyloid core of PrP and lie within it in NM, their collapse into a compact, molten folding intermediate might affect PrP and NM nucleation in a similar way, by freeing flanking regions to make their critical nucleating contacts. Acidic conditions facilitate the conversion of the C-terminal segment of PrPC into aggregation-prone conformations (51-53), while the pH dependence of full-length PrP is not well established. Our chimeric proteins show decreased assembly rates under acidic conditions, and this effect is profound for proteins with repeat expansions. Such pH sensitivities may be of importance in disease since one compartment that might be involved in the conversion of PrPC to PrPSc is the acidic endosome (68, 69). The PrP repeats also interact with metal ions, especially Cu(II), which also has suggested roles in prion diseases (70, 71). Although our work does not directly address how such Cu(II)-repeat interactions affect conformational conversion in full-length PrP, it does provide strong evidence that Cu(II) (and Zn(II)) can induce a major conformational rearrangement in the repeats that can affect subsequent amyloid formation. The differential effect of Cu(II) ions on R1+4 versus R1+8 may be due to different binding environments of Cu(II) upon assembly (24, 56, 59-61, 72), although non-assembled R1+4 and R1+8 have similar coordination environments indicated by the EPR studies. On the other hand, EPR spectrum broadening was observed for the soluble R1+8 protein, suggesting a dipolar-dipolar interaction, which may result in a very different arrangement of the individual repeat units in R1+8 versus in R1+4. Potentially different arrangements of the repeat units could result in different collapse rates and/or stabilities of the oligomeric intermediates. Interestingly, Cu(II) stimulates endocytosis of wild-type PrPC in human neuroblastoma cells, whereas such an event is compromised with expanding the number of the repeats (26). Either deletion or expansion of the repeat region also interferes with Cu(II)-induced association of the PrP repeat region that is fused to a GST protein (17). Thus, more or less than the optimal number of four consecutive repeats results in profound changes in PrP structure and function, and this may be one influence on the high conservation of repeat number during evolution.
Efforts to understand and control the assembly of amyloidogenic proteins are inspired not only by their importance in diverse biological processes, but also their potential applications in nanotechnology (73, 74). NM fibers are stable under a wide variety of conditions and can incorporate a diversity of functions, including the binding of metals that allow them to form nanowires and electronic circuits (74). The NM chimeras with PrP repeats offer new methods for controlling assembly with pH and metal ions, and further raise the possibility of adapting such architectures for novel materials and biotechnological applications. For example, when the chimeras and wild-type NM are mixed together for assembly under different pH, different ratios of the chimeras and NM will be incorporated into individual fibers. If a single cysteine mutation is presented in the chimeras, but not in wild-type NM, different chemical moieties can be introduced via the cysteine on the chimeras but not on wild-type NM. As a result, controlled and fine-tuned patterning and mixing of chemical moieties covalently bound to the mixed fibers can be achieved. This will significantly broaden functional diversity and specificity of these self-assembly-based nanomaterials. In sum, modification of NM by substituting the endogenous repeats with those of PrP has provided insights on assembly that offer additional promise for the future.
| FOOTNOTES |
|---|
The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1-S5. ![]()
1 Present address: Division of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena, CA. ![]()
2 Present address: Francis Bitter Magnet Laboratory/MIT, Cambridge, MA. ![]()
3 To whom correspondence should be addressed: Whitehead Institute for Biomedical Research, Cambridge, MA 02142-1479. Tel.: 617-258-5184; Fax: 617-258-7226; E-mail: lindquist_admin{at}wi.mit.edu.
4 The abbreviations used are: PrPC, cellular prion protein; PrPSc, pathological isoform of cellular prion protein; EPR, electron paramagnetic resonance; YPD, yeast peptone dextrose medium; AFM, atomic force microscopy; ThT, Thioflavin T; GST, glutathione S-transferase; MOPS, 4-morpholinepropanesulfonic acid; AFM, atomic force microscopy; ThT, thioflavin-T; SOD, superoxide dismutase. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|